ID: 1100784511

View in Genome Browser
Species Human (GRCh38)
Location 12:98064890-98064912
Sequence TGCACAGTGTGAGTTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100784506_1100784511 3 Left 1100784506 12:98064864-98064886 CCAAAAACTCACTCTCCCCCAAA No data
Right 1100784511 12:98064890-98064912 TGCACAGTGTGAGTTGTTACTGG No data
1100784505_1100784511 6 Left 1100784505 12:98064861-98064883 CCACCAAAAACTCACTCTCCCCC No data
Right 1100784511 12:98064890-98064912 TGCACAGTGTGAGTTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100784511 Original CRISPR TGCACAGTGTGAGTTGTTAC TGG Intergenic
No off target data available for this crispr