ID: 1100790582

View in Genome Browser
Species Human (GRCh38)
Location 12:98125934-98125956
Sequence CTTGGATGGCACCTTGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100790582_1100790589 19 Left 1100790582 12:98125934-98125956 CCAAATTCAAGGTGCCATCCAAG No data
Right 1100790589 12:98125976-98125998 TATAGGAGAGAATCCTTCATGGG No data
1100790582_1100790588 18 Left 1100790582 12:98125934-98125956 CCAAATTCAAGGTGCCATCCAAG No data
Right 1100790588 12:98125975-98125997 CTATAGGAGAGAATCCTTCATGG No data
1100790582_1100790586 2 Left 1100790582 12:98125934-98125956 CCAAATTCAAGGTGCCATCCAAG No data
Right 1100790586 12:98125959-98125981 ATTATCCTTCTGAAAACTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100790582 Original CRISPR CTTGGATGGCACCTTGAATT TGG (reversed) Intergenic
No off target data available for this crispr