ID: 1100792852

View in Genome Browser
Species Human (GRCh38)
Location 12:98149706-98149728
Sequence AACGTGTGTGGTTCCCTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100792845_1100792852 29 Left 1100792845 12:98149654-98149676 CCTCTTCTAAGTGACTTTTTTAA No data
Right 1100792852 12:98149706-98149728 AACGTGTGTGGTTCCCTGTATGG No data
1100792848_1100792852 -8 Left 1100792848 12:98149691-98149713 CCACCCAAGAGGGACAACGTGTG No data
Right 1100792852 12:98149706-98149728 AACGTGTGTGGTTCCCTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100792852 Original CRISPR AACGTGTGTGGTTCCCTGTA TGG Intergenic
No off target data available for this crispr