ID: 1100793124

View in Genome Browser
Species Human (GRCh38)
Location 12:98152440-98152462
Sequence GCCATAGGTATGTGGGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100793124_1100793134 13 Left 1100793124 12:98152440-98152462 CCTGTTCCCCACATACCTATGGC No data
Right 1100793134 12:98152476-98152498 GAAACCTATGGGGGTTCAACTGG No data
1100793124_1100793136 20 Left 1100793124 12:98152440-98152462 CCTGTTCCCCACATACCTATGGC No data
Right 1100793136 12:98152483-98152505 ATGGGGGTTCAACTGGACAAAGG No data
1100793124_1100793130 2 Left 1100793124 12:98152440-98152462 CCTGTTCCCCACATACCTATGGC No data
Right 1100793130 12:98152465-98152487 CACAGACTCCTGAAACCTATGGG No data
1100793124_1100793129 1 Left 1100793124 12:98152440-98152462 CCTGTTCCCCACATACCTATGGC No data
Right 1100793129 12:98152464-98152486 TCACAGACTCCTGAAACCTATGG No data
1100793124_1100793131 3 Left 1100793124 12:98152440-98152462 CCTGTTCCCCACATACCTATGGC No data
Right 1100793131 12:98152466-98152488 ACAGACTCCTGAAACCTATGGGG No data
1100793124_1100793137 21 Left 1100793124 12:98152440-98152462 CCTGTTCCCCACATACCTATGGC No data
Right 1100793137 12:98152484-98152506 TGGGGGTTCAACTGGACAAAGGG No data
1100793124_1100793138 27 Left 1100793124 12:98152440-98152462 CCTGTTCCCCACATACCTATGGC No data
Right 1100793138 12:98152490-98152512 TTCAACTGGACAAAGGGAAAAGG No data
1100793124_1100793132 4 Left 1100793124 12:98152440-98152462 CCTGTTCCCCACATACCTATGGC No data
Right 1100793132 12:98152467-98152489 CAGACTCCTGAAACCTATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100793124 Original CRISPR GCCATAGGTATGTGGGGAAC AGG (reversed) Intergenic
No off target data available for this crispr