ID: 1100793132

View in Genome Browser
Species Human (GRCh38)
Location 12:98152467-98152489
Sequence CAGACTCCTGAAACCTATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100793122_1100793132 7 Left 1100793122 12:98152437-98152459 CCACCTGTTCCCCACATACCTAT No data
Right 1100793132 12:98152467-98152489 CAGACTCCTGAAACCTATGGGGG No data
1100793125_1100793132 -2 Left 1100793125 12:98152446-98152468 CCCCACATACCTATGGCTTCACA No data
Right 1100793132 12:98152467-98152489 CAGACTCCTGAAACCTATGGGGG No data
1100793127_1100793132 -4 Left 1100793127 12:98152448-98152470 CCACATACCTATGGCTTCACAGA No data
Right 1100793132 12:98152467-98152489 CAGACTCCTGAAACCTATGGGGG No data
1100793126_1100793132 -3 Left 1100793126 12:98152447-98152469 CCCACATACCTATGGCTTCACAG No data
Right 1100793132 12:98152467-98152489 CAGACTCCTGAAACCTATGGGGG No data
1100793124_1100793132 4 Left 1100793124 12:98152440-98152462 CCTGTTCCCCACATACCTATGGC No data
Right 1100793132 12:98152467-98152489 CAGACTCCTGAAACCTATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100793132 Original CRISPR CAGACTCCTGAAACCTATGG GGG Intergenic
No off target data available for this crispr