ID: 1100794403

View in Genome Browser
Species Human (GRCh38)
Location 12:98164984-98165006
Sequence TTCTTAGCAACCCTCTGTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100794402_1100794403 3 Left 1100794402 12:98164958-98164980 CCAATTCGTAGCTTAGATGTAAA No data
Right 1100794403 12:98164984-98165006 TTCTTAGCAACCCTCTGTTATGG No data
1100794401_1100794403 4 Left 1100794401 12:98164957-98164979 CCCAATTCGTAGCTTAGATGTAA No data
Right 1100794403 12:98164984-98165006 TTCTTAGCAACCCTCTGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100794403 Original CRISPR TTCTTAGCAACCCTCTGTTA TGG Intergenic