ID: 1100796046

View in Genome Browser
Species Human (GRCh38)
Location 12:98182850-98182872
Sequence GCCCAGTAAAAGAGTTTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100796046_1100796047 -5 Left 1100796046 12:98182850-98182872 CCTCTTAAACTCTTTTACTGGGC No data
Right 1100796047 12:98182868-98182890 TGGGCAGTAAAGCTAAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100796046 Original CRISPR GCCCAGTAAAAGAGTTTAAG AGG (reversed) Intergenic
No off target data available for this crispr