ID: 1100809556

View in Genome Browser
Species Human (GRCh38)
Location 12:98324993-98325015
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100809547_1100809556 9 Left 1100809547 12:98324961-98324983 CCAGTAGCAGCAACGGACATCCC No data
Right 1100809556 12:98324993-98325015 CAAGTGGTCCACATTGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100809556 Original CRISPR CAAGTGGTCCACATTGGTGT TGG Intergenic
No off target data available for this crispr