ID: 1100810371

View in Genome Browser
Species Human (GRCh38)
Location 12:98331281-98331303
Sequence CATTGTAGAGCCCAACATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100810371_1100810373 -3 Left 1100810371 12:98331281-98331303 CCTTAATGTTGGGCTCTACAATG No data
Right 1100810373 12:98331301-98331323 ATGTGGCTTGTTTTCTTCAGTGG No data
1100810371_1100810374 1 Left 1100810371 12:98331281-98331303 CCTTAATGTTGGGCTCTACAATG No data
Right 1100810374 12:98331305-98331327 GGCTTGTTTTCTTCAGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100810371 Original CRISPR CATTGTAGAGCCCAACATTA AGG (reversed) Intergenic
No off target data available for this crispr