ID: 1100810374

View in Genome Browser
Species Human (GRCh38)
Location 12:98331305-98331327
Sequence GGCTTGTTTTCTTCAGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100810371_1100810374 1 Left 1100810371 12:98331281-98331303 CCTTAATGTTGGGCTCTACAATG No data
Right 1100810374 12:98331305-98331327 GGCTTGTTTTCTTCAGTGGCAGG No data
1100810370_1100810374 2 Left 1100810370 12:98331280-98331302 CCCTTAATGTTGGGCTCTACAAT No data
Right 1100810374 12:98331305-98331327 GGCTTGTTTTCTTCAGTGGCAGG No data
1100810366_1100810374 30 Left 1100810366 12:98331252-98331274 CCTCATCATGAGCAGAATGTATT No data
Right 1100810374 12:98331305-98331327 GGCTTGTTTTCTTCAGTGGCAGG No data
1100810369_1100810374 6 Left 1100810369 12:98331276-98331298 CCTGCCCTTAATGTTGGGCTCTA No data
Right 1100810374 12:98331305-98331327 GGCTTGTTTTCTTCAGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100810374 Original CRISPR GGCTTGTTTTCTTCAGTGGC AGG Intergenic
No off target data available for this crispr