ID: 1100815034

View in Genome Browser
Species Human (GRCh38)
Location 12:98378678-98378700
Sequence CAGTGTGGGTGAAGTGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100815034_1100815039 2 Left 1100815034 12:98378678-98378700 CCCACTTCACTTCACCCACACTG No data
Right 1100815039 12:98378703-98378725 CTCTTTGCTGTTCCTTAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100815034 Original CRISPR CAGTGTGGGTGAAGTGAAGT GGG (reversed) Intergenic
No off target data available for this crispr