ID: 1100819613

View in Genome Browser
Species Human (GRCh38)
Location 12:98419106-98419128
Sequence TCCTGCCCTTCTCTTTAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100819609_1100819613 12 Left 1100819609 12:98419071-98419093 CCTAAGCTCTTCTTCGTAAAAAA No data
Right 1100819613 12:98419106-98419128 TCCTGCCCTTCTCTTTAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100819613 Original CRISPR TCCTGCCCTTCTCTTTAGGG TGG Intergenic
No off target data available for this crispr