ID: 1100831799

View in Genome Browser
Species Human (GRCh38)
Location 12:98523143-98523165
Sequence CATGATTAGCAGTTTCAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100831799 Original CRISPR CATGATTAGCAGTTTCAGTC AGG (reversed) Intronic
915826985 1:159088405-159088427 CATGACTTACAGCTTCAGTCTGG + Intronic
916326163 1:163562275-163562297 CATGAGAAGTAGCTTCAGTCAGG + Intergenic
923208704 1:231783495-231783517 CATGAATTACAGTTTCAGTTTGG + Intronic
923980095 1:239311828-239311850 AATGCTTAGCAGTTACAATCTGG - Intergenic
1063164273 10:3445679-3445701 CATAATTGGCAATTTCAGGCAGG + Intergenic
1065809215 10:29425874-29425896 CAGGATTAGAACTTTCACTCTGG - Intergenic
1069847374 10:71381846-71381868 CATGCTTAGCACTTTCAATAAGG + Intergenic
1076360186 10:129882897-129882919 CATGATTAGTGGCTTCAGTTAGG - Intronic
1076397081 10:130147516-130147538 CATGAGTGGCAGGTGCAGTCAGG - Intronic
1079082108 11:17420828-17420850 CAAGATTAGCAGATACACTCGGG - Intronic
1081391310 11:42532483-42532505 TATGATTAGCAGTTTGATTATGG - Intergenic
1082881447 11:58041874-58041896 CATGATAAGCAGCTGCTGTCAGG - Intronic
1082961464 11:58922241-58922263 CAGGTTGAGCTGTTTCAGTCTGG + Intronic
1086789003 11:91010866-91010888 CATGTTTAGCATTTTTAGTATGG - Intergenic
1088263375 11:107966361-107966383 CAAGATGAGCAGTTTCCATCAGG - Intergenic
1088970929 11:114774164-114774186 CATGTTTCTGAGTTTCAGTCTGG + Intergenic
1089925978 11:122258181-122258203 CATGATTAGCAGCATCAGAGGGG - Intergenic
1090993827 11:131846794-131846816 CAGGATTAGCAGTGTCTCTCAGG + Intronic
1091254740 11:134173455-134173477 GATGATGAGGAGTTTCTGTCCGG - Intronic
1100831799 12:98523143-98523165 CATGATTAGCAGTTTCAGTCAGG - Intronic
1106986277 13:35355380-35355402 CATGACTAGTGGTTACAGTCTGG - Intronic
1108745502 13:53389297-53389319 GATGATTAGAAGTTTCAATGGGG + Intergenic
1111283782 13:86062816-86062838 CATTATTAGCAGTTCCAGAAGGG + Intergenic
1111899043 13:94178621-94178643 AATGATTTGCATTTTCATTCTGG - Intronic
1113334737 13:109366977-109366999 CATGATTCCCAGCTTCACTCAGG - Intergenic
1120383681 14:83816713-83816735 AATGATTAGTAGTTTGAGTAGGG + Intergenic
1121504818 14:94469020-94469042 CATGTTTACCAGTTACAGTAGGG - Intronic
1124063619 15:26319340-26319362 CATGAATAGCAATTACAGACTGG + Intergenic
1129749498 15:78051139-78051161 CATGATAAGCAGTTTGTGGCTGG - Intronic
1130159117 15:81381258-81381280 CATGAAGAGCTTTTTCAGTCAGG - Intergenic
1133603616 16:7364451-7364473 CATTATTAGCAGTATCAGGTTGG + Intronic
1137415037 16:48268355-48268377 CATGATTAACACATTCAGTAAGG - Intronic
1142843736 17:2655138-2655160 AATGATCAGCAATTTCATTCTGG - Intronic
1143676530 17:8436566-8436588 GATGATTAGCAGTTCCGGGCGGG - Intronic
1145293333 17:21567771-21567793 CAAGATTTTCAGTTTCACTCTGG + Intronic
1145386639 17:22418166-22418188 CAAGATTTTCAGTTTCAATCTGG - Intergenic
1148804948 17:50259312-50259334 CAAGATTAGCAGGTTCAAACTGG - Intergenic
1149010628 17:51853220-51853242 CCTGATTAGCAGTTTCTGTGGGG - Intronic
1155065589 18:22266332-22266354 CACAATTATCAGTTTCTGTCTGG - Intergenic
1160133412 18:76249935-76249957 CATCATTGGCAGTGTCTGTCAGG - Intergenic
1168315747 19:55484102-55484124 GATGATGAGGAGTTTCTGTCCGG - Exonic
925301216 2:2814132-2814154 CATGATTGGCAGTATCATTCTGG - Intergenic
944076523 2:195738451-195738473 CATGATTCTCAGTATCAGTGTGG - Intronic
947894319 2:233655433-233655455 CATCATTAGCAGATTCAGAAGGG + Intronic
1173697061 20:45026890-45026912 TATGATTAGCAGTGGCAGCCTGG - Intronic
1179675867 21:42981759-42981781 AATGATTGGCTGTTTTAGTCGGG + Intronic
950042342 3:9928338-9928360 CAGGGTCAGCAGTTGCAGTCGGG - Exonic
971659742 4:29398077-29398099 TATTTTTAGCATTTTCAGTCTGG + Intergenic
972020457 4:34307060-34307082 CATGATTATCACTTTCAGTTTGG + Intergenic
974883046 4:67783189-67783211 TAGGATTAGCACTTTCAGTTTGG + Intergenic
977121578 4:93107827-93107849 AATGAAAAGCAGTTTAAGTCTGG - Intronic
977344810 4:95804191-95804213 AAGGATTAGCTGTTTCAGCCAGG + Intergenic
981318073 4:143361445-143361467 CCTGACTTGCAGTATCAGTCAGG + Intronic
987253972 5:16129341-16129363 CATGATTAGCAGTGTTTGTTTGG + Intronic
990787184 5:59434779-59434801 CCTGATTAGCAGTTATTGTCTGG - Intronic
993930209 5:93929111-93929133 CATGATTAGAAATTTGATTCTGG - Intronic
997170321 5:131712875-131712897 CTAGATGAGCAGTTTCAGTGGGG - Intronic
998655269 5:144171460-144171482 CATTATTAACATTTTGAGTCAGG + Intronic
998985690 5:147753915-147753937 TATGATTTGGAGTTTCACTCTGG - Intronic
1001009513 5:168085387-168085409 CATGATGAGCTGCTACAGTCTGG + Intronic
1004139405 6:13001857-13001879 CATCACTGGAAGTTTCAGTCTGG + Intronic
1004974420 6:20949258-20949280 CAAGATTAGCAGTCTCACTTAGG - Intronic
1005416151 6:25602418-25602440 CATGATTAACAGTTTCTTTTTGG + Intronic
1006998437 6:38285086-38285108 CATGATTAGTAGTTCCCTTCAGG - Intronic
1011977831 6:93328050-93328072 CATGTTTAGCATGTTCAGTGGGG - Intronic
1017683580 6:156888533-156888555 CAAAATTACCAGTTACAGTCTGG + Intronic
1020983373 7:15100338-15100360 CTTGAATAGCTTTTTCAGTCTGG - Intergenic
1021828546 7:24578933-24578955 CATGATTTGCAGTTTGATTGAGG + Intronic
1022102890 7:27179612-27179634 CAAGTTTAGCAATTTCAGTCTGG - Intronic
1028721032 7:94031925-94031947 CATGTTTATTAGTTTCACTCTGG + Intergenic
1032013955 7:128364408-128364430 CATTTTCAGCATTTTCAGTCTGG - Intergenic
1032053373 7:128664045-128664067 CATGTTTGGCAGTTATAGTCAGG + Intergenic
1036632203 8:10523877-10523899 CATGAGTAGCAGGTCCAGTGGGG + Intergenic
1037050931 8:14373285-14373307 CATAATTAACAGTTTCATTTTGG + Intronic
1041530664 8:58862579-58862601 CTTTATTAGAAGTTTGAGTCAGG - Intronic
1043888648 8:85631860-85631882 CATGGTTAGGAGTTGCTGTCAGG + Intergenic
1047013448 8:120697454-120697476 CATGATTAGAAGTTTAAGCCAGG + Intronic
1050151053 9:2620303-2620325 CATGCTTAGCAGTCACAATCAGG + Intergenic
1050709824 9:8448655-8448677 AATGTTTAGCATTTTCAGTGTGG - Intronic
1055256361 9:74376436-74376458 CATGCTTTGCATTTTCATTCAGG - Intergenic
1057170769 9:92961721-92961743 AATGATCCTCAGTTTCAGTCAGG - Intronic
1060295501 9:122340469-122340491 CATTATTAGCAGTGTGATTCAGG - Intergenic
1190897667 X:54637131-54637153 CTTGATTATCAGTTTCTGTAGGG + Intergenic
1197418963 X:126213351-126213373 CATGAATTGCTGTTTCATTCTGG - Intergenic
1200281263 X:154778903-154778925 CTTGATTAGCAGTTACATTTTGG + Exonic
1200404706 Y:2797982-2798004 CATGATTAGCACTTGCGGGCTGG - Intergenic