ID: 1100837480

View in Genome Browser
Species Human (GRCh38)
Location 12:98580343-98580365
Sequence ATCCTAGCTACTTGGAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100837477_1100837480 2 Left 1100837477 12:98580318-98580340 CCGGGCGTAGTGGCAGGTGCCTG 0: 101
1: 3667
2: 23041
3: 57738
4: 110001
Right 1100837480 12:98580343-98580365 ATCCTAGCTACTTGGAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100837480 Original CRISPR ATCCTAGCTACTTGGAATGC TGG Intergenic
No off target data available for this crispr