ID: 1100837955

View in Genome Browser
Species Human (GRCh38)
Location 12:98585079-98585101
Sequence GCCTAAAACCATCTGTGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100837954_1100837955 2 Left 1100837954 12:98585054-98585076 CCTTAGTAAAACAGAATCTTTTG No data
Right 1100837955 12:98585079-98585101 GCCTAAAACCATCTGTGTCTTGG No data
1100837953_1100837955 19 Left 1100837953 12:98585037-98585059 CCAGGACACTTCATCAGCCTTAG No data
Right 1100837955 12:98585079-98585101 GCCTAAAACCATCTGTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100837955 Original CRISPR GCCTAAAACCATCTGTGTCT TGG Intergenic
No off target data available for this crispr