ID: 1100839075

View in Genome Browser
Species Human (GRCh38)
Location 12:98593852-98593874
Sequence CGCCCTTGAAGAGGTCACGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 84}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100839075_1100839082 -3 Left 1100839075 12:98593852-98593874 CCGCCGTGACCTCTTCAAGGGCG 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1100839082 12:98593872-98593894 GCGTGGAGACGGGAAGGAAAAGG 0: 1
1: 0
2: 7
3: 34
4: 411
1100839075_1100839086 9 Left 1100839075 12:98593852-98593874 CCGCCGTGACCTCTTCAAGGGCG 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1100839086 12:98593884-98593906 GAAGGAAAAGGCCCCGGTTGGGG 0: 1
1: 0
2: 0
3: 14
4: 137
1100839075_1100839081 -9 Left 1100839075 12:98593852-98593874 CCGCCGTGACCTCTTCAAGGGCG 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1100839081 12:98593866-98593888 TCAAGGGCGTGGAGACGGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 191
1100839075_1100839083 3 Left 1100839075 12:98593852-98593874 CCGCCGTGACCTCTTCAAGGGCG 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1100839083 12:98593878-98593900 AGACGGGAAGGAAAAGGCCCCGG 0: 1
1: 0
2: 0
3: 32
4: 321
1100839075_1100839087 16 Left 1100839075 12:98593852-98593874 CCGCCGTGACCTCTTCAAGGGCG 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1100839087 12:98593891-98593913 AAGGCCCCGGTTGGGGTTCCAGG 0: 1
1: 0
2: 0
3: 13
4: 92
1100839075_1100839092 23 Left 1100839075 12:98593852-98593874 CCGCCGTGACCTCTTCAAGGGCG 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1100839092 12:98593898-98593920 CGGTTGGGGTTCCAGGGCGCCGG 0: 1
1: 0
2: 2
3: 8
4: 100
1100839075_1100839085 8 Left 1100839075 12:98593852-98593874 CCGCCGTGACCTCTTCAAGGGCG 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1100839085 12:98593883-98593905 GGAAGGAAAAGGCCCCGGTTGGG 0: 1
1: 0
2: 0
3: 15
4: 148
1100839075_1100839084 7 Left 1100839075 12:98593852-98593874 CCGCCGTGACCTCTTCAAGGGCG 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1100839084 12:98593882-98593904 GGGAAGGAAAAGGCCCCGGTTGG 0: 1
1: 0
2: 7
3: 22
4: 221
1100839075_1100839088 17 Left 1100839075 12:98593852-98593874 CCGCCGTGACCTCTTCAAGGGCG 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1100839088 12:98593892-98593914 AGGCCCCGGTTGGGGTTCCAGGG 0: 1
1: 0
2: 1
3: 8
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100839075 Original CRISPR CGCCCTTGAAGAGGTCACGG CGG (reversed) Intronic