ID: 1100839078

View in Genome Browser
Species Human (GRCh38)
Location 12:98593861-98593883
Sequence CCGTCTCCACGCCCTTGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 53}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100839078_1100839088 8 Left 1100839078 12:98593861-98593883 CCTCTTCAAGGGCGTGGAGACGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1100839088 12:98593892-98593914 AGGCCCCGGTTGGGGTTCCAGGG 0: 1
1: 0
2: 1
3: 8
4: 128
1100839078_1100839085 -1 Left 1100839078 12:98593861-98593883 CCTCTTCAAGGGCGTGGAGACGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1100839085 12:98593883-98593905 GGAAGGAAAAGGCCCCGGTTGGG 0: 1
1: 0
2: 0
3: 15
4: 148
1100839078_1100839087 7 Left 1100839078 12:98593861-98593883 CCTCTTCAAGGGCGTGGAGACGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1100839087 12:98593891-98593913 AAGGCCCCGGTTGGGGTTCCAGG 0: 1
1: 0
2: 0
3: 13
4: 92
1100839078_1100839083 -6 Left 1100839078 12:98593861-98593883 CCTCTTCAAGGGCGTGGAGACGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1100839083 12:98593878-98593900 AGACGGGAAGGAAAAGGCCCCGG 0: 1
1: 0
2: 0
3: 32
4: 321
1100839078_1100839094 27 Left 1100839078 12:98593861-98593883 CCTCTTCAAGGGCGTGGAGACGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1100839094 12:98593911-98593933 AGGGCGCCGGTAACGTTAACCGG 0: 1
1: 0
2: 0
3: 0
4: 6
1100839078_1100839084 -2 Left 1100839078 12:98593861-98593883 CCTCTTCAAGGGCGTGGAGACGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1100839084 12:98593882-98593904 GGGAAGGAAAAGGCCCCGGTTGG 0: 1
1: 0
2: 7
3: 22
4: 221
1100839078_1100839086 0 Left 1100839078 12:98593861-98593883 CCTCTTCAAGGGCGTGGAGACGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1100839086 12:98593884-98593906 GAAGGAAAAGGCCCCGGTTGGGG 0: 1
1: 0
2: 0
3: 14
4: 137
1100839078_1100839092 14 Left 1100839078 12:98593861-98593883 CCTCTTCAAGGGCGTGGAGACGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1100839092 12:98593898-98593920 CGGTTGGGGTTCCAGGGCGCCGG 0: 1
1: 0
2: 2
3: 8
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100839078 Original CRISPR CCGTCTCCACGCCCTTGAAG AGG (reversed) Intronic