ID: 1100839078

View in Genome Browser
Species Human (GRCh38)
Location 12:98593861-98593883
Sequence CCGTCTCCACGCCCTTGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 53}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100839078_1100839085 -1 Left 1100839078 12:98593861-98593883 CCTCTTCAAGGGCGTGGAGACGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1100839085 12:98593883-98593905 GGAAGGAAAAGGCCCCGGTTGGG 0: 1
1: 0
2: 0
3: 15
4: 148
1100839078_1100839084 -2 Left 1100839078 12:98593861-98593883 CCTCTTCAAGGGCGTGGAGACGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1100839084 12:98593882-98593904 GGGAAGGAAAAGGCCCCGGTTGG 0: 1
1: 0
2: 7
3: 22
4: 221
1100839078_1100839092 14 Left 1100839078 12:98593861-98593883 CCTCTTCAAGGGCGTGGAGACGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1100839092 12:98593898-98593920 CGGTTGGGGTTCCAGGGCGCCGG 0: 1
1: 0
2: 2
3: 8
4: 100
1100839078_1100839088 8 Left 1100839078 12:98593861-98593883 CCTCTTCAAGGGCGTGGAGACGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1100839088 12:98593892-98593914 AGGCCCCGGTTGGGGTTCCAGGG 0: 1
1: 0
2: 1
3: 8
4: 128
1100839078_1100839083 -6 Left 1100839078 12:98593861-98593883 CCTCTTCAAGGGCGTGGAGACGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1100839083 12:98593878-98593900 AGACGGGAAGGAAAAGGCCCCGG 0: 1
1: 0
2: 0
3: 32
4: 321
1100839078_1100839094 27 Left 1100839078 12:98593861-98593883 CCTCTTCAAGGGCGTGGAGACGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1100839094 12:98593911-98593933 AGGGCGCCGGTAACGTTAACCGG 0: 1
1: 0
2: 0
3: 0
4: 6
1100839078_1100839086 0 Left 1100839078 12:98593861-98593883 CCTCTTCAAGGGCGTGGAGACGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1100839086 12:98593884-98593906 GAAGGAAAAGGCCCCGGTTGGGG 0: 1
1: 0
2: 0
3: 14
4: 137
1100839078_1100839087 7 Left 1100839078 12:98593861-98593883 CCTCTTCAAGGGCGTGGAGACGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1100839087 12:98593891-98593913 AAGGCCCCGGTTGGGGTTCCAGG 0: 1
1: 0
2: 0
3: 13
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100839078 Original CRISPR CCGTCTCCACGCCCTTGAAG AGG (reversed) Intronic
915668867 1:157470395-157470417 CCTTCTCCACTCCCTGGCAGAGG + Intergenic
921589326 1:216985317-216985339 CCACCTCCACGCACTGGAAGAGG + Intronic
1063456361 10:6185458-6185480 CCGTCTCCTCGCCCCCGCAGTGG - Intronic
1063566912 10:7179314-7179336 CCCTCTCCGTGCCTTTGAAGAGG + Intronic
1067084561 10:43230918-43230940 CTGTCTCCAGGCCCTTGAGCTGG - Intronic
1077218318 11:1404343-1404365 CCGTGGCCACTCCCCTGAAGAGG - Intronic
1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG + Intronic
1089138507 11:116268291-116268313 CCTCCTCCAGGCCCTTGAGGGGG + Intergenic
1090848038 11:130546710-130546732 CCTTCCCCACTCCCTTGCAGGGG - Intergenic
1091259847 11:134225236-134225258 CCGTCTCCCCGTCGTAGAAGAGG - Exonic
1092881877 12:12893020-12893042 ACCTCTCCACGCCCTTGGAGAGG - Intronic
1094218469 12:27970172-27970194 ATGTCTCCCCGCCCGTGAAGCGG - Exonic
1098994469 12:77102991-77103013 CAGGCTCAACACCCTTGAAGTGG + Intergenic
1099491294 12:83292006-83292028 CCTTCTCCACCCCCTGGCAGTGG + Intergenic
1100839078 12:98593861-98593883 CCGTCTCCACGCCCTTGAAGAGG - Intronic
1108127148 13:47256851-47256873 CCATTTCCACACCCCTGAAGAGG + Intergenic
1117272555 14:54159697-54159719 CCTTCTCCAGGACCTTGAAGGGG - Intergenic
1124429142 15:29591294-29591316 CCGTCTTCATGCCCTGGAAGGGG + Intergenic
1126370930 15:47946333-47946355 ACCTCTCCAAGCCCTTGCAGAGG + Intergenic
1129450450 15:75648330-75648352 CCCTCTCCCCGCCCCAGAAGTGG - Exonic
1132802756 16:1762377-1762399 CCATCTCCACCCGCGTGAAGCGG - Exonic
1135554511 16:23424845-23424867 CCCTCTCCACGCCGTTGCTGAGG + Exonic
1136049485 16:27640343-27640365 CCACCTCCACGCCCTTGCAAGGG - Intronic
1145960526 17:28884263-28884285 CCGTCTCTACGTCCTCGCAGCGG + Exonic
1148767216 17:50046400-50046422 GCTTCTCCAGGCCCTAGAAGTGG + Intergenic
1151770816 17:76159464-76159486 CCATCTCCAAGCACGTGAAGTGG + Exonic
1152412523 17:80135347-80135369 CCGTCTCCCTTCCTTTGAAGAGG - Exonic
1156361863 18:36390789-36390811 GATTCTCCACTCCCTTGAAGGGG + Intronic
928276024 2:29900656-29900678 CCATCTACACGCCCTTGACTGGG + Intronic
940864157 2:158800520-158800542 CTGTCTCCACGTCCTTCAATGGG - Intronic
1173972832 20:47165739-47165761 CCCTCTCCAGCCCCTTGAAAGGG - Intronic
1175751397 20:61500410-61500432 CCCTCTCCACGCCCGTGATGTGG - Intronic
1178321501 21:31609592-31609614 CCTTCTCCAGGCCCTTGAGCTGG - Intergenic
1183702974 22:39460192-39460214 CCATCTCCAAGCCCTTCATGTGG + Intronic
954752892 3:52823621-52823643 CCATCTCTGAGCCCTTGAAGAGG + Exonic
955057545 3:55470178-55470200 CCGTCTGCACGGTCTTGAACTGG + Exonic
962418805 3:135208898-135208920 CCCTCTCCAGGCCTTGGAAGGGG - Intronic
973512432 4:51494678-51494700 CTTTCTCCACTCCCTGGAAGTGG + Intergenic
976282052 4:83335062-83335084 CCATCTCCGCACCCTTCAAGTGG - Exonic
985578145 5:683188-683210 CAGTCTCCTCATCCTTGAAGGGG + Intronic
985593075 5:775329-775351 CAGTCTCCTCATCCTTGAAGGGG + Intergenic
1001322969 5:170698108-170698130 CCCTCTCCAGGACCTAGAAGAGG + Intronic
1001401523 5:171449187-171449209 CCGTCTCCTTGCCCTTGATCCGG - Exonic
1012420822 6:99063454-99063476 GCGTCTCCACTGCCTGGAAGGGG + Intergenic
1014270949 6:119335388-119335410 CCCTTTCCACGCCTTTGAAATGG - Intronic
1018833376 6:167463450-167463472 TTGTCTCCACGCCCTTGAGTTGG - Intergenic
1019042373 6:169117869-169117891 CTGTCTCGAGGCCCGTGAAGTGG + Intergenic
1024742808 7:52373035-52373057 CCTTCTCCAGGCCCCTTAAGGGG - Intergenic
1034716881 7:153251665-153251687 CCGTCTCCACTCCCATTATGAGG - Intergenic
1035732023 8:1860197-1860219 TCCTCTCCACGCCCCCGAAGTGG + Intronic
1035732034 8:1860232-1860254 TCCTCTCCACGCCCCCGAAGTGG + Intronic
1036274597 8:7339351-7339373 CCGTTTCCACGCAATGGAAGTGG - Intergenic
1036346755 8:7970995-7971017 CCGTTTCCACGCAATGGAAGTGG + Intergenic
1037476782 8:19265472-19265494 CTTCCTCCACGCCCTTCAAGAGG - Intergenic
1048326976 8:133447366-133447388 CCGTCCCTACGACCTTGAGGGGG + Intergenic
1049587603 8:143439225-143439247 ACGGCTCCACGCCCCTGACGTGG + Intronic
1057713150 9:97465468-97465490 CCCTCTCCACCCTCTTGAAAAGG + Intronic
1199858570 X:151779690-151779712 CCGGCACCATGCCCTTGTAGAGG + Intergenic