ID: 1100839084

View in Genome Browser
Species Human (GRCh38)
Location 12:98593882-98593904
Sequence GGGAAGGAAAAGGCCCCGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 7, 3: 22, 4: 221}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100839078_1100839084 -2 Left 1100839078 12:98593861-98593883 CCTCTTCAAGGGCGTGGAGACGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1100839084 12:98593882-98593904 GGGAAGGAAAAGGCCCCGGTTGG 0: 1
1: 0
2: 7
3: 22
4: 221
1100839076_1100839084 4 Left 1100839076 12:98593855-98593877 CCGTGACCTCTTCAAGGGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 141
Right 1100839084 12:98593882-98593904 GGGAAGGAAAAGGCCCCGGTTGG 0: 1
1: 0
2: 7
3: 22
4: 221
1100839072_1100839084 20 Left 1100839072 12:98593839-98593861 CCTCTTTCGAAGGCCGCCGTGAC 0: 1
1: 0
2: 0
3: 4
4: 29
Right 1100839084 12:98593882-98593904 GGGAAGGAAAAGGCCCCGGTTGG 0: 1
1: 0
2: 7
3: 22
4: 221
1100839075_1100839084 7 Left 1100839075 12:98593852-98593874 CCGCCGTGACCTCTTCAAGGGCG 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1100839084 12:98593882-98593904 GGGAAGGAAAAGGCCCCGGTTGG 0: 1
1: 0
2: 7
3: 22
4: 221
1100839070_1100839084 30 Left 1100839070 12:98593829-98593851 CCGGGAGCAGCCTCTTTCGAAGG 0: 1
1: 0
2: 2
3: 8
4: 102
Right 1100839084 12:98593882-98593904 GGGAAGGAAAAGGCCCCGGTTGG 0: 1
1: 0
2: 7
3: 22
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100839084 Original CRISPR GGGAAGGAAAAGGCCCCGGT TGG Intronic
900204370 1:1425826-1425848 GGGAGGGAGGCGGCCCCGGTGGG + Intergenic
900522917 1:3114862-3114884 GGGGAGGAAGAGGCCCTGGCCGG + Intronic
900579573 1:3402472-3402494 GGGCTGGAGAAGGCCCCGCTCGG - Intronic
901843468 1:11967405-11967427 GGGGAGGAAAGGGCCAAGGTGGG + Intronic
902338417 1:15767270-15767292 GGGAAGCTGAGGGCCCCGGTCGG - Intronic
902405660 1:16182075-16182097 GGGAAGGAAGAGGCTGCTGTTGG + Intergenic
902801055 1:18830588-18830610 GGGAGGGAAGAGGCCTCGGAGGG - Intergenic
904236161 1:29118696-29118718 GGGAGGGAAAGAGCCCAGGTGGG + Exonic
904319795 1:29689462-29689484 GGGAGGGCAAAGGCCCCGGGTGG - Intergenic
905205141 1:36339176-36339198 GGGAAGGAGAAGGCCCAGCCAGG - Intergenic
906166145 1:43687851-43687873 GGGAAGGAAAAATCCCCTCTGGG - Intronic
906794645 1:48687367-48687389 GGTGGAGAAAAGGCCCCGGTGGG + Intronic
907372487 1:54012287-54012309 GGGCAGGGAAAGGCCCTGGAGGG + Intronic
910853337 1:91670125-91670147 GGGAAGGAATTTGCCCCGGTGGG - Intergenic
911053915 1:93694960-93694982 GGGAATAACAAGGCCCAGGTGGG - Intronic
913957431 1:143318569-143318591 GGGTAGGAGAAGGCCATGGTAGG + Intergenic
914051745 1:144143933-144143955 GGGTAGGAGAAGGCCATGGTAGG + Intergenic
914127452 1:144822608-144822630 GGGTAGGAGAAGGCCATGGTAGG - Intergenic
914900585 1:151709174-151709196 AGGAAGGGGAAGGGCCCGGTGGG + Intronic
915625464 1:157111640-157111662 GGGAGGGACAAGGCCCCAGGTGG + Intergenic
915944745 1:160141548-160141570 GGGATGGAAAAGGATCTGGTCGG - Exonic
916060153 1:161092820-161092842 GGGAAGGAGTGGGCCCAGGTTGG + Intergenic
916839418 1:168584571-168584593 TGCCAGGAAAAGGCCACGGTAGG + Intergenic
920341548 1:205278246-205278268 GAGAAGGAAAAGGCCAAGGAGGG + Intergenic
924801311 1:247331326-247331348 GGGAAGGAGAAGGTCGCTGTGGG + Intronic
1066760226 10:38742003-38742025 GGGTAGGAAAAGGCCATGGTAGG - Intergenic
1066961379 10:42230765-42230787 GGGTAGGAAAAGGCCATGGTAGG + Intergenic
1067433078 10:46256637-46256659 GGGAGGCAGAAGGCCCTGGTAGG + Intergenic
1071310382 10:84337873-84337895 GCGAAGGAAAAGGAGCAGGTAGG + Intronic
1072663634 10:97379016-97379038 GGGAAGAACAAGGCCCAGTTGGG + Intronic
1072710597 10:97713634-97713656 GGGAAGGGAAAGGGGCGGGTGGG + Intronic
1073312783 10:102556142-102556164 GGGAACGATGAGGCTCCGGTGGG + Intronic
1075671159 10:124264988-124265010 GGGCAGGAACAGGGCCCGGGTGG - Intergenic
1077978607 11:7275876-7275898 GGGAAGGAAAAGGCACATATGGG - Intronic
1079380609 11:19934100-19934122 CAGAAGGAAAAGGCCCAGGAGGG + Exonic
1080416188 11:32072075-32072097 GAGGAGGAAAAAGCCCTGGTCGG + Intronic
1081398966 11:42620376-42620398 GGGCAGGAACAGGTCCCTGTTGG + Intergenic
1082916091 11:58439220-58439242 GGGAAGGCAAAGGCCTCTATAGG - Exonic
1083998236 11:66282703-66282725 GGGAAGGAAAAGGCCGCGATGGG - Intronic
1084815101 11:71641025-71641047 GAGAAGGGAAAGGTCCTGGTCGG + Intergenic
1085759064 11:79226289-79226311 GGGAAGGAAAAGTCCAAGGACGG - Intronic
1087600416 11:100307592-100307614 GGGAAAGAAAAGTCCCCGAAGGG - Intronic
1088582348 11:111328260-111328282 GGGCAAGAGAAGGCCCCGTTAGG - Intergenic
1088630037 11:111766002-111766024 GGGAAGGGCAAGGCTCCGGGCGG + Intronic
1090709917 11:129375301-129375323 GGGAAGGAGAAAGGCACGGTGGG + Intergenic
1092140634 12:6180882-6180904 GGGATAGGGAAGGCCCCGGTGGG + Intergenic
1092263071 12:6962775-6962797 GGGAGGGAGAAGGCCCCGCCAGG - Intergenic
1093646975 12:21597566-21597588 GTGAAGGAAAAGGCACTCGTAGG + Intronic
1096110777 12:49027906-49027928 GGGAAGGAAAAGGGTCTGGAAGG - Exonic
1096186891 12:49587349-49587371 GTGAAGGAAAAGCCCCCTGGTGG + Intronic
1097085976 12:56468761-56468783 GGGAAGGAAAAGACCCGAGAGGG - Intronic
1099311603 12:81033003-81033025 GGGAAGGCCAAAGCCCAGGTGGG + Intronic
1100839084 12:98593882-98593904 GGGAAGGAAAAGGCCCCGGTTGG + Intronic
1102901993 12:116646151-116646173 GGGAAGGGAAAGGCTGTGGTGGG + Intergenic
1103274094 12:119697214-119697236 TGGAAGGATGAGGCCCTGGTGGG - Intronic
1104934283 12:132356236-132356258 GGGTTGGAGAAGGCCCTGGTGGG - Intergenic
1106778057 13:33027391-33027413 GCCAAGGTCAAGGCCCCGGTTGG - Intronic
1111585880 13:90284314-90284336 GAGAAGGAAAAAGGCCAGGTAGG + Intergenic
1118604343 14:67491947-67491969 GGGAAGGACAGGGCCCCGTGGGG - Intronic
1119720254 14:76885259-76885281 GGGAAGGAGAAGGCAGAGGTGGG - Intergenic
1121098433 14:91233775-91233797 GGGTGGGAATAAGCCCCGGTTGG - Exonic
1121925824 14:97926425-97926447 GGGAAGGAGAAGTCCTCAGTAGG - Exonic
1123064247 14:105608352-105608374 GGGAAGGAACAGGGAGCGGTGGG - Intergenic
1123073551 14:105653991-105654013 GGGAAGGAACAGGCAGCGGTGGG - Intergenic
1123093482 14:105752761-105752783 GGGAAGGAACAGGCAGCGGTGGG - Intergenic
1202930949 14_KI270725v1_random:31521-31543 GGGTAGGAGAAGGCCATGGTAGG - Intergenic
1123443641 15:20306618-20306640 GGGTAGGAGAAGGCCACGGTAGG - Intergenic
1127863445 15:63013139-63013161 GGGAAAGGAAAGGCCCCTTTTGG - Intergenic
1128145101 15:65328683-65328705 GGGAAGGAACAGGCTCCTGCAGG + Exonic
1128754546 15:70172467-70172489 GGGAATGAATATGCCCAGGTAGG - Intergenic
1129182668 15:73886957-73886979 GGGAAGGGGAAGGCCAGGGTTGG - Intronic
1129319662 15:74767592-74767614 GGAAAAGAAAAGCCCCCGGAGGG - Intergenic
1129440489 15:75578304-75578326 GGGCAGGAAAAGCCCCAGTTTGG - Intronic
1132093593 15:98965756-98965778 GGGAAGGAGGAGGCCCTGTTGGG - Intergenic
1132464661 16:72100-72122 GGGAAGGAAAATGCAGCGGGGGG + Intronic
1133117304 16:3584722-3584744 GGGAGGGAAAAGACCACTGTGGG + Intronic
1134482209 16:14629873-14629895 GAGAAGGACAAGGCCCCGGATGG + Intronic
1134902352 16:17949852-17949874 AGGAAGGAAAATGCCTCTGTGGG + Intergenic
1135863752 16:26081464-26081486 GGGATGGAAAAGTCCCAGGCTGG + Intronic
1136232529 16:28895011-28895033 AGGAAGGCAGAGGCCCTGGTTGG + Intronic
1136722569 16:32337273-32337295 GGGTAGGAAAAGGCCACGGTAGG + Intergenic
1136840893 16:33543266-33543288 GGGTAGGAAAAGGCCACGGTAGG + Intergenic
1137922562 16:52505192-52505214 AGGAAGGAAAAGGCCTGGCTAGG + Intronic
1139314906 16:66059775-66059797 GGTAAGGAGAAGGCCCCATTAGG - Intergenic
1140258825 16:73359608-73359630 GGGAAGGAAAGGCCCCATGTGGG + Intergenic
1141169835 16:81684351-81684373 GGGCATGAGAAGGCCCCTGTGGG - Intronic
1141537495 16:84692530-84692552 GAGAAGGAAAAGGCCCAGGAGGG - Intergenic
1141986273 16:87582464-87582486 GGGAAAGAAAAGGGCCAGGAGGG - Intergenic
1203003862 16_KI270728v1_random:180491-180513 GGGTAGGAAAAGGCCACGGTAGG - Intergenic
1203135470 16_KI270728v1_random:1716898-1716920 GGGTAGGAAAAGGCCACGGTAGG - Intergenic
1203151058 16_KI270728v1_random:1843563-1843585 GGGTAGGAAAAGGCCACGGTAGG + Intergenic
1142686225 17:1578327-1578349 GGGGAGGAAAAGGCGACTGTGGG + Intronic
1143174682 17:4949248-4949270 GGGACAGAAGTGGCCCCGGTGGG - Intronic
1144938224 17:18917360-18917382 GGGGCAGAAAAGGCCCCTGTGGG + Intronic
1145709951 17:26962843-26962865 CGGAGGTAAAAAGCCCCGGTGGG - Intergenic
1146469759 17:33114831-33114853 AGGAAGGAAAGGGTCCCAGTTGG - Intronic
1147618484 17:41845738-41845760 GGGAAGGTAAAGGACCAGGGTGG + Exonic
1149817222 17:59737227-59737249 GGTAAGGAAAAGGCTACAGTGGG + Intronic
1152189515 17:78879912-78879934 GGGACGGAAAAGAACCGGGTGGG + Intronic
1152802100 17:82335314-82335336 GGGGAGGAAAAGGCAACAGTTGG - Intergenic
1154230751 18:12553678-12553700 GGGAAGGACAAGGGCCTGGCTGG + Intronic
1155154142 18:23144147-23144169 GGGAAGGAAGAGGCCCAGCCAGG - Intronic
1155657734 18:28210854-28210876 GGGAAGGAAAAGGCAGCGGCCGG + Intergenic
1159075807 18:63680475-63680497 GGGAAGGACAAGTCCCAGGAAGG - Intronic
1160505132 18:79422713-79422735 GGGAAGCAAAAGGAGCCCGTTGG - Intronic
1161369624 19:3903405-3903427 GGCAGGGAAAGGGCCCAGGTTGG + Intronic
1161527727 19:4767582-4767604 GGGAAAGAACAGGCCCTGGGGGG - Intergenic
1162428606 19:10612890-10612912 GCCAAGGAAAAGGCCTGGGTTGG + Intronic
1163693271 19:18749244-18749266 GGCTAGGAGAAGGCCCCGGAAGG - Intronic
1164766652 19:30777492-30777514 GGGAAAGAAAAGGGCCGGGAGGG + Intergenic
1165221067 19:34317144-34317166 GGGAAGGAAAAGGCTCCTCAAGG - Intronic
1165246272 19:34500221-34500243 GTGAGGGAAGAGGCCCAGGTTGG - Exonic
1165246862 19:34502957-34502979 GGGGAGGAGAAGGACCGGGTTGG - Exonic
1166015267 19:39974654-39974676 GGGAAGGGAGAGGCCCCATTGGG + Intronic
1166210797 19:41305555-41305577 GGCAAGGGAAGGGCCCCTGTGGG + Intronic
1167204972 19:48095338-48095360 GGGAAAGAAAAGGACTTGGTAGG - Intronic
1167587783 19:50384557-50384579 GAGCAGGAAAAGGCCGGGGTGGG + Intronic
1167774912 19:51548566-51548588 GGGAAACAGAAGGCCCCAGTGGG + Intergenic
1202691141 1_KI270712v1_random:96357-96379 GGGTAGGAGAAGGCCATGGTAGG + Intergenic
926787274 2:16530673-16530695 GGGAAGGAAAGGGCTTTGGTTGG + Intergenic
927433518 2:23047508-23047530 GGGGAGGAAAAGGGCCAGGCAGG - Intergenic
928022712 2:27716282-27716304 GGGGAGGAAAGGGCCCCAGGAGG - Intergenic
930297796 2:49577318-49577340 GGGAGGGGATAGGCCCCAGTGGG + Intergenic
931905463 2:66838054-66838076 GGGAATGAGGAGGCCCCAGTGGG - Intergenic
931912431 2:66915374-66915396 TGGAAGTAAAAGGACTCGGTTGG - Intergenic
933955249 2:87357593-87357615 GGGTAGGAGAAGGCCATGGTAGG - Intergenic
934239439 2:90253807-90253829 GGGTAGGAGAAGGCCATGGTAGG - Intergenic
934273746 2:91562891-91562913 GGGTAGGAGAAGGCCATGGTAGG + Intergenic
934323545 2:91986344-91986366 GGGTAGGAAAAGGCCATGGTAGG - Intergenic
934461880 2:94217161-94217183 GGGTAGGAGAAGGCCATGGTAGG - Intergenic
936645493 2:114365031-114365053 GGGAATTAGAAGGCCCCAGTGGG - Intergenic
938137980 2:128774870-128774892 AGGAAGGCAGAGGCCCAGGTTGG - Intergenic
938571601 2:132566825-132566847 GGGAAGGAAAAGGCCTTGGAGGG - Intronic
939630884 2:144524583-144524605 GGGACGGAAAGGGGCCCTGTAGG + Intergenic
939868664 2:147503702-147503724 GGGAATGAAAAGGCCCAGTGTGG - Intergenic
942589202 2:177522799-177522821 GGGTAGGAGAGGGCCCAGGTGGG - Intronic
944001204 2:194840774-194840796 GGGAAGGAAAAAGCCTAGGGAGG - Intergenic
946627289 2:221627546-221627568 TGGAAGCAAAAGGCCTTGGTGGG - Intergenic
947186892 2:227463533-227463555 GGAAAGAAAGAGGCCCCTGTGGG - Intergenic
947960011 2:234228578-234228600 GGTCAGGAGAAGGCCCTGGTTGG + Intergenic
948855309 2:240727530-240727552 GGGAAGAGGAAGGCCCCGGGGGG + Intronic
948882892 2:240869362-240869384 GGTAAGGGAGAGGCCCAGGTGGG + Exonic
1172591262 20:36119685-36119707 GGGAAGGAAAGGGACAAGGTGGG + Intronic
1173581884 20:44152776-44152798 GTTAAGGAAAAGGCCTCCGTGGG + Intronic
1173859974 20:46276990-46277012 GAGTAGGAAAAGGCCCAGGCCGG + Intronic
1174461593 20:50686863-50686885 GCCAAGGACAAGGCCCAGGTGGG - Intronic
1175330602 20:58161455-58161477 GGGAAGGAAAATGACCCATTTGG - Intergenic
1176170952 20:63696164-63696186 GGGAAGGAGGAGACCCCCGTGGG + Exonic
1176592970 21:8660143-8660165 GGGTAGGAGAAGGCCATGGTAGG - Intergenic
1179346695 21:40564942-40564964 GGAAGGGAAGAGGCCCAGGTGGG + Intronic
1179981298 21:44897293-44897315 GGGAAGGAAAGTGCCCGGGAGGG - Intronic
1180275822 22:10637286-10637308 GGGTAGGAGAAGGCCATGGTAGG - Intergenic
1180550304 22:16532215-16532237 GGGTAGGAAAAGGCCACGGTAGG - Intergenic
1181094609 22:20496578-20496600 GGGAAGGAGCAGGCCGCGGGAGG - Intronic
1181435508 22:22908167-22908189 GGGAGGGAGTAGGCCCTGGTGGG - Intergenic
1183056654 22:35310934-35310956 TGGAAGGAATAGGCCCTGGCGGG + Intronic
1183919040 22:41149072-41149094 AGGAAGGAACTGGCCCTGGTTGG - Exonic
949984898 3:9532915-9532937 GGGAAGAAACAGGCCTCAGTGGG + Intronic
950105521 3:10386075-10386097 GGGCAGGAAGAGGCCCCACTGGG + Intronic
950111459 3:10421345-10421367 GGGAAGGAGAAGGGCCCTGTGGG - Intronic
951341590 3:21494530-21494552 AGCAAGGCAAAGGCCCCGGGAGG + Intronic
952247653 3:31612543-31612565 GGAAATGAAAAAGCCCAGGTGGG - Intronic
952343900 3:32466963-32466985 TGGATGGAAAGGGCCCAGGTTGG + Intronic
958540779 3:95468498-95468520 GGGCAGGAAAATGCCAGGGTAGG - Intergenic
960949656 3:122991079-122991101 GGGAAGGAAAATCCCACTGTTGG - Intronic
961252563 3:125519755-125519777 GGGAGGGAAAGGGACCCGGGGGG - Intronic
961420333 3:126797968-126797990 GGGAAGGAAACGGCACAGTTGGG - Intronic
961647717 3:128401261-128401283 GGGAAGAAAAATGCCCCAGCAGG - Intronic
962368069 3:134798685-134798707 AGGTGGGAAAAGGCACCGGTGGG - Intronic
962848178 3:139288879-139288901 GGGAAGGAATAGCCCCTGGAGGG + Intronic
965673116 3:171167554-171167576 GGGAAGAAAAAGACCCCTATGGG + Intronic
966218497 3:177527318-177527340 GGGCAGGAGAAGCCCCCGCTTGG + Intergenic
967596334 3:191329718-191329740 AGGAAGGTAAGGGCCCCGGAGGG + Exonic
969276270 4:6137868-6137890 AGGAAGGAGAAGGCCATGGTTGG - Intronic
969276287 4:6137933-6137955 AGGAAGGAGAAGGCCATGGTGGG - Intronic
969360858 4:6662981-6663003 GGGAAGGAAAAGAACCAGGATGG + Intergenic
969494133 4:7516266-7516288 GGGAATGAGAAGGCCCAGCTGGG + Intronic
970820671 4:20208223-20208245 GGGAAGGAAAAGATACTGGTTGG + Intergenic
970824122 4:20252815-20252837 GGAAAGGCAAAGGCCAAGGTTGG - Intergenic
981174601 4:141666633-141666655 GGGAAGCAGAAGGGCCAGGTGGG - Intronic
985866107 5:2515775-2515797 GGGTGGGAACAGGCCTCGGTGGG + Intergenic
985939670 5:3125237-3125259 GGGAAAGACAAGGACCCTGTGGG - Intergenic
989103210 5:37839212-37839234 GGGAAGGAAACTGCCCCTCTTGG + Intronic
991221934 5:64227185-64227207 GGGAAGGAACAGGCAGCGGTGGG + Intronic
991590009 5:68241120-68241142 GAGAAGGAAATGGTCCTGGTGGG + Intronic
992891250 5:81206429-81206451 GGGCAGGGAAAGCCCACGGTAGG + Intronic
994261526 5:97665103-97665125 GGGAAGAAAAAGGAGCTGGTTGG + Intergenic
996456663 5:123692475-123692497 GGAAAGGAAGAGGCCGCGGTAGG + Intergenic
999068625 5:148718342-148718364 GGGAAGCAGAAGGCCACAGTGGG - Intergenic
999198936 5:149802473-149802495 GGGGAGGAAAAGACCCCCATGGG - Intronic
999383669 5:151139498-151139520 GGGAAGGAAGTGGCCCTGGTGGG - Intronic
1000029533 5:157390064-157390086 GGGAAGGGACAGGCCATGGTGGG - Intronic
1002078448 5:176723547-176723569 GGGGAGGAAGAGGACCCAGTAGG - Intergenic
1002168567 5:177362768-177362790 GGCAGGGAAAGGGCCCGGGTTGG + Intronic
1002428836 5:179191549-179191571 GGGAAGGAAAATGCCGCTATGGG + Intronic
1003543406 6:7038079-7038101 AGGAAGAAAGAGGCCCCAGTGGG + Intergenic
1006123334 6:31821321-31821343 GGAAAGGACGAGGGCCCGGTGGG - Intergenic
1006378379 6:33684215-33684237 GGGACAGAGAAGGGCCCGGTGGG + Intronic
1006630837 6:35428439-35428461 GGGAAGGGGAAGGCCCCTGGAGG + Intergenic
1008546881 6:52591003-52591025 GGGAAGGCAGAGGCCAAGGTGGG - Intergenic
1010317614 6:74468762-74468784 GGGTAGGAAAATGCCCCAGTGGG + Intergenic
1015117811 6:129668645-129668667 GGGTAGGAAAAGTGCCTGGTGGG - Intronic
1015385114 6:132613535-132613557 GAAAAGGAAAAGGTCCCAGTGGG - Intergenic
1019101799 6:169637124-169637146 GGGAAAGAAAAGGCAATGGTAGG - Intronic
1019294811 7:268298-268320 GGGAAGTAAAAGGCCATGATTGG + Intergenic
1019460941 7:1158938-1158960 GGTCAGGAAAAGGCCCCGGGAGG - Intronic
1020737451 7:11968958-11968980 GGGAAGGCAAAGGCCCAGAAAGG + Intergenic
1023365246 7:39457431-39457453 GGTAAGGAAAGGGCCAGGGTGGG + Intronic
1023648837 7:42347566-42347588 GAGGAGGGAAAGGCCCAGGTAGG + Intergenic
1023654917 7:42409583-42409605 GGAAAGGAAAAGGCCCAAGAGGG - Intergenic
1024051261 7:45624823-45624845 GAGAGAGAAAAGGCCCAGGTGGG - Intronic
1025775701 7:64558941-64558963 GGGAAGAAAAAAGGCCGGGTGGG + Intronic
1026607010 7:71825033-71825055 AGGAAGGAGAAGGCCCTGGAAGG - Intronic
1026737764 7:72959966-72959988 GGGAAGGGGAAGGCCCTGGCGGG + Intronic
1026788798 7:73318767-73318789 GGGAAGGGGAAGGCCCTGGCGGG + Intronic
1026843497 7:73683906-73683928 GGGAAGGGAAGGACCCGGGTGGG + Intronic
1027105970 7:75405102-75405124 GGGAAGGGGAAGGCCCTGGCGGG - Intronic
1027470046 7:78562084-78562106 GGGAAGGAAGAGACCCAGTTGGG + Intronic
1032954054 7:136950294-136950316 GGGAGGCAAAAGGTCCCTGTAGG + Intronic
1033043729 7:137941578-137941600 GGGGAGTAAAGGGCCCCGGTTGG + Intronic
1033489332 7:141825960-141825982 GGGAAGGAAAAAGATCCGGAAGG + Intergenic
1035061669 7:156074171-156074193 AGGCAGGAAAAGCCCCGGGTTGG - Intergenic
1035772532 8:2159473-2159495 GGGAAGGAAATGGCACTGGCAGG - Intronic
1036916655 8:12810774-12810796 GGGAAGGAACAGGAGCGGGTAGG - Intergenic
1037143053 8:15540491-15540513 AGGAAGGGAAAGCTCCCGGTGGG - Exonic
1040284892 8:46094647-46094669 GGGAAGGGAGAGGCCTCGCTGGG - Intergenic
1040318137 8:46275706-46275728 GGGAAGGAAGAGGCCTCCCTGGG + Intergenic
1040319583 8:46285884-46285906 GGGAAGGAAGAGGCCTCCCTGGG + Intergenic
1040469971 8:47728892-47728914 AGGAAAGACAAGGCCCCGGGAGG - Intronic
1043515159 8:80989312-80989334 GGGAAGGAAGACTCCCAGGTGGG + Intronic
1045269744 8:100651469-100651491 AGGAAGGAAATGGCCCTGTTTGG - Intronic
1046660035 8:116938723-116938745 GGGAAGGAAAAGGGCCCTGCAGG + Intronic
1049391234 8:142372737-142372759 GGGAAGGAAATGGCACTGGTGGG - Intronic
1049391273 8:142372885-142372907 GGGAAGGAAACAGCACTGGTGGG - Intronic
1049686543 8:143941446-143941468 GGGAAGGGAAGGGGCACGGTGGG + Intronic
1053176619 9:35930107-35930129 GAGAAGGAGAAGTCCCCAGTAGG + Intergenic
1053692350 9:40592813-40592835 GGGTAGGAGAAGGCCATGGTAGG - Intergenic
1053692361 9:40592845-40592867 GGGTAGGAGAAGGCCAGGGTAGG - Intergenic
1054303611 9:63393779-63393801 GGGTAGGAGAAGGCCATGGTAGG - Intergenic
1054435992 9:65204604-65204626 GGGTAGGAGAAGGCCATGGTAGG - Intergenic
1054494400 9:65817083-65817105 GGGTAGGAGAAGGCCATGGTAGG + Intergenic
1055563787 9:77548247-77548269 GTGAAGGCAAAGGCACAGGTTGG - Intronic
1056822100 9:89850315-89850337 GGAAAAGCAAAGGCCCAGGTGGG - Intergenic
1062518579 9:136947903-136947925 GGGAAGGAGAAGGGCCCAGGAGG + Intronic
1203623016 Un_KI270749v1:138950-138972 GGGTAGGAGAAGGCCATGGTAGG - Intergenic
1190789753 X:53687226-53687248 GGGAATAAAAAGGACCTGGTGGG + Intergenic
1194917368 X:99722521-99722543 GGGTGGCTAAAGGCCCCGGTTGG - Intergenic
1195502061 X:105613250-105613272 GGGAAGGACACGGTCCAGGTAGG + Intronic
1198785379 X:140282902-140282924 GGGAAGGAAAAGGGCCTGGATGG - Intergenic
1201190960 Y:11441330-11441352 GGGTAAGAAAAGGCCATGGTAGG - Intergenic
1201215185 Y:11716449-11716471 GAGAAGGGAAAGGAACCGGTAGG + Intergenic