ID: 1100839085

View in Genome Browser
Species Human (GRCh38)
Location 12:98593883-98593905
Sequence GGAAGGAAAAGGCCCCGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100839078_1100839085 -1 Left 1100839078 12:98593861-98593883 CCTCTTCAAGGGCGTGGAGACGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1100839085 12:98593883-98593905 GGAAGGAAAAGGCCCCGGTTGGG 0: 1
1: 0
2: 0
3: 15
4: 148
1100839072_1100839085 21 Left 1100839072 12:98593839-98593861 CCTCTTTCGAAGGCCGCCGTGAC 0: 1
1: 0
2: 0
3: 4
4: 29
Right 1100839085 12:98593883-98593905 GGAAGGAAAAGGCCCCGGTTGGG 0: 1
1: 0
2: 0
3: 15
4: 148
1100839075_1100839085 8 Left 1100839075 12:98593852-98593874 CCGCCGTGACCTCTTCAAGGGCG 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1100839085 12:98593883-98593905 GGAAGGAAAAGGCCCCGGTTGGG 0: 1
1: 0
2: 0
3: 15
4: 148
1100839076_1100839085 5 Left 1100839076 12:98593855-98593877 CCGTGACCTCTTCAAGGGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 141
Right 1100839085 12:98593883-98593905 GGAAGGAAAAGGCCCCGGTTGGG 0: 1
1: 0
2: 0
3: 15
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100839085 Original CRISPR GGAAGGAAAAGGCCCCGGTT GGG Intronic
902628766 1:17692425-17692447 GGATGGCAAAGGAGCCGGTTTGG - Intronic
903598344 1:24514345-24514367 AGAAGGAAAAGGCCCACTTTGGG + Exonic
904319794 1:29689461-29689483 GGAGGGCAAAGGCCCCGGGTGGG - Intergenic
907335286 1:53695587-53695609 GGAGGGAAGAGGCCCAGGGTCGG - Intronic
907404819 1:54247433-54247455 GGAAGGAAAAGGGCCCCTTGAGG - Intronic
913274244 1:117121967-117121989 GGGAGGAAAAGGCCAAGGCTCGG + Intronic
914900586 1:151709175-151709197 GGAAGGGGAAGGGCCCGGTGGGG + Intronic
917451584 1:175151781-175151803 GGAAGGAAAAAGGCCAGGTGTGG + Intergenic
920368410 1:205460935-205460957 GGAAGGCAAAGGCCCAGGACTGG + Intergenic
920573121 1:207032926-207032948 GGAAGGAGGAGGAGCCGGTTTGG + Intronic
921653997 1:217712566-217712588 GGAAGGAAAAGGCCTGGGGCTGG - Intronic
922566282 1:226603833-226603855 AGAAGGCAAAGGCCTGGGTTGGG - Exonic
922574979 1:226655368-226655390 GGGAGGAAATGGCCCCCGTTAGG + Intronic
1063367861 10:5502220-5502242 GGGAGGAAATGACCCCGGATGGG - Intergenic
1065389522 10:25168483-25168505 GAAAGGAAAATGCCCAGGATTGG + Intergenic
1065857647 10:29843209-29843231 GGAAGGGAGAGGCCCCTGCTTGG - Intergenic
1066385849 10:34940598-34940620 GGAAGGAAAGGGCCTCTGTGAGG - Intergenic
1066760225 10:38742002-38742024 GGTAGGAAAAGGCCATGGTAGGG - Intergenic
1066961380 10:42230766-42230788 GGTAGGAAAAGGCCATGGTAGGG + Intergenic
1069711072 10:70489044-70489066 GGAAGGAATAGGCCCAGGAGAGG + Intronic
1070247948 10:74749456-74749478 GCAATGCAAAGGCCCTGGTTTGG + Intergenic
1073237120 10:102026577-102026599 GGAAAGAAATGGCCCTGGTGTGG + Intronic
1075671158 10:124264987-124265009 GGCAGGAACAGGGCCCGGGTGGG - Intergenic
1076995873 11:297291-297313 GGAAGGGAAGGGCCCCGGAGTGG + Intergenic
1079437985 11:20477212-20477234 GGAGGGAAAAGGTCCTGATTAGG + Intronic
1083998235 11:66282702-66282724 GGAAGGAAAAGGCCGCGATGGGG - Intronic
1084350628 11:68596530-68596552 AGAAGGAAAAGGCCCTGTGTTGG + Intronic
1094497920 12:31000625-31000647 GGATGGAAAGGGCACTGGTTTGG - Intergenic
1096466926 12:51851790-51851812 GAAAGAAAAGGGCCCCGGGTTGG + Intergenic
1097249648 12:57625522-57625544 GTAGGGAAAAGGACCCGGTGTGG + Intronic
1100839085 12:98593883-98593905 GGAAGGAAAAGGCCCCGGTTGGG + Intronic
1103274093 12:119697213-119697235 GGAAGGATGAGGCCCTGGTGGGG - Intronic
1103557318 12:121774622-121774644 GGAAGAAAAAGGACCCGCTGAGG - Intronic
1106778055 13:33027390-33027412 CCAAGGTCAAGGCCCCGGTTGGG - Intronic
1109298495 13:60564533-60564555 GAAAGAAAATGGCCCTGGTTTGG + Intronic
1116192617 14:41679887-41679909 TGAAGGGAAAGTCCCAGGTTTGG + Intronic
1118709849 14:68510162-68510184 GGAGGGAAAAAGCCCTGGATGGG - Intronic
1119158210 14:72430945-72430967 GGAAGGAAAAGACCCAGGAGAGG - Intronic
1119264559 14:73256236-73256258 GGAAGAAAAAGGGCCAGGTGAGG + Intronic
1121239303 14:92416579-92416601 GGAAGGAAAAGGCCACAGGCTGG + Intronic
1122542919 14:102507950-102507972 GAAAGGAAGAGGCCACGGTGAGG + Intronic
1123073550 14:105653990-105654012 GGAAGGAACAGGCAGCGGTGGGG - Intergenic
1123093481 14:105752760-105752782 GGAAGGAACAGGCAGCGGTGGGG - Intergenic
1123443640 15:20306617-20306639 GGTAGGAGAAGGCCACGGTAGGG - Intergenic
1126152178 15:45533257-45533279 GGATGGCAAAGGCCCCCTTTTGG + Intergenic
1129182667 15:73886956-73886978 GGAAGGGGAAGGCCAGGGTTGGG - Intronic
1129440488 15:75578303-75578325 GGCAGGAAAAGCCCCAGTTTGGG - Intronic
1130192550 15:81750505-81750527 GTAAGGAGAAGGCCCAGGTATGG + Intergenic
1130816694 15:87443513-87443535 GGAAAGAAAAAGCCCAGGTAAGG + Intergenic
1131098664 15:89671567-89671589 GGAAGGAAAGGGCCAAGTTTGGG + Intronic
1132116860 15:99143711-99143733 GGAAAGAAAAGCTCCCTGTTTGG - Intronic
1135735426 16:24927661-24927683 GTAAGGAAAAGGCACCTGATTGG - Intronic
1135863753 16:26081465-26081487 GGATGGAAAAGTCCCAGGCTGGG + Intronic
1136232530 16:28895012-28895034 GGAAGGCAGAGGCCCTGGTTGGG + Intronic
1136613745 16:31382760-31382782 GGAGGGACATGGCCCCGGTGCGG + Exonic
1136722570 16:32337274-32337296 GGTAGGAAAAGGCCACGGTAGGG + Intergenic
1136840894 16:33543267-33543289 GGTAGGAAAAGGCCACGGTAGGG + Intergenic
1140266618 16:73426859-73426881 GGAAGGAAAAGGCACTGACTTGG - Intergenic
1140449077 16:75055567-75055589 GGAAGGAAAAGGCCTCTCATAGG - Intronic
1203003861 16_KI270728v1_random:180490-180512 GGTAGGAAAAGGCCACGGTAGGG - Intergenic
1203135469 16_KI270728v1_random:1716897-1716919 GGTAGGAAAAGGCCACGGTAGGG - Intergenic
1203151059 16_KI270728v1_random:1843564-1843586 GGTAGGAAAAGGCCACGGTAGGG + Intergenic
1145709950 17:26962842-26962864 GGAGGTAAAAAGCCCCGGTGGGG - Intergenic
1146976048 17:37112955-37112977 GGAAGGAAAAAGCTTTGGTTTGG + Intronic
1147456702 17:40542471-40542493 GGAAGGAAAAGGTCTCAGTCTGG - Intergenic
1147618485 17:41845739-41845761 GGAAGGTAAAGGACCAGGGTGGG + Exonic
1148776787 17:50100347-50100369 GGGAGGGAAAGTCCCAGGTTTGG + Intronic
1149260983 17:54879129-54879151 TCAAGGATAAGGCCCAGGTTTGG + Intergenic
1152071784 17:78137773-78137795 GGAAGGCGAAGGCCACGGTGAGG - Exonic
1152735518 17:81995236-81995258 GGAAACAAAAGGCCCCTGTGAGG - Intronic
1153803106 18:8688963-8688985 CTACGGCAAAGGCCCCGGTTGGG + Intergenic
1154383575 18:13873320-13873342 GGAAGGAAAGGGAGCTGGTTAGG + Intergenic
1157318064 18:46610172-46610194 AGAATGAACAGGCCCCGGCTAGG + Intronic
1158462366 18:57657694-57657716 GGAAAGAAAAGGCCATGGTTTGG - Intronic
1158635212 18:59150366-59150388 GGAGGGAAAGGGCACTGGTTTGG - Intronic
1160505131 18:79422712-79422734 GGAAGCAAAAGGAGCCCGTTGGG - Intronic
1160743591 19:699407-699429 GGAAGGAAATGGCCCAGCTCTGG - Intergenic
1161033271 19:2069840-2069862 GGAAGGGACAGGCTCCTGTTAGG - Intergenic
1161743954 19:6043301-6043323 GGAAGGAAAAGGCTCCAGACAGG - Intronic
1161962184 19:7529021-7529043 GGGAGGATATGGCCCCGGATAGG - Intronic
1163501246 19:17677655-17677677 GGAAAGAAAAGGGGCCGGTGTGG - Intronic
1164874628 19:31675207-31675229 GGAAGGAAAGGGTCCCGGGGAGG + Intergenic
1165944825 19:39435795-39435817 GGAAGGAGAAGGCCAGGGTCTGG - Intronic
1167292960 19:48634721-48634743 GGAAGGGTAGGGCCCTGGTTCGG + Intronic
925058595 2:873911-873933 GCTCGGAAAAGGCCCCGGTCAGG - Intergenic
927250570 2:20991930-20991952 GGAAGGAACAGGCCAAGGTGTGG + Intergenic
927653568 2:24927232-24927254 GGCTAGAAAAGGCCCCGGATGGG + Intergenic
930811772 2:55549625-55549647 GCAAGGAAAAGTCACAGGTTTGG - Exonic
931648146 2:64444174-64444196 TGCAGTAAAAGGCCCTGGTTAGG + Intergenic
933866415 2:86522318-86522340 GGAAGGAAAAGGCTACATTTTGG - Intronic
934323544 2:91986343-91986365 GGTAGGAAAAGGCCATGGTAGGG - Intergenic
940314153 2:152309868-152309890 GAAACAAAAAGGCCCCGTTTGGG + Intergenic
942091620 2:172497171-172497193 GGAAAGAAAAGGGCCAGTTTAGG - Intronic
942202335 2:173583744-173583766 GGAAGGAGAAGACTCCGGCTTGG + Intergenic
946273067 2:218610165-218610187 GAAAGGAAAAGGACCAGGTCAGG + Intronic
946560381 2:220905959-220905981 CTAAGGAAAAGGCCGAGGTTAGG - Intergenic
946627288 2:221627545-221627567 GGAAGCAAAAGGCCTTGGTGGGG - Intergenic
947691424 2:232140144-232140166 GGAAGGAGAAAGCCACTGTTAGG - Intronic
948807358 2:240458838-240458860 GGGAGGAAAAGGCCTGGCTTCGG - Intronic
1170099525 20:12683478-12683500 GGAAGGAATAGGACAGGGTTTGG - Intergenic
1172562305 20:35899987-35900009 GCAAGGAAAACGCACAGGTTTGG - Intronic
1175136255 20:56826504-56826526 GGAAGGAGAAGGCACCGGATAGG - Intergenic
1175330601 20:58161454-58161476 GGAAGGAAAATGACCCATTTGGG - Intergenic
1176100022 20:63360636-63360658 GGAAGGACAAGGTCGCGGGTGGG - Intronic
1178274635 21:31225972-31225994 GGAAGAAAAAGGCACCTCTTAGG + Intronic
1180550303 22:16532214-16532236 GGTAGGAAAAGGCCACGGTAGGG - Intergenic
1182579932 22:31301042-31301064 GGAAAGGAAAGTCCCCGGTTTGG + Intergenic
1183056655 22:35310935-35310957 GGAAGGAATAGGCCCTGGCGGGG + Intronic
1183205038 22:36413152-36413174 GGAGGGAAATGACCTCGGTTTGG + Intergenic
1185029212 22:48432774-48432796 GGGAGGAAAAGGGCCTGGTGAGG - Intergenic
949667963 3:6363453-6363475 GTAAGGAATAGGCCCAGTTTCGG - Intergenic
953351788 3:42221529-42221551 GGAAGGAAAAGGGCCCATTCTGG - Intronic
960949655 3:122991078-122991100 GGAAGGAAAATCCCACTGTTGGG - Intronic
969360859 4:6662982-6663004 GGAAGGAAAAGAACCAGGATGGG + Intergenic
976620821 4:87125802-87125824 GTCAGGGAAAGGCACCGGTTGGG + Intronic
985874982 5:2587496-2587518 GGAAAGGAAAGGCCCTGGGTGGG + Intergenic
986244968 5:5998804-5998826 GGAAGAAAAAGGCTGCAGTTTGG + Intergenic
987136357 5:14903103-14903125 GGGAAGAAAAGCCCCCTGTTTGG + Intergenic
988976588 5:36522197-36522219 GTAGGGAAAAGGCCCCGTCTTGG - Intergenic
989103211 5:37839213-37839235 GGAAGGAAACTGCCCCTCTTGGG + Intronic
991221935 5:64227186-64227208 GGAAGGAACAGGCAGCGGTGGGG + Intronic
991390675 5:66140376-66140398 GGCTGGAACAGGCCCAGGTTTGG + Intronic
993812509 5:92499345-92499367 GGAAGGAAAAGACCAATGTTTGG - Intergenic
996364022 5:122680740-122680762 GGAAGGAAGAGGACAAGGTTTGG - Intergenic
996456664 5:123692476-123692498 GAAAGGAAGAGGCCGCGGTAGGG + Intergenic
1002168567 5:177362768-177362790 GGCAGGGAAAGGGCCCGGGTTGG + Intronic
1002172393 5:177382707-177382729 AGAAGGAGGAGGCCCAGGTTTGG + Intronic
1007288981 6:40769984-40770006 GGTTGGAAAATGCCCCTGTTAGG - Intergenic
1010040805 6:71380629-71380651 GGAAGGAAAATTCCCTGGTGAGG + Intergenic
1017344265 6:153361669-153361691 GGCAGGAAAATGCCCCGGACAGG - Intergenic
1018366444 6:163124690-163124712 GGAAGGAAGAGGCTGCAGTTCGG + Intronic
1019460940 7:1158937-1158959 GTCAGGAAAAGGCCCCGGGAGGG - Intronic
1020508897 7:9027574-9027596 GGAAGTAAAGGCACCCGGTTAGG + Intergenic
1022282696 7:28927027-28927049 GGAAGGAAAAAGGCGCGGCTCGG + Intergenic
1025604353 7:63028656-63028678 GGTAGGAAAATGGCCAGGTTAGG - Intergenic
1026817036 7:73521601-73521623 GGAAGGAGAAGGGCCCGCTTCGG - Intronic
1028312088 7:89351760-89351782 GGAAGGAAAAACCCACAGTTTGG + Intergenic
1029368451 7:100131734-100131756 GGAAAGAAAAGGGCCCGGCGCGG - Intergenic
1029435192 7:100560126-100560148 GGCAGGGAAAGGCCTCGGCTGGG + Intronic
1032285292 7:130534973-130534995 GGAAGGAAAAGGCAGCCGTAAGG + Intronic
1034714297 7:153225573-153225595 GGATGGAAAAGGACCCAATTGGG - Intergenic
1035061668 7:156074170-156074192 GGCAGGAAAAGCCCCGGGTTGGG - Intergenic
1036780623 8:11644531-11644553 GGTAGGAAAATGGCCAGGTTAGG + Intergenic
1049342348 8:142119954-142119976 GGAAGGTGGAGGCCCCGGTCTGG + Intergenic
1049391233 8:142372736-142372758 GGAAGGAAATGGCACTGGTGGGG - Intronic
1049744722 8:144258407-144258429 GGCAGGAACAGGCCCGGGGTGGG + Intronic
1050326691 9:4504970-4504992 ATAAGGAAATGGCCTCGGTTTGG + Intronic
1050523664 9:6527326-6527348 GGAAGAAAAAGGCCACAGTAAGG + Intergenic
1050540448 9:6664988-6665010 GGAAGGGAAAGGCCTCAGTGAGG - Intergenic
1052734451 9:32325898-32325920 GGAAGAAAAAAGCCCTAGTTTGG + Intergenic
1052967227 9:34349273-34349295 GGGAGGAAAAGGCCTAGGGTTGG - Intergenic
1057530322 9:95839338-95839360 GGAAGGGAAAGCCTCCAGTTAGG - Intergenic
1060035430 9:120251606-120251628 GGAGGGAAAAGACCAGGGTTAGG + Intergenic
1060241774 9:121909938-121909960 GGAAGGAAAGGGCACCATTTTGG + Intronic
1060304860 9:122402340-122402362 GGTGGGAAAAGGCCACGCTTTGG - Intergenic
1061239655 9:129362268-129362290 GGAAAGGAAAGGGCCTGGTTAGG - Intergenic
1062533019 9:137009977-137009999 GGAAGGACGAGGCCCGGGTGAGG - Exonic
1188762891 X:34054143-34054165 GGAAGGAAAAGGCCATGGAAAGG - Intergenic
1192810001 X:74538898-74538920 GGAGGGTAAAGGCCACAGTTGGG - Intergenic
1193692151 X:84659142-84659164 GGAAGGAAAAGGCCATGGAAAGG + Intergenic
1194917367 X:99722520-99722542 GGTGGCTAAAGGCCCCGGTTGGG - Intergenic
1197646697 X:129025754-129025776 GGCAGAACAAGGCCCTGGTTAGG - Intergenic
1198668242 X:139048374-139048396 TGAAGGAAAAGTGCCCCGTTAGG - Intronic
1200124080 X:153805070-153805092 GGAAGGAAAAGGGCGCTGGTGGG - Intronic