ID: 1100839086

View in Genome Browser
Species Human (GRCh38)
Location 12:98593884-98593906
Sequence GAAGGAAAAGGCCCCGGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 137}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100839072_1100839086 22 Left 1100839072 12:98593839-98593861 CCTCTTTCGAAGGCCGCCGTGAC 0: 1
1: 0
2: 0
3: 4
4: 29
Right 1100839086 12:98593884-98593906 GAAGGAAAAGGCCCCGGTTGGGG 0: 1
1: 0
2: 0
3: 14
4: 137
1100839078_1100839086 0 Left 1100839078 12:98593861-98593883 CCTCTTCAAGGGCGTGGAGACGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1100839086 12:98593884-98593906 GAAGGAAAAGGCCCCGGTTGGGG 0: 1
1: 0
2: 0
3: 14
4: 137
1100839075_1100839086 9 Left 1100839075 12:98593852-98593874 CCGCCGTGACCTCTTCAAGGGCG 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1100839086 12:98593884-98593906 GAAGGAAAAGGCCCCGGTTGGGG 0: 1
1: 0
2: 0
3: 14
4: 137
1100839076_1100839086 6 Left 1100839076 12:98593855-98593877 CCGTGACCTCTTCAAGGGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 141
Right 1100839086 12:98593884-98593906 GAAGGAAAAGGCCCCGGTTGGGG 0: 1
1: 0
2: 0
3: 14
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100839086 Original CRISPR GAAGGAAAAGGCCCCGGTTG GGG Intronic
900827947 1:4941544-4941566 GAAGGATAAGGCCAGGGGTGGGG - Intergenic
902439714 1:16421513-16421535 GGAGGAAGAGGCCCCGGTGCTGG + Exonic
903598345 1:24514346-24514368 GAAGGAAAAGGCCCACTTTGGGG + Exonic
906059063 1:42936534-42936556 GGGGGAAGAGGCCCAGGTTGGGG + Intronic
917736352 1:177924227-177924249 GAAGGCAAGGGCCCCAGGTGAGG - Intronic
919662699 1:200262854-200262876 GAACAGAAAGGCCCTGGTTGTGG - Intergenic
921416890 1:214898777-214898799 AAAGGAAAAGGAGACGGTTGGGG - Intergenic
922566281 1:226603832-226603854 GAAGGCAAAGGCCTGGGTTGGGG - Exonic
924482833 1:244452051-244452073 GCAGGAAGAGGCCCTGGTGGCGG + Exonic
1062977331 10:1694500-1694522 GAAGGAAGTGCCACCGGTTGTGG - Intronic
1063192035 10:3704568-3704590 GAAGGAAAAGGCATCGCTTGAGG + Intergenic
1063367860 10:5502219-5502241 GGAGGAAATGACCCCGGATGGGG - Intergenic
1064054299 10:12084556-12084578 GAAGGAAGAGGCCTCACTTGAGG + Exonic
1071310384 10:84337875-84337897 GAAGGAAAAGGAGCAGGTAGGGG + Intronic
1071989566 10:91088300-91088322 GAAGGAAAAGGCTGTTGTTGTGG + Intergenic
1072733819 10:97865910-97865932 GAAGGAAAAGCCCCCAGGTCAGG - Exonic
1074618201 10:115092373-115092395 GAAGGAAAACGGCCCTTTTGTGG + Intergenic
1074721012 10:116265236-116265258 GAAGGAAAAGTCCCAGCTTCTGG - Intronic
1075031158 10:119025604-119025626 AAAGGAAATGGCCCGGGCTGGGG + Intergenic
1077224674 11:1434845-1434867 GTAGGAAAGGGCCTGGGTTGTGG + Intronic
1077300133 11:1842954-1842976 AAAGGAGAAGGCCCGGGTGGGGG - Intergenic
1077615565 11:3671270-3671292 GAAGCAGAAGGCCCAGGCTGAGG + Exonic
1080120249 11:28668483-28668505 GAAGGAAAAGACACAGGTAGTGG + Intergenic
1083623674 11:64061016-64061038 GGAGGAGGAGGCCGCGGTTGAGG - Intronic
1084815103 11:71641027-71641049 GAAGGGAAAGGTCCTGGTCGGGG + Intergenic
1085276519 11:75303604-75303626 GAAGGTACAGGCCCCGGTGTCGG + Intronic
1086267331 11:85016881-85016903 GTAGGAAAAGGCCTAGGGTGAGG - Intronic
1091448425 12:558085-558107 GAAGGTAAAGGGCCTGGATGGGG + Exonic
1094500360 12:31015866-31015888 GAAGGCAGGGGCCCCGGTTCTGG - Intergenic
1100839086 12:98593884-98593906 GAAGGAAAAGGCCCCGGTTGGGG + Intronic
1101568777 12:105934359-105934381 GAAGGAAGAGCCTCCGGTTACGG - Intergenic
1106327262 13:28705309-28705331 GAAGGAAATGGCCAAGCTTGAGG + Intronic
1106778054 13:33027389-33027411 CAAGGTCAAGGCCCCGGTTGGGG - Intronic
1110707363 13:78610050-78610072 GTAGAAAAATGCCCCTGTTGGGG - Intergenic
1111565664 13:90011926-90011948 GAAGGAAAAGTGCCCAGTTGAGG + Intergenic
1113802395 13:113093349-113093371 GAAGGCAAAGCACCCGGGTGGGG + Intronic
1113803898 13:113102397-113102419 GAAGGCAAAGCACCCGGGTGGGG + Intergenic
1114800405 14:25768653-25768675 GAAGGAGAGGGCCACTGTTGTGG - Intergenic
1116967057 14:51025879-51025901 GAAGGAAGAGGACACGGATGAGG - Intronic
1117226723 14:53668685-53668707 CAAGGAAAAGTCCTGGGTTGAGG - Intergenic
1118709848 14:68510161-68510183 GAGGGAAAAAGCCCTGGATGGGG - Intronic
1123663740 15:22589767-22589789 GAAGGAAAAGGCACACGCTGCGG + Intergenic
1124317569 15:28684216-28684238 GAAGGAAAAGGCACACGCTGCGG + Intergenic
1126531615 15:49716723-49716745 GAAGGACAAGGCCTTGGGTGAGG + Intergenic
1127662768 15:61115632-61115654 GAAGGAAAATGCCTCAGTTACGG + Intronic
1129182666 15:73886955-73886977 GAAGGGGAAGGCCAGGGTTGGGG - Intronic
1129440487 15:75578302-75578324 GCAGGAAAAGCCCCAGTTTGGGG - Intronic
1129663452 15:77566198-77566220 GAAAGGAAAGGCCTGGGTTGAGG + Intergenic
1130416811 15:83702015-83702037 GAATGAAAAGGTCCAGGCTGAGG + Intronic
1130725373 15:86433395-86433417 GAAGGTGAAGGCCCCTGTTCAGG + Intronic
1132030527 15:98435322-98435344 GACGGAATAGGCCCCGGGCGCGG + Intergenic
1132665900 16:1081197-1081219 GAAGGAGAAGGACCAGGGTGCGG + Intergenic
1133197974 16:4184295-4184317 GAGGGAAAAGGTCGCGGCTGGGG - Intergenic
1133283712 16:4680979-4681001 GAAGGAAAATGCCCAGGTTCTGG - Intronic
1142174758 16:88639990-88640012 GAAGGCAAAGGCCCCAGGTGTGG - Exonic
1142415398 16:89938495-89938517 GGAAGAAAAGCCCCTGGTTGTGG - Intergenic
1145372702 17:22320417-22320439 GAAGGACAAGGAGCCGGGTGAGG + Intergenic
1145709949 17:26962841-26962863 GAGGTAAAAAGCCCCGGTGGGGG - Intergenic
1146580851 17:34037394-34037416 GTAGGAAAAGGCCCCGCCCGAGG - Intronic
1147320614 17:39643636-39643658 GAAGGCAGAGGCCCTGGGTGTGG - Intronic
1147458206 17:40551854-40551876 GAAGGAAAAGGCCCCCTGGGAGG - Intergenic
1148075195 17:44931738-44931760 GAAGGAAAAGGCACAGGTAGAGG + Intronic
1149260984 17:54879130-54879152 CAAGGATAAGGCCCAGGTTTGGG + Intergenic
1150122132 17:62612770-62612792 GTAGGAAAAGGCCCCGCCCGAGG + Exonic
1153803107 18:8688964-8688986 TACGGCAAAGGCCCCGGTTGGGG + Intergenic
1162788939 19:13053288-13053310 GAAGGAAAAGGAGTGGGTTGGGG - Intronic
1163752309 19:19085035-19085057 CATGGAGAAGGACCCGGTTGTGG + Intronic
1164144610 19:22504366-22504388 GGAGGAAAAGGCCCTGAGTGAGG - Intronic
1164546980 19:29174033-29174055 GAAGGAAAGGGCCTTGGGTGAGG + Intergenic
1166170698 19:41025954-41025976 GAAGGAAAACGCCCAGGGCGAGG - Intergenic
1166931450 19:46303916-46303938 CAAGGAAAAGTCCCGGGATGCGG + Exonic
1167196698 19:48033969-48033991 GAAGGAAAGGGCCTTGGCTGAGG + Intronic
1167587785 19:50384559-50384581 GCAGGAAAAGGCCGGGGTGGGGG + Intronic
925860827 2:8173452-8173474 GAAGGACAAGGACCCGGATATGG + Intergenic
926206133 2:10835405-10835427 GAAGGAATACGCCCCGGATAAGG - Intronic
929970130 2:46566896-46566918 GAAGGAAAAGAGCCAGGTTCTGG - Intronic
931648147 2:64444175-64444197 GCAGTAAAAGGCCCTGGTTAGGG + Intergenic
937102902 2:119285420-119285442 GGAGGAAAAGGCCCCGGAATTGG + Intergenic
943638076 2:190327707-190327729 AAAGGAAAGGGCCCCAGATGTGG - Intronic
944539598 2:200743088-200743110 GTAGCAGAAGGCCCCGGATGGGG - Intergenic
946330163 2:219004470-219004492 GAAGGAGAAGGCCCTTGCTGAGG + Intronic
946627287 2:221627544-221627566 GAAGCAAAAGGCCTTGGTGGGGG - Intergenic
946764904 2:223031459-223031481 GCAGGAAAAGGCCCTGTTTAAGG + Intergenic
1174568336 20:51483414-51483436 GAAAGAAAAAGCCCAGGGTGGGG + Intronic
1175582646 20:60112508-60112530 GAAGGCAAAGGCCCAGATCGTGG + Intergenic
1176100021 20:63360635-63360657 GAAGGACAAGGTCGCGGGTGGGG - Intronic
1178840577 21:36135034-36135056 AAAGAAAAAGGCCCCGGCTCCGG - Exonic
1179642265 21:42755582-42755604 AAAGGAAAGGGCCCCAGGTGTGG + Intronic
1179765799 21:43572113-43572135 GAAGGGAAAGGCCAGGCTTGGGG + Intronic
1181013915 22:20057463-20057485 GAAGGATAAGCCCCAGGTGGAGG - Intronic
1182444033 22:30379963-30379985 GAAGGAGAAGGGCCTGGTGGTGG + Intronic
950022783 3:9800233-9800255 GAAGGAAAAGGTTCTGATTGAGG + Exonic
954660566 3:52224732-52224754 GAAGGAAAAGGAAGGGGTTGTGG - Intronic
967131392 3:186473868-186473890 GAAGCAAAAGGCCCCAGCCGTGG + Intergenic
967264494 3:187678335-187678357 GAAGGAAAAGGGCCCTCTCGAGG + Intergenic
969360860 4:6662983-6663005 GAAGGAAAAGAACCAGGATGGGG + Intergenic
969416889 4:7066752-7066774 GAACGAGATGGCCCCGGGTGTGG - Intronic
970571991 4:17392472-17392494 GAAAGAAAAAGAGCCGGTTGTGG + Intergenic
977236042 4:94508409-94508431 GAAGGAAAAGGCTCCCTTGGAGG + Intronic
982782396 4:159504950-159504972 GAATAAAAAGGCCCAGGCTGGGG - Intergenic
991590011 5:68241122-68241144 GAAGGAAATGGTCCTGGTGGGGG + Intronic
992185110 5:74237008-74237030 GAAGGCAAAGGCCCTTGATGTGG + Intergenic
992829437 5:80580109-80580131 AGACGAAAATGCCCCGGTTGGGG + Intergenic
993703367 5:91143750-91143772 GAGGGGGAAGGCCCCTGTTGAGG - Intronic
995147688 5:108805592-108805614 GAACGAAAAGGTCCAGGCTGAGG + Intronic
997558777 5:134825399-134825421 GAAGGAAAAGGCCAAGGGTATGG - Intronic
998148937 5:139746227-139746249 GAACGAAAAGCCCCCCGCTGGGG - Intergenic
1001955548 5:175846043-175846065 GAAGGAAAAGGCCACAGGTGCGG - Intronic
1002171657 5:177378105-177378127 GGAGACAAAGGCCCAGGTTGCGG + Intergenic
1002172394 5:177382708-177382730 GAAGGAGGAGGCCCAGGTTTGGG + Intronic
1002310255 5:178309732-178309754 GAAGGAAGGGGTCCAGGTTGGGG - Intronic
1002928134 6:1616822-1616844 GAAGCAAATGGCCGGGGTTGGGG - Intergenic
1004647183 6:17573803-17573825 GATGGACAAGGACCCGGGTGTGG - Intergenic
1005599459 6:27411837-27411859 GAAGAGAAAGGCCCCTGTGGAGG + Intergenic
1006300488 6:33191452-33191474 GAAGGAAAAGATCAGGGTTGTGG + Intronic
1006341942 6:33452087-33452109 GAAGGAAAAGGGGGCGGCTGAGG - Exonic
1006346640 6:33487786-33487808 GAAGGAAAGGGCGCCAGGTGTGG + Intergenic
1006626031 6:35398431-35398453 GAAGGTAAAGGGCTCGGTTTTGG + Intronic
1007015922 6:38466582-38466604 GAAGGAAAAAGGGCCGGGTGCGG - Intronic
1007163730 6:39813056-39813078 GAAGGCAAGCTCCCCGGTTGTGG - Intronic
1010030877 6:71269421-71269443 GAAGGAGAAGGTCCTGGTGGGGG + Intergenic
1015234865 6:130959142-130959164 TAAGGAAAAGGCCCAGGTCAAGG + Intronic
1017440673 6:154461902-154461924 GAAGTAAAAGGCATCGGTTGCGG - Intronic
1018618620 6:165709758-165709780 GAAGGAAAGAGCCATGGTTGCGG - Intronic
1018997961 6:168724673-168724695 GGAGGACCAGGCCCTGGTTGGGG + Intergenic
1019103003 6:169647281-169647303 GCAGGAAAAGGTCCCGGCTGAGG + Intronic
1019460939 7:1158936-1158958 TCAGGAAAAGGCCCCGGGAGGGG - Intronic
1019538669 7:1541699-1541721 GCAGGCAAAGGCTCCGGGTGAGG - Exonic
1027710205 7:81591264-81591286 TAAGGAAAAGGCACTGGGTGAGG - Intergenic
1030052014 7:105546334-105546356 GAAGGGAAAGGTCCCGGGAGAGG + Intronic
1033406305 7:141073784-141073806 GAAGTAGAACGCCCCGGATGCGG - Intergenic
1036309995 8:7679048-7679070 GAAGGGAGAGGTCCTGGTTGGGG - Intergenic
1036359540 8:8067054-8067076 GAAGGGAGAGGTCCTGGTTGGGG + Intergenic
1036578904 8:10054636-10054658 GAAGGAACAGACCCCTGTAGCGG + Exonic
1036891416 8:12599898-12599920 GAAGGGAGAGGTCCTGGTTGGGG - Intergenic
1038416068 8:27397035-27397057 GCAGGAAAGGGCCCAGGTGGAGG - Intronic
1038452020 8:27645864-27645886 GAATGAAAAAGCCCTGGCTGAGG - Intronic
1040590677 8:48789679-48789701 GAAGGAAGAAGCCGCGGGTGTGG + Intergenic
1041191684 8:55361581-55361603 GAAGGAAGAGGGCACGGGTGAGG - Intronic
1043822935 8:84890899-84890921 GAAGGAAAGGAACACGGTTGTGG + Intronic
1044320410 8:90794632-90794654 GAAGGAAAAGCCAACAGTTGTGG - Intronic
1044748020 8:95390024-95390046 GGAGGAAAAGGGCCCAGTTCAGG + Intergenic
1047557877 8:125952222-125952244 GAAGGAAAATGGACCAGTTGTGG - Intergenic
1049230700 8:141479793-141479815 GAAGGAGAAGGCTCAGGCTGTGG + Intergenic
1049744723 8:144258408-144258430 GCAGGAACAGGCCCGGGGTGGGG + Intronic
1056767824 9:89455530-89455552 GAAGGGAAGGGCCCCAGTTGAGG - Intronic
1061283338 9:129609595-129609617 CACGGAAAAGGGCCCTGTTGGGG + Intronic
1061402405 9:130375687-130375709 GAAGGACGGGGCCCCGTTTGAGG + Intronic
1062514587 9:136926201-136926223 GAAGGGAGAGGCCCTGGGTGGGG + Exonic
1193707535 X:84840664-84840686 GAAAGAAAAGGAACCGGTTGAGG - Intergenic
1194777893 X:97988154-97988176 TAATGAAAAGGCACAGGTTGCGG + Intergenic
1200124079 X:153805069-153805091 GAAGGAAAAGGGCGCTGGTGGGG - Intronic