ID: 1100839087

View in Genome Browser
Species Human (GRCh38)
Location 12:98593891-98593913
Sequence AAGGCCCCGGTTGGGGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 92}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100839076_1100839087 13 Left 1100839076 12:98593855-98593877 CCGTGACCTCTTCAAGGGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 141
Right 1100839087 12:98593891-98593913 AAGGCCCCGGTTGGGGTTCCAGG 0: 1
1: 0
2: 0
3: 13
4: 92
1100839075_1100839087 16 Left 1100839075 12:98593852-98593874 CCGCCGTGACCTCTTCAAGGGCG 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1100839087 12:98593891-98593913 AAGGCCCCGGTTGGGGTTCCAGG 0: 1
1: 0
2: 0
3: 13
4: 92
1100839078_1100839087 7 Left 1100839078 12:98593861-98593883 CCTCTTCAAGGGCGTGGAGACGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1100839087 12:98593891-98593913 AAGGCCCCGGTTGGGGTTCCAGG 0: 1
1: 0
2: 0
3: 13
4: 92
1100839072_1100839087 29 Left 1100839072 12:98593839-98593861 CCTCTTTCGAAGGCCGCCGTGAC 0: 1
1: 0
2: 0
3: 4
4: 29
Right 1100839087 12:98593891-98593913 AAGGCCCCGGTTGGGGTTCCAGG 0: 1
1: 0
2: 0
3: 13
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100839087 Original CRISPR AAGGCCCCGGTTGGGGTTCC AGG Intronic
900255000 1:1693294-1693316 ACTGCCCAGGTTTGGGTTCCAGG + Intronic
900263743 1:1746560-1746582 ACTGCCCAGGTTTGGGTTCCAGG + Intergenic
900647329 1:3714852-3714874 AAGGCCCCAGATGGGGTACCTGG + Intronic
901318713 1:8325884-8325906 CAGGCCCCACTTGTGGTTCCCGG - Exonic
901707942 1:11090421-11090443 AAGGCCCAGGTTGGGGTGTAAGG + Intronic
901810888 1:11766306-11766328 AAGTCCCCGCTAGGGGTGCCTGG - Exonic
912486731 1:110034890-110034912 AGGGGCCAGGTTGGGCTTCCCGG + Intronic
914247625 1:145897630-145897652 AAGGCCCCATTTGTGGTTCGAGG - Exonic
915937584 1:160098380-160098402 CAGGCCCCCGTTCCGGTTCCCGG - Intronic
919742891 1:200991209-200991231 AGGGCCCAGGTTGGGGTGCCGGG + Intronic
1064245731 10:13666337-13666359 AAAGCACCGGTTTGGGTTACTGG + Intronic
1064384675 10:14879244-14879266 CAGTCCCCGGTTGGAGGTCCGGG + Intronic
1070747726 10:78944867-78944889 AAGGCCAAGGTTGAGGTTCCTGG - Intergenic
1076350420 10:129811474-129811496 GAGGCTCCGGTGGGGGTTCAGGG - Intergenic
1079257118 11:18840782-18840804 AAGGCCCTGGCTGGAGTTGCTGG - Intergenic
1083330003 11:61893066-61893088 ATGTGCCAGGTTGGGGTTCCAGG - Intergenic
1083694944 11:64436545-64436567 AAGGCCCTGGAGGGGGTTCCTGG + Intergenic
1084079761 11:66814123-66814145 ATGGCCCAGGTTGGGGTTTGGGG + Intronic
1085520864 11:77138218-77138240 ATGGCCCGGTTTAGGGTTCCGGG + Intronic
1085559284 11:77455565-77455587 ATGGACCCGGCTGGGCTTCCAGG - Intronic
1089182850 11:116594942-116594964 CAGGCTCAGGTTGGGGGTCCTGG + Intergenic
1092423897 12:8357556-8357578 AAAGCCCCAGTTGGGATTGCTGG - Intergenic
1097211763 12:57376279-57376301 AAGGCCCTGATTGGGGTTTGGGG - Intronic
1100839087 12:98593891-98593913 AAGGCCCCGGTTGGGGTTCCAGG + Intronic
1105853306 13:24354918-24354940 CAGGCCCCGGGTGGGGACCCTGG + Intergenic
1114492793 14:23113787-23113809 AAGATCCCGGTTGGGGTTGTGGG - Intergenic
1118990251 14:70791275-70791297 AGGGCCTTGGTTGGGGTTTCTGG - Intronic
1121396283 14:93626102-93626124 AAGGACCCAGTTGAGGTTCATGG - Intronic
1122795904 14:104206091-104206113 AAGGCCCCAGATGGTGTCCCAGG - Intergenic
1124323584 15:28737654-28737676 GAGGCACCGGTTGCGCTTCCTGG + Intronic
1125169782 15:36753328-36753350 GAGGCTCCGTTTGGGGCTCCAGG - Intronic
1126462181 15:48926072-48926094 AAGGCACCGGTGGGGTATCCAGG + Intronic
1128881007 15:71242832-71242854 AAGGCCCATGTTGGGGGACCTGG - Exonic
1129664575 15:77572390-77572412 GAGGCCCAGGTCGGGGCTCCTGG + Intergenic
1132807566 16:1782198-1782220 TGGGCCCCGGGTGGGGTTCCAGG + Intronic
1135058341 16:19249785-19249807 CAGGCCCTGGTTGGTGTTTCTGG + Intronic
1135978012 16:27123905-27123927 AAGGCCCTGTTTGGGGCTCGTGG + Intergenic
1139654447 16:68378774-68378796 AAGGGCCCAGTAAGGGTTCCAGG - Intronic
1144051756 17:11502764-11502786 CAGGCACTGGGTGGGGTTCCGGG + Intronic
1146970437 17:37067650-37067672 AACACCCGGGGTGGGGTTCCTGG - Intergenic
1149260985 17:54879137-54879159 AAGGCCCAGGTTTGGGTCCCAGG + Intergenic
1152089908 17:78240586-78240608 ACGGCCCCGTTTGGGGTTTGGGG + Exonic
1152778002 17:82214004-82214026 ATGGGCCAGGTTGGGGGTCCAGG - Intergenic
1152884587 17:82842147-82842169 AAGGCCAAGGTGGGGCTTCCGGG - Intronic
1157576294 18:48746117-48746139 GAGGAGCCGGTTGGGCTTCCTGG - Intronic
1157884295 18:51351481-51351503 CAGGACCCGGGTGGGGTTTCAGG - Intergenic
1158441350 18:57476989-57477011 AAGGCCCCATTTGGGTTTCTGGG - Exonic
1159100821 18:63956082-63956104 GAGGCCACAGTTGTGGTTCCTGG + Intronic
1160696727 19:488690-488712 CAGGGCCCGGTCGGGGATCCAGG - Intergenic
1161342498 19:3750960-3750982 CAGGCCCAGGATGGGGCTCCGGG + Exonic
1164881471 19:31735774-31735796 ATAGCCCCAGTTGGGCTTCCGGG + Intergenic
1167649471 19:50721520-50721542 AAGGCCCCTCCTGGGGCTCCCGG + Intergenic
1168060555 19:53889783-53889805 AAGCGCCCGGTCTGGGTTCCGGG + Intronic
925718756 2:6808409-6808431 ATGGCCCAGGGTGGGGTTCCTGG - Intergenic
929414092 2:41729826-41729848 AATGCCCAGGGTGGGGTTGCAGG - Intergenic
933979888 2:87540790-87540812 AAGGCAGAGGTTGGGGTTCCTGG + Intergenic
936313932 2:111410001-111410023 AAGGCAGAGGTTGGGGTTCCTGG - Intergenic
936522761 2:113221718-113221740 AAGGCCTGGGTTGGGGTTAGTGG + Intronic
939613130 2:144333000-144333022 AGGGCCCCTGTGCGGGTTCCTGG + Intergenic
945035335 2:205699584-205699606 AAGGCCCTGCTTTGGGTTGCAGG + Intronic
948305017 2:236940266-236940288 AAGGACCAGGGTGGGGGTCCAGG + Intergenic
1172189271 20:33052152-33052174 AAGGCCTAGGGTGGTGTTCCAGG - Intergenic
1173176973 20:40771867-40771889 AAGGGACTGGTTGGGGGTCCTGG - Intergenic
1176180572 20:63747557-63747579 CAGGGCCCGGTTGGGGTTGGGGG + Intronic
1176413403 21:6461137-6461159 AAGGCCCAGGGAGGGGTTGCGGG - Intergenic
1179688900 21:43069460-43069482 AAGGCCCAGGGAGGGGTTGCGGG - Intronic
1179808412 21:43854654-43854676 CAGGGCCCGGGTGGGGTTGCCGG + Intergenic
1184510861 22:44932395-44932417 AGGGCCCAGGTTGGGGGTTCAGG - Intronic
1185171620 22:49297792-49297814 CAGGCCCCGCTGGGGGATCCAGG + Intergenic
949666725 3:6347581-6347603 AAAGCCCGGGTTGGTGTTGCAGG + Intergenic
950467656 3:13164801-13164823 AAAGCCTCGCTTGGGCTTCCTGG + Intergenic
950651561 3:14410451-14410473 AGAGCCCAGGATGGGGTTCCTGG + Intronic
953853719 3:46485058-46485080 AGGGCCCCAGCTGGAGTTCCAGG + Intronic
961665790 3:128492589-128492611 AAGGCCCCAGTTCGGGGGCCGGG + Intronic
970332532 4:15001942-15001964 CAGGCGCCGGTCGGGGTCCCGGG + Intergenic
971119370 4:23687155-23687177 AAGGCCCAGGTTGTTGTTCCAGG - Intergenic
975128309 4:70806796-70806818 AAGGCAGTGGTTGGGGTTACTGG + Exonic
977255146 4:94732331-94732353 AAGTCCTAGGTTGGGTTTCCTGG + Intergenic
977508991 4:97938072-97938094 AAGCCCCCGGCTGGAGTTGCTGG + Intronic
977666710 4:99652309-99652331 AAGGCCCCGGCAAGGGTCCCGGG - Exonic
979289590 4:118965282-118965304 AAGGCCCTGGTTGGGGTGGGGGG - Intronic
982249307 4:153388697-153388719 AAGGCCCGGGTTGGGGCTAGTGG - Intronic
986136843 5:4987903-4987925 AAGGCCCAGGTGGGCTTTCCTGG + Intergenic
989631042 5:43483478-43483500 CTGGCCCAGGGTGGGGTTCCGGG - Intronic
1003240822 6:4344256-4344278 AGGGCCCAGGCTGTGGTTCCAGG + Intergenic
1004625590 6:17373722-17373744 AAGTCCCTGGCTGGGGTTCCAGG - Intergenic
1013076317 6:106774806-106774828 AATGCCCCTGTTGGGGTAGCAGG - Intergenic
1016590102 6:145735129-145735151 GAGGCCCCGGTTGGGGGTGCGGG + Intronic
1025181315 7:56825226-56825248 CAGGCCCAGGTTGGGCCTCCCGG - Intronic
1029503745 7:100949788-100949810 AAGGCACCGCTTGGGGCTCTGGG + Intronic
1034824553 7:154249946-154249968 CAGGCCCCGGGTGTGGTACCAGG - Intronic
1035222704 7:157415571-157415593 AGAGCCCAGGGTGGGGTTCCGGG + Intronic
1035222728 7:157415654-157415676 AGGTCCCAGGGTGGGGTTCCAGG + Intronic
1035361842 7:158318514-158318536 TGGGCCCCGCTTGGGGGTCCAGG - Intronic
1038879093 8:31587877-31587899 AATGCCCCAGTTTGGCTTCCTGG - Intergenic
1044821829 8:96160479-96160501 GAGGCCGCGGCTGTGGTTCCTGG + Exonic
1056569887 9:87805935-87805957 GAGGCCAAGGTTGGAGTTCCCGG - Intergenic
1056840945 9:89997580-89997602 AAGGCTCCTCGTGGGGTTCCAGG + Intergenic
1061043027 9:128150643-128150665 AAGGCACTGGGTGGGGTTCCAGG - Intronic
1061283339 9:129609602-129609624 AAGGGCCCTGTTGGGGCCCCTGG + Intronic
1062445650 9:136593081-136593103 CAGCCCCCGGTTTGGGTTGCAGG + Intergenic
1203780976 EBV:100740-100762 AAGACCCTGGTCGGGCTTCCGGG - Intergenic
1187670166 X:21658632-21658654 AGGAACCCGGTTGGGGTTGCGGG + Intergenic
1192370075 X:70505883-70505905 AAGGCCCAGGTTGAGGTTGTCGG - Intergenic
1194223622 X:91227406-91227428 AAGGCCCTTGATGTGGTTCCTGG - Intergenic
1200560088 Y:4690788-4690810 AAGGCCCTTGATGTGGTTCCTGG - Intergenic