ID: 1100839088

View in Genome Browser
Species Human (GRCh38)
Location 12:98593892-98593914
Sequence AGGCCCCGGTTGGGGTTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100839072_1100839088 30 Left 1100839072 12:98593839-98593861 CCTCTTTCGAAGGCCGCCGTGAC 0: 1
1: 0
2: 0
3: 4
4: 29
Right 1100839088 12:98593892-98593914 AGGCCCCGGTTGGGGTTCCAGGG 0: 1
1: 0
2: 1
3: 8
4: 128
1100839076_1100839088 14 Left 1100839076 12:98593855-98593877 CCGTGACCTCTTCAAGGGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 141
Right 1100839088 12:98593892-98593914 AGGCCCCGGTTGGGGTTCCAGGG 0: 1
1: 0
2: 1
3: 8
4: 128
1100839078_1100839088 8 Left 1100839078 12:98593861-98593883 CCTCTTCAAGGGCGTGGAGACGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1100839088 12:98593892-98593914 AGGCCCCGGTTGGGGTTCCAGGG 0: 1
1: 0
2: 1
3: 8
4: 128
1100839075_1100839088 17 Left 1100839075 12:98593852-98593874 CCGCCGTGACCTCTTCAAGGGCG 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1100839088 12:98593892-98593914 AGGCCCCGGTTGGGGTTCCAGGG 0: 1
1: 0
2: 1
3: 8
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100839088 Original CRISPR AGGCCCCGGTTGGGGTTCCA GGG Intronic
900647330 1:3714853-3714875 AGGCCCCAGATGGGGTACCTGGG + Intronic
903738411 1:25544365-25544387 AGGCCCCGCCTGGGGTGCCTCGG + Intronic
906306880 1:44725095-44725117 GGGACCCGGCTGGGGTGCCAGGG - Intronic
912476074 1:109935774-109935796 AGGCCTGGGCTGGGGTTGCATGG + Intergenic
917315288 1:173718504-173718526 TTGCCCAGGTTGGGGTTCAATGG - Intronic
918042642 1:180922461-180922483 AGGCCCCTGCTGGGATTCCTTGG + Intronic
1064384676 10:14879245-14879267 AGTCCCCGGTTGGAGGTCCGGGG + Intronic
1066100814 10:32116840-32116862 ATGCCAAGGTGGGGGTTCCATGG + Intergenic
1068663338 10:59646825-59646847 AGGCCCTTGTTGGGGATGCAGGG + Intergenic
1068712546 10:60150200-60150222 AGGCACCGGATGAGGTCCCAGGG - Intronic
1069046488 10:63748982-63749004 AGGCCACAGTTTGAGTTCCATGG + Intergenic
1069846691 10:71377165-71377187 AGGCCCAGGCTGGGGTGGCACGG + Intergenic
1070747725 10:78944866-78944888 AGGCCAAGGTTGAGGTTCCTGGG - Intergenic
1073009363 10:100347569-100347591 AGGCGCGGGCTGGGCTTCCAGGG + Intronic
1075629686 10:123993688-123993710 GGGCTGGGGTTGGGGTTCCAAGG - Intergenic
1076142819 10:128093165-128093187 GGGAGCCGGTGGGGGTTCCAGGG + Intergenic
1077042305 11:530183-530205 AGGGCCCCGCTGGGGTTGCAGGG - Intergenic
1077181347 11:1218618-1218640 AGGACCCAGTTGGGGCTCCTTGG + Intergenic
1077258029 11:1597935-1597957 TGGCTCCTGTGGGGGTTCCAAGG - Exonic
1077258909 11:1604955-1604977 AGGACCCTGGTGGGGTTGCAGGG + Intergenic
1077259445 11:1608061-1608083 TGGCTCCTGTGGGGGTTCCAAGG - Exonic
1077261149 11:1621739-1621761 TGGCTCCTGTGGGGGTTCCAAGG - Exonic
1078107126 11:8365513-8365535 TGACCCAGGTTGGGCTTCCAGGG + Intergenic
1078535174 11:12167374-12167396 AGGCCCCGGTTTGTGCTCGAGGG + Intronic
1083307166 11:61767164-61767186 AGGCCAGGCTTGGGGTGCCAGGG + Intronic
1083694945 11:64436546-64436568 AGGCCCTGGAGGGGGTTCCTGGG + Intergenic
1084381434 11:68815726-68815748 GGGCCAGGGTTGGGGTACCACGG - Intronic
1084381473 11:68815856-68815878 GGGCCAGGGTTGGGGTACCACGG - Intronic
1084381496 11:68815921-68815943 GGGCCAGGGTTGGGGTACCACGG - Intronic
1084381518 11:68815986-68816008 GGGCCAGGGTTGGGGTACCACGG - Intronic
1085248977 11:75129205-75129227 AGGGCCAGGTTGTGGTGCCAAGG + Intronic
1089498087 11:118917901-118917923 AGGCCCCAGGTGGGGGTCAAAGG + Intronic
1090000154 11:122949423-122949445 AGGCCCCACTTGAGGATCCATGG - Intronic
1100839088 12:98593892-98593914 AGGCCCCGGTTGGGGTTCCAGGG + Intronic
1102492784 12:113298947-113298969 GGGCCCTGGGCGGGGTTCCAAGG - Exonic
1104785399 12:131445146-131445168 TGGCCCAGGTTGGGGTTGGAAGG - Intergenic
1104986957 12:132602791-132602813 AGGCCCTGGCTGAGCTTCCATGG - Intergenic
1105345181 13:19564960-19564982 AGGCCTCGGCTGGAGTTCCCCGG + Intergenic
1106778053 13:33027381-33027403 AGGCCCCGGTTGGGGAAACCTGG - Intronic
1113121178 13:106925001-106925023 AGGCACCGGGTGGGGTGTCAGGG + Intergenic
1120062429 14:79999963-79999985 TGGCACAGGTTGGGGTTACATGG - Intergenic
1123053820 14:105560067-105560089 AGCCCAGGGTGGGGGTTCCATGG + Intergenic
1123078403 14:105680484-105680506 AGCCCAGGGTGGGGGTTCCATGG + Intergenic
1123127024 14:105954040-105954062 ACACCCTGGTTGGGCTTCCAAGG - Intergenic
1123407483 15:20029860-20029882 ACACCCTGGTTGGGCTTCCAAGG - Intergenic
1123516811 15:21036516-21036538 ACACCCTGGTTGGGCTTCCAAGG - Intergenic
1124376874 15:29134043-29134065 AGGCCCAATTTGGGGGTCCATGG - Intronic
1125503712 15:40254552-40254574 AGGCAACAGTTGAGGTTCCAGGG - Intronic
1127263381 15:57342319-57342341 TTGCCCAGGTTGGGGTTCCATGG + Intergenic
1127681465 15:61302431-61302453 AGGCCATGGATGGGGGTCCATGG - Intergenic
1128308165 15:66613656-66613678 AGAGCCCCGGTGGGGTTCCAGGG + Intronic
1131116237 15:89797777-89797799 GGGCCTGGGTTGGGGTTCCCAGG - Intronic
1132587336 16:711336-711358 AGGCCCCTTCTGGGGTTTCAGGG + Intronic
1132594306 16:741195-741217 AGGCCCCGGGTTGGGGTGCAGGG + Intronic
1132807567 16:1782199-1782221 GGGCCCCGGGTGGGGTTCCAGGG + Intronic
1132824407 16:1896251-1896273 AGGCCCCGCAAGGGGATCCAGGG + Intergenic
1133077509 16:3291055-3291077 AGGCCCCAGTTGGGAAGCCATGG + Exonic
1133202613 16:4213447-4213469 TCGCCCAGGTTGGGGTTCAATGG + Intronic
1134631716 16:15760882-15760904 AGGCCCCAGTTGGGGGTTTAGGG + Intronic
1134664599 16:16009716-16009738 AGGCCCTGGGGGAGGTTCCAGGG + Intronic
1139654446 16:68378773-68378795 AGGGCCCAGTAAGGGTTCCAGGG - Intronic
1140565354 16:76035518-76035540 GGGCCCTGGTTGGGGTCCCCAGG + Intergenic
1140910086 16:79443305-79443327 AGGCAGGGGTTGGGGTGCCATGG - Intergenic
1141130080 16:81430343-81430365 TCGCCCAGGCTGGGGTTCCATGG + Intergenic
1142284823 16:89167418-89167440 CTGCCCGGGTTGGGGCTCCAAGG + Intergenic
1144051757 17:11502765-11502787 AGGCACTGGGTGGGGTTCCGGGG + Intronic
1147459889 17:40561567-40561589 GGGCTCCGGTTGGAGTTCTAGGG - Intronic
1147882191 17:43661192-43661214 AGGCCCGGCAGGGGGTTCCAAGG - Exonic
1149175933 17:53870107-53870129 TGACCCAGGTTGGAGTTCCATGG + Intergenic
1151482116 17:74375978-74376000 TTGCCCAGGTTGGAGTTCCATGG - Intergenic
1151704601 17:75760131-75760153 AGGCCCAGGCTGGAGTGCCATGG + Intronic
1151820300 17:76493396-76493418 AGGCCCAGCTTGGGGATGCATGG - Intronic
1152433675 17:80262744-80262766 AGGCACTGGGTGGGGTTCCCTGG - Intronic
1152778001 17:82214003-82214025 TGGGCCAGGTTGGGGGTCCAGGG - Intergenic
1152858490 17:82680211-82680233 AGGCCCCAGTGTGGGGTCCAAGG - Intronic
1153342957 18:3994167-3994189 AGGCCCTGGCTGGGGTGCCGAGG + Intronic
1153962296 18:10149983-10150005 AGGCCCTGGATGGGCTTCCACGG + Intergenic
1157576293 18:48746116-48746138 AGGAGCCGGTTGGGCTTCCTGGG - Intronic
1159100822 18:63956083-63956105 AGGCCACAGTTGTGGTTCCTGGG + Intronic
1161342499 19:3750961-3750983 AGGCCCAGGATGGGGCTCCGGGG + Exonic
1163826974 19:19529317-19529339 GGGCCACGGTTGGGGTTCGGTGG - Intronic
1165092857 19:33395838-33395860 AGGCTCCGGCCGGGGTCCCAGGG + Intronic
1165901160 19:39169954-39169976 AGGCTCAGGTTGGGGTGGCATGG - Intronic
1166669460 19:44701267-44701289 GGGGCCCGGTTTGGGTACCAGGG - Intronic
1167420409 19:49399363-49399385 AGGCCCTGGTTGTGTTTTCAGGG + Intronic
929414091 2:41729825-41729847 ATGCCCAGGGTGGGGTTGCAGGG - Intergenic
933979889 2:87540791-87540813 AGGCAGAGGTTGGGGTTCCTGGG + Intergenic
936313931 2:111410000-111410022 AGGCAGAGGTTGGGGTTCCTGGG - Intergenic
936971755 2:118183279-118183301 ACGCTCCAGTTTGGGTTCCAAGG - Intergenic
937991368 2:127664213-127664235 GGGCCCCGGTCGGGTTTCCGAGG + Intronic
945035336 2:205699585-205699607 AGGCCCTGCTTTGGGTTGCAGGG + Intronic
1169191931 20:3663313-3663335 AGGCCAGGGTTCGGGGTCCAGGG + Intronic
1176180573 20:63747558-63747580 AGGGCCCGGTTGGGGTTGGGGGG + Intronic
1179808413 21:43854655-43854677 AGGGCCCGGGTGGGGTTGCCGGG + Intergenic
1179902140 21:44399834-44399856 AGGCCCTGCCGGGGGTTCCAGGG - Intronic
1180965845 22:19787593-19787615 AAGCCCAGGTGGGGGTCCCAAGG + Exonic
1182299930 22:29331647-29331669 AGGCCCAGGTTGGGGAACGAAGG - Intronic
1184510860 22:44932394-44932416 GGGCCCAGGTTGGGGGTTCAGGG - Intronic
1185224251 22:49644007-49644029 TGGCCTCTGTGGGGGTTCCATGG - Intronic
949666726 3:6347582-6347604 AAGCCCGGGTTGGTGTTGCAGGG + Intergenic
953853720 3:46485059-46485081 GGGCCCCAGCTGGAGTTCCAGGG + Intronic
954680698 3:52344424-52344446 GGGCCCCGGCTGGGGTTCACAGG + Intronic
954795669 3:53160445-53160467 AGGGACCAGTTGGGGTTCTAGGG - Intronic
955118672 3:56032700-56032722 AGTGCCTGGTTGGGGTTCCAAGG - Intronic
956741883 3:72281742-72281764 ATGCCCTGGTGGGGGTTTCAGGG - Intergenic
961002753 3:123384943-123384965 AGGACCAGGGTGGGGTCCCAGGG - Intronic
969227441 4:5808083-5808105 AGGCCCCTCTTGGGGCTCCCAGG + Intronic
971119369 4:23687154-23687176 AGGCCCAGGTTGTTGTTCCAGGG - Intergenic
981517382 4:145624671-145624693 AGGCTCAGGTTTGGGTTCCATGG + Intronic
986315403 5:6583341-6583363 AGGTCCCCCATGGGGTTCCAGGG - Intergenic
991655954 5:68904008-68904030 AGGTCACGTTTGGGGTTTCATGG - Intergenic
992723137 5:79580267-79580289 GGGACTGGGTTGGGGTTCCAAGG - Intergenic
995109975 5:108418173-108418195 ACACCCCCTTTGGGGTTCCATGG + Intergenic
998110205 5:139495600-139495622 AGGCTCAGGTTTGGGTTCCACGG - Intergenic
1002784609 6:391983-392005 AGGCGCTGGTTTGGGCTCCAAGG + Intronic
1005626691 6:27669073-27669095 AGGCCCAGGCTGGGGTACTATGG - Intergenic
1006390003 6:33752619-33752641 AGGCCCTGCCTGGGGTTGCAGGG + Intergenic
1018054611 6:160041118-160041140 AGGCACCGGATGAGGTGCCAAGG + Intronic
1023816463 7:43954202-43954224 AGGCCCCTTTTGGGGTTCTTTGG + Exonic
1033290065 7:140076080-140076102 AGGCCGGGGGTGGGGGTCCATGG - Intergenic
1034440286 7:151082642-151082664 AGGACCCTGTGGAGGTTCCAGGG - Intronic
1034501742 7:151455131-151455153 ATGCCCGGCTTGGGGTTCCAAGG + Intergenic
1035373332 7:158392726-158392748 AGGCTCCGGCTTGGCTTCCAAGG - Intronic
1038033869 8:23669827-23669849 TGGCCCCGTATGGGATTCCATGG + Intergenic
1044198692 8:89409176-89409198 GGTGCCTGGTTGGGGTTCCAAGG - Intergenic
1049460657 8:142726312-142726334 GGGCCTGGGCTGGGGTTCCAGGG - Intergenic
1052799643 9:32955959-32955981 AGGCCCCGGCTGGAGCCCCATGG + Intergenic
1056569886 9:87805934-87805956 AGGCCAAGGTTGGAGTTCCCGGG - Intergenic
1057827630 9:98382978-98383000 TGGCCCAGGCTGGGGTGCCATGG + Intronic
1060749290 9:126158264-126158286 AGTCCCCAGTGGGGGTTTCAGGG - Intergenic
1060819020 9:126651072-126651094 AGGTCCTGGATGGGGCTCCAGGG + Intronic
1062095697 9:134702046-134702068 AGGAGCCTGTAGGGGTTCCAGGG + Intronic
1062445651 9:136593082-136593104 AGCCCCCGGTTTGGGTTGCAGGG + Intergenic
1187392306 X:18894189-18894211 AGGACCAGGTGGGGGTGCCAGGG - Exonic
1196963609 X:121030819-121030841 CAGGCCTGGTTGGGGTTCCAAGG + Intergenic
1197279088 X:124514328-124514350 AGACCCCAGTTGGGTTTCGATGG - Intronic
1199673525 X:150165989-150166011 TGGCACCAGCTGGGGTTCCAAGG - Intergenic
1199971554 X:152865522-152865544 AGGCCCTGGTTTGCGTTCAAAGG - Intronic