ID: 1100839089 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:98593895-98593917 |
| Sequence | GCGCCCTGGAACCCCAACCG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 111 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 8, 4: 101} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1100839089_1100839094 | -7 | Left | 1100839089 | 12:98593895-98593917 | CCCCGGTTGGGGTTCCAGGGCGC | 0: 1 1: 0 2: 1 3: 8 4: 101 |
||
| Right | 1100839094 | 12:98593911-98593933 | AGGGCGCCGGTAACGTTAACCGG | 0: 1 1: 0 2: 0 3: 0 4: 6 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1100839089 | Original CRISPR | GCGCCCTGGAACCCCAACCG GGG (reversed) | Intronic | ||