ID: 1100839089

View in Genome Browser
Species Human (GRCh38)
Location 12:98593895-98593917
Sequence GCGCCCTGGAACCCCAACCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100839089_1100839094 -7 Left 1100839089 12:98593895-98593917 CCCCGGTTGGGGTTCCAGGGCGC 0: 1
1: 0
2: 1
3: 8
4: 101
Right 1100839094 12:98593911-98593933 AGGGCGCCGGTAACGTTAACCGG 0: 1
1: 0
2: 0
3: 0
4: 6

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100839089 Original CRISPR GCGCCCTGGAACCCCAACCG GGG (reversed) Intronic