ID: 1100839091

View in Genome Browser
Species Human (GRCh38)
Location 12:98593897-98593919
Sequence CGGCGCCCTGGAACCCCAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100839091_1100839094 -9 Left 1100839091 12:98593897-98593919 CCGGTTGGGGTTCCAGGGCGCCG 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1100839094 12:98593911-98593933 AGGGCGCCGGTAACGTTAACCGG 0: 1
1: 0
2: 0
3: 0
4: 6

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100839091 Original CRISPR CGGCGCCCTGGAACCCCAAC CGG (reversed) Intronic