ID: 1100839092

View in Genome Browser
Species Human (GRCh38)
Location 12:98593898-98593920
Sequence CGGTTGGGGTTCCAGGGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100839075_1100839092 23 Left 1100839075 12:98593852-98593874 CCGCCGTGACCTCTTCAAGGGCG 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1100839092 12:98593898-98593920 CGGTTGGGGTTCCAGGGCGCCGG 0: 1
1: 0
2: 2
3: 8
4: 100
1100839078_1100839092 14 Left 1100839078 12:98593861-98593883 CCTCTTCAAGGGCGTGGAGACGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1100839092 12:98593898-98593920 CGGTTGGGGTTCCAGGGCGCCGG 0: 1
1: 0
2: 2
3: 8
4: 100
1100839076_1100839092 20 Left 1100839076 12:98593855-98593877 CCGTGACCTCTTCAAGGGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 141
Right 1100839092 12:98593898-98593920 CGGTTGGGGTTCCAGGGCGCCGG 0: 1
1: 0
2: 2
3: 8
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100839092 Original CRISPR CGGTTGGGGTTCCAGGGCGC CGG Intronic
900587495 1:3440157-3440179 TGGCTGGGGTTCCAGGGAGGTGG + Intergenic
901893046 1:12284604-12284626 CGGCCGGGGTTCCAGGGCTCTGG - Intronic
902920814 1:19665236-19665258 CGTGTGGGGTACCAGGGCGGGGG - Intergenic
903656165 1:24949954-24949976 CTCCTGGGGTTCCAGGGCCCAGG - Intronic
907430014 1:54406226-54406248 CGGAAGGAGTTCCAGGGCGATGG - Exonic
912445151 1:109730084-109730106 GGGTTGGGCTTCCAGGTCACAGG + Intronic
920436320 1:205949333-205949355 GGGCTGGGGCTCCAGGGCTCAGG - Intergenic
920928320 1:210363648-210363670 CTGTAGGGGGTCCAGGGCCCAGG + Intronic
922464552 1:225838340-225838362 CTGCTGGGTTTCCAGGGCTCAGG - Intronic
1067040800 10:42952181-42952203 CTGTTAGGGTTCCACGGAGCAGG - Intergenic
1070788684 10:79177020-79177042 CGGGTGGGGTCCCAGGACCCAGG - Intronic
1072727267 10:97822220-97822242 GGGGTGGGGTTCCAGAGCTCAGG + Intergenic
1076028822 10:127140846-127140868 CGGTAGATGTTCCAGGGCACTGG + Intronic
1076078232 10:127554696-127554718 CAGGTGGGGATGCAGGGCGCGGG + Intergenic
1076142822 10:128093171-128093193 CGGTGGGGGTTCCAGGGCCCGGG + Intergenic
1076750269 10:132538732-132538754 GGGTTTGGGGTCCAGGGCTCAGG - Intronic
1078928186 11:15892745-15892767 AGGTTTGGTTTCCAGGGTGCTGG - Intergenic
1079300684 11:19276465-19276487 CAGTTGGGGGCCCAGGGCCCAGG + Intergenic
1086106855 11:83156689-83156711 CGGTGGGGGTTGGAGGGAGCGGG - Intergenic
1086888340 11:92227106-92227128 CGGCTGGGGTTCCTGTGCGTGGG + Intergenic
1090473507 11:127000397-127000419 CGGCTGGGTTGTCAGGGCGCGGG - Intronic
1090729238 11:129555425-129555447 GGGTTGGGCTTCCAAGGCCCAGG - Intergenic
1092154397 12:6273151-6273173 CGGCTTGGCTTCCAGGGCTCAGG + Intergenic
1100839092 12:98593898-98593920 CGGTTGGGGTTCCAGGGCGCCGG + Intronic
1100983837 12:100186383-100186405 AGGTTGGGGGTCCAGGGAGGAGG + Intergenic
1102347382 12:112168690-112168712 CAGCTGGGGTTCCAGGGTCCAGG - Intronic
1103989199 12:124786819-124786841 CATTTAGGGTTCCAGGGCCCCGG - Intronic
1104916659 12:132269096-132269118 AGGTTGGGGTTCCAGGGCTCAGG - Intronic
1104941069 12:132395553-132395575 CGATGCGGGTCCCAGGGCGCTGG - Intergenic
1108356930 13:49636561-49636583 CGGTTAGGGCACAAGGGCGCTGG - Intergenic
1114037892 14:18646427-18646449 CGGGAGGAGTTCCAGGGCGATGG - Intergenic
1114120729 14:19668601-19668623 CGGGAGGAGTTCCAGGGCGATGG + Intergenic
1115257711 14:31420444-31420466 CAGTCGGGGATCCAGGGAGCGGG - Intronic
1117016124 14:51519167-51519189 CCGTTGGGGTGGCAGGGGGCGGG - Intronic
1123042019 14:105494166-105494188 CGGGTGGGGGCCCAGGACGCAGG + Intronic
1124648127 15:31454196-31454218 CGCTTGTGCTGCCAGGGCGCCGG - Intergenic
1131466019 15:92655493-92655515 CGGGTGGTGTTCCCGGGCCCCGG + Exonic
1132154607 15:99486645-99486667 CGGGTGGCTTGCCAGGGCGCTGG + Intergenic
1132585489 16:704376-704398 CAGTTGGGGTGGCAGGGGGCAGG + Intronic
1141801377 16:86311631-86311653 CTTTTGGGGATCCAGGGCACTGG - Intergenic
1142398336 16:89845734-89845756 CGGGTGGGGTTTCGGGGCACTGG - Intronic
1143007836 17:3848356-3848378 CGGCTGGTGTGCCAGGGTGCTGG - Intergenic
1145077504 17:19867841-19867863 CGGTGCGGGTTCTAGGGCGGCGG - Exonic
1147015745 17:37490032-37490054 CGCTTCGGGTCCCTGGGCGCAGG + Intronic
1147324823 17:39665190-39665212 GGGTTGGGGTACCTGGACGCTGG - Exonic
1149981332 17:61313756-61313778 TGGTTTGGGTTCCAGGGCACAGG + Intronic
1151598471 17:75091842-75091864 GGGTTGGGGGGCCAGGGCGCAGG + Intronic
1157483932 18:48073719-48073741 GGGTTGGGGAGCCAGGGCGGAGG - Intronic
1157576291 18:48746110-48746132 CGGTTGGGCTTCCTGGGCTGTGG - Intronic
1158067197 18:53424952-53424974 TGGATGGGTTTCCAGGGCTCGGG - Intronic
1161142083 19:2653966-2653988 CGGTGGGGGGCCCAGGGTGCTGG - Intronic
1161282497 19:3453636-3453658 AGGCTGGGGGGCCAGGGCGCGGG - Intronic
1163241074 19:16064311-16064333 CATTTGGGGTTCCCGGACGCTGG - Intergenic
1163463884 19:17455225-17455247 GGGTGGGGGTGCCAGGGCGGAGG - Intronic
1163613897 19:18315216-18315238 CGTTTGAGGTTGCAGGTCGCTGG - Intronic
1166785522 19:45364572-45364594 GGGTTGGGGTGGCAGGGCCCTGG - Intronic
1168290411 19:55354615-55354637 CGGGTGGGGTTCAGGGGCGGGGG - Intronic
926239044 2:11070839-11070861 CTCTAGGGGTTCCAGGGGGCTGG - Intergenic
928421258 2:31138874-31138896 AGGCTGGGATTCCAGGGCGCCGG + Intronic
934776378 2:96940240-96940262 CGGTATGGGGTCCAGGGCCCAGG + Intronic
935746838 2:106196224-106196246 CGGTTGGTGTCCCAGGACACTGG + Intergenic
938273060 2:129992661-129992683 CGGGAGGAGTTCCAGGGCGATGG + Intergenic
938443164 2:131353445-131353467 CGGGAGGAGTTCCAGGGCGATGG - Intronic
944495901 2:200306952-200306974 CGGCTGGGGATGCAGGGCGCGGG + Intronic
948460184 2:238125363-238125385 CGGCTGGGGTTCCCTGGCCCTGG - Exonic
948841302 2:240650780-240650802 AGGTCTGGGTTCCAGGGCCCAGG - Intergenic
1170033429 20:11966189-11966211 AGGTAGGGGTTCCAGGGTGAGGG - Intergenic
1171010883 20:21508893-21508915 CGGGTGCGCTCCCAGGGCGCTGG + Intergenic
1172284569 20:33731884-33731906 AGGTTGGGTTTCCAGGGCTGGGG + Exonic
1180462019 22:15573469-15573491 CGGGAGGAGTTCCAGGGCGATGG - Intergenic
1180847296 22:18990890-18990912 CGGTTGGGGTCATAGGGCTCAGG - Intergenic
1185135638 22:49070518-49070540 CTGTTGGGGTATCAGGGGGCAGG - Intergenic
954291772 3:49653681-49653703 TGGCTGGGGTCCCAGGGCCCTGG - Exonic
961138580 3:124535926-124535948 TGGATGGTGTTCCAGGGAGCAGG + Intronic
961827245 3:129605600-129605622 CAGTTGGGCTTGCAGTGCGCGGG - Exonic
969378989 4:6782446-6782468 CGGGTGGGGGTCTAGGGCCCGGG - Intronic
969455885 4:7299333-7299355 CGGATTGGGATCCAGGGCCCTGG - Intronic
971195815 4:24471212-24471234 CGGTGGGCGGTCCAGGGCGCCGG - Intergenic
976367324 4:84245725-84245747 AGGATGGGGTTCCTGGGCTCTGG - Intergenic
976828415 4:89285200-89285222 CGGTTGGGGGGTCAGGGGGCGGG + Intronic
977070033 4:92374033-92374055 CGGTTGGGGTGGCAGGGCGGGGG - Intronic
986250074 5:6047435-6047457 CAGGTGGGGTTCCAAAGCGCTGG - Intergenic
991029029 5:62063352-62063374 TGGTTGGGCTTCCAGGAGGCTGG + Intergenic
997622030 5:135305303-135305325 TGGATGGGGTTCCAGAGGGCAGG + Intronic
999386456 5:151157391-151157413 TGGTTGAGGGTCCTGGGCGCCGG - Intronic
1003586003 6:7389815-7389837 CGGTTGGGGTGGCAGGGTGGTGG + Exonic
1004185032 6:13414370-13414392 TGGTTGGATTTGCAGGGCGCTGG - Intronic
1006343325 6:33459371-33459393 GCGTTGGGGGTCCATGGCGCAGG + Intergenic
1006509816 6:34515727-34515749 AAGTTGGGGTACCAGGGAGCAGG + Intronic
1010752582 6:79631531-79631553 AGGTTGGGGTCGCGGGGCGCGGG + Intronic
1015217896 6:130770928-130770950 CGGGTCTGGTTCCTGGGCGCCGG + Intergenic
1018176230 6:161181491-161181513 CGGTGGGGGTAGCAGGGGGCGGG + Intronic
1018959998 6:168441311-168441333 CGGCTGCAGTGCCAGGGCGCAGG + Exonic
1023865981 7:44238662-44238684 CGGCAGAGGTTCCAGGGTGCTGG - Intronic
1024331615 7:48160725-48160747 CATGTGGGGTTCCAGGGCCCAGG + Intergenic
1035630698 8:1104705-1104727 GGGTTGGGGTCCCGGGGCCCAGG + Intergenic
1037528388 8:19750053-19750075 CGGTTGGGGATCCAGGATGCAGG - Intronic
1040662756 8:49594848-49594870 CGGTTAGGGTCTCAGGGCTCAGG + Intergenic
1042483176 8:69325642-69325664 CAGCTGGAGTTCCAGGGAGCAGG + Intergenic
1042902843 8:73746392-73746414 AGGCTGGGGTTCTAGGGGGCCGG - Intronic
1045847792 8:106658050-106658072 CTGTTGGGGTTCGGGGGCGGCGG + Intronic
1046211422 8:111081410-111081432 GGGTTGGGGTTGCAGGGCTGGGG - Intergenic
1049460655 8:142726306-142726328 GGGCTGGGGTTCCAGGGTTCTGG - Intergenic
1052996097 9:34552289-34552311 AGGTGGGGGTGCCAGGGAGCTGG + Exonic
1060264142 9:122100608-122100630 GGGTGGGGCTTCCAGGGTGCTGG - Intergenic
1061723980 9:132571330-132571352 GGGTTGGGATTCCAGGGCAAAGG - Intronic
1061851358 9:133417902-133417924 CGCTTGTGCTGCCAGGGCGCCGG - Exonic
1187392304 X:18894183-18894205 AGGTGGGGGTGCCAGGGAGCTGG - Exonic
1188878905 X:35468240-35468262 GGGTTGCGGTTCCAGGCCCCAGG - Intergenic
1192363299 X:70452515-70452537 CGGCTGGGGTTCCGGGGGACAGG + Intronic
1196804959 X:119575164-119575186 CGCTTGGGGTTCTAGGGGGGCGG + Intronic