ID: 1100839094

View in Genome Browser
Species Human (GRCh38)
Location 12:98593911-98593933
Sequence AGGGCGCCGGTAACGTTAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 6}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100839091_1100839094 -9 Left 1100839091 12:98593897-98593919 CCGGTTGGGGTTCCAGGGCGCCG 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1100839094 12:98593911-98593933 AGGGCGCCGGTAACGTTAACCGG 0: 1
1: 0
2: 0
3: 0
4: 6
1100839089_1100839094 -7 Left 1100839089 12:98593895-98593917 CCCCGGTTGGGGTTCCAGGGCGC 0: 1
1: 0
2: 1
3: 8
4: 101
Right 1100839094 12:98593911-98593933 AGGGCGCCGGTAACGTTAACCGG 0: 1
1: 0
2: 0
3: 0
4: 6
1100839090_1100839094 -8 Left 1100839090 12:98593896-98593918 CCCGGTTGGGGTTCCAGGGCGCC 0: 1
1: 0
2: 1
3: 17
4: 271
Right 1100839094 12:98593911-98593933 AGGGCGCCGGTAACGTTAACCGG 0: 1
1: 0
2: 0
3: 0
4: 6
1100839078_1100839094 27 Left 1100839078 12:98593861-98593883 CCTCTTCAAGGGCGTGGAGACGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1100839094 12:98593911-98593933 AGGGCGCCGGTAACGTTAACCGG 0: 1
1: 0
2: 0
3: 0
4: 6

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100839094 Original CRISPR AGGGCGCCGGTAACGTTAAC CGG Intronic
918746795 1:188211714-188211736 AGGTCACTGGTAACCTTAACAGG - Intergenic
1073575446 10:104618930-104618952 AGGGAGCTGGTACCATTAACAGG - Intergenic
1081798870 11:45843305-45843327 AGGGCGCGGATAACTTAAACTGG + Intergenic
1100839094 12:98593911-98593933 AGGGCGCCGGTAACGTTAACCGG + Intronic
1152650026 17:81488413-81488435 CGGGCGCCGGAAACGGCAACAGG - Intergenic
950263662 3:11559804-11559826 AGGGCTCTGGGGACGTTAACGGG - Intronic
1034168832 7:149047003-149047025 AGGGCTCCAATAATGTTAACAGG + Intergenic