ID: 1100840452

View in Genome Browser
Species Human (GRCh38)
Location 12:98607480-98607502
Sequence AGGTGGGTCTACGGAGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100840446_1100840452 5 Left 1100840446 12:98607452-98607474 CCCACAGAGGAAGCAAGTTGGCA 0: 1
1: 0
2: 2
3: 8
4: 195
Right 1100840452 12:98607480-98607502 AGGTGGGTCTACGGAGAAACAGG 0: 1
1: 0
2: 2
3: 4
4: 102
1100840447_1100840452 4 Left 1100840447 12:98607453-98607475 CCACAGAGGAAGCAAGTTGGCAG 0: 1
1: 0
2: 2
3: 28
4: 265
Right 1100840452 12:98607480-98607502 AGGTGGGTCTACGGAGAAACAGG 0: 1
1: 0
2: 2
3: 4
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100840452 Original CRISPR AGGTGGGTCTACGGAGAAAC AGG Intergenic
904262731 1:29299328-29299350 AGGTGGGCCTATGGGCAAACTGG + Intronic
908617455 1:65938125-65938147 ATGTGGGGCTAAGGAGAAAAAGG - Intronic
911063062 1:93764345-93764367 GGTTGGGTCTATGGAGAAAGAGG - Intronic
916834882 1:168533266-168533288 AGGTGGGTATAAGAAAAAACTGG + Intergenic
919824644 1:201494604-201494626 AGGTGGGTCTACCTAGCGACAGG + Intronic
1064365558 10:14704464-14704486 AGGTGGGTCTACCCAGAGACAGG + Intronic
1066307925 10:34165129-34165151 ATTTGGGTCTCTGGAGAAACGGG + Intronic
1072790000 10:98311095-98311117 AGGTGGCTCCACGGGGGAACTGG + Intergenic
1074004873 10:109411313-109411335 AGGTGGGGCTAATGAGAAGCAGG - Intergenic
1074572091 10:114633300-114633322 TGGTGGGTCTGGGGAGAAGCGGG + Intronic
1075188669 10:120286207-120286229 AGGTAGGACTGCAGAGAAACTGG + Intergenic
1075338674 10:121627851-121627873 AGATGGGTCTTGGGAGAAAATGG - Intergenic
1076774547 10:132687521-132687543 AGGTGGGTCTAGGGTGCAGCAGG - Intronic
1081125705 11:39318582-39318604 AGGTGGGAATATGGAGAAAGAGG - Intergenic
1082076394 11:47979425-47979447 AGCTTGGCCTTCGGAGAAACAGG - Intergenic
1087149149 11:94842973-94842995 AGGTGGGTCTATTCACAAACAGG - Intronic
1088064928 11:105705760-105705782 TGGTGGGACTACGGGGAAACAGG + Intronic
1094504359 12:31048937-31048959 AGTTGTGGCTACGGAGAAAGAGG + Intergenic
1096672254 12:53207005-53207027 AGGTGGGGGTACTGTGAAACTGG + Intronic
1098049478 12:66438442-66438464 AGTTGGCTCTACTGAGGAACTGG - Intronic
1098906988 12:76172519-76172541 AGGGGGCTCTAGGGAGTAACTGG + Intergenic
1100840452 12:98607480-98607502 AGGTGGGTCTACGGAGAAACAGG + Intergenic
1102772123 12:115487063-115487085 CGGAGGTTCTAGGGAGAAACAGG - Intergenic
1104474946 12:129063592-129063614 TGGTGGGTCTGCAGAGAAGCTGG - Intergenic
1104705872 12:130947014-130947036 AGATAGGTCTAAGGAGAAATGGG - Intergenic
1104803108 12:131568314-131568336 AGGTGGGTGGATGGACAAACGGG - Intergenic
1113076145 13:106469737-106469759 AGCTGGGCCTTGGGAGAAACAGG + Intergenic
1113899629 13:113788944-113788966 ATGTGGGTCTAAGGAGCACCAGG - Intronic
1114994678 14:28333181-28333203 AGGTTGATCAACTGAGAAACTGG + Intergenic
1116479494 14:45381667-45381689 AGGTGGGACACTGGAGAAACAGG - Intergenic
1117896922 14:60496740-60496762 AGGTGGGTCATTGGAGAACCTGG + Intronic
1118081240 14:62363228-62363250 TGGTGAGGCTACGGAGAAAAGGG - Intergenic
1120754474 14:88229363-88229385 AAGTGGGTCTAAGGAGAACCAGG - Intronic
1120847376 14:89138448-89138470 AGGTGGGTAGGTGGAGAAACAGG + Intronic
1121431074 14:93888846-93888868 GGGTGGGTCTAGGGGGAAAATGG + Intergenic
1121550505 14:94796082-94796104 AAGTGGTTCTACTGAGGAACAGG + Intergenic
1124256391 15:28146177-28146199 GGTTGTGTCTACGGAGACACAGG + Intronic
1125964153 15:43859552-43859574 AGGTGGGTTTAAACAGAAACTGG - Intronic
1130758618 15:86793958-86793980 TGGTGAGGCTACAGAGAAACTGG + Intronic
1133722627 16:8509014-8509036 CGGTGGGGCTGCGGAGAAAAGGG + Intergenic
1135235276 16:20749518-20749540 AGGTGGTTCTAAGAAGAGACTGG + Intronic
1136269071 16:29137921-29137943 AGGTGGGTCTGCGGAGACGGGGG + Intergenic
1138096004 16:54212493-54212515 AGGTGGTTCTATTGAGCAACTGG + Intergenic
1140553296 16:75891390-75891412 TGGTGAGTCTGTGGAGAAACAGG - Intergenic
1141195269 16:81855942-81855964 AGGTGGGGCTAAGGAGACAGAGG - Intronic
1142072555 16:88099195-88099217 AGGTGGGTCTGCGGAGACGGGGG + Intronic
1143174094 17:4946873-4946895 AGGTGGGTCTTTGGAGAACACGG - Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1146489508 17:33270163-33270185 AGGTGGGTGGTCGGAGAAAAAGG - Intronic
1149393729 17:56218164-56218186 AGAAGGGGCTAAGGAGAAACAGG - Intronic
1151775654 17:76199763-76199785 AGGTGGATCTTCAGAGAGACGGG - Intronic
1151944023 17:77309559-77309581 ATGTGGATCTACAGAGAAGCTGG - Intronic
1156316224 18:35971592-35971614 TGGTGAGGATACGGAGAAACTGG + Intergenic
1157492242 18:48131894-48131916 TGGTGGGGATATGGAGAAACTGG + Intronic
1161786665 19:6330768-6330790 AGGTGGGACTACTGAGGACCGGG + Intronic
1163748835 19:19063687-19063709 GGGCGGGGCTACGAAGAAACTGG - Intergenic
1165790282 19:38487292-38487314 AGATGGGTCTACGAATAAAAGGG - Intronic
927403517 2:22741854-22741876 AGGTGGGTCTGTGGACACACTGG + Intergenic
928951324 2:36815691-36815713 AGGTGAGTCTTTGGAGAAGCTGG - Intergenic
931923755 2:67048484-67048506 AGGTGGCTCTACTGAGGAATGGG - Intergenic
936486833 2:112933056-112933078 AAGTGGGTCTTCGAAGAAACAGG - Intergenic
941143926 2:161819272-161819294 AGGTGAGTCTAAAGAGGAACTGG + Intronic
943624425 2:190182248-190182270 AGGTAGGACTAATGAGAAACAGG - Intronic
945133032 2:206595383-206595405 TGGTGGGTCCCTGGAGAAACAGG + Intronic
946507945 2:220321643-220321665 AGGTGGGACTACTAAGAATCAGG + Intergenic
948181541 2:235985085-235985107 TGGTGAGGCTACGGAGAAATAGG - Intronic
1172181740 20:33007906-33007928 AGGTGGGTCTGCTGAGACCCAGG - Intronic
1173761309 20:45562934-45562956 AGGTGGGTAGAGGGAGAAAGAGG + Intronic
1174377334 20:50134792-50134814 AGGTGTGTCTACGCATAAAAAGG - Intronic
1184809225 22:46817890-46817912 TGGTGAGGCTACGGAGAAATGGG - Intronic
1184925470 22:47633369-47633391 GAGTGGGTCTGCAGAGAAACCGG + Intergenic
952123123 3:30268078-30268100 AGGAGGGTCTATGGAGAATAAGG - Intergenic
952999544 3:38920123-38920145 AGGTGTGTCCAGAGAGAAACTGG + Intronic
953090230 3:39717453-39717475 TGGTGGGTTTAAAGAGAAACTGG + Intergenic
960331844 3:116369581-116369603 AGGAGGGTCAACGGAGAAACAGG + Intronic
963496950 3:146076566-146076588 GGGTGAGGCTACGGAGAAAAGGG - Intronic
964619548 3:158707358-158707380 TGATGGGTCTATGAAGAAACTGG + Intronic
968354390 3:198092845-198092867 TGGTGGGGCTGCGGAGAAAAGGG - Intergenic
969683832 4:8657810-8657832 CGGTGGGTAAATGGAGAAACTGG - Intergenic
970928176 4:21477450-21477472 AGGGTGTTCTACTGAGAAACTGG - Intronic
971609388 4:28702953-28702975 AGGTGAGTTTATGGAGTAACTGG - Intergenic
973801499 4:54483059-54483081 AGGTGGATCTTCTGAGAAAGGGG - Intergenic
978033032 4:103959165-103959187 TGGTGAGGCTATGGAGAAACAGG + Intergenic
979953575 4:126926191-126926213 TGGTGAGTCTGCAGAGAAACAGG + Intergenic
984982224 4:185293156-185293178 TGGTGAGGATACGGAGAAACTGG + Intronic
985237124 4:187887554-187887576 TGGTGGGGATACGGAGAAAGGGG - Intergenic
992269217 5:75049071-75049093 ATGTGGATTTACTGAGAAACAGG - Intergenic
993878015 5:93330603-93330625 TGGTGGGTGTACTGAAAAACTGG + Intergenic
998136642 5:139677574-139677596 AGGTGGGTACACGGAGGGACTGG - Intronic
1006276503 6:33008681-33008703 AGGTGGGTGTGAGGGGAAACAGG + Intronic
1007745014 6:44038364-44038386 AGGTGGGTCTGGGGAGAACTGGG + Intergenic
1009750627 6:67874767-67874789 AGGTGAGGCTGTGGAGAAACAGG + Intergenic
1012713191 6:102634472-102634494 AGATAGGCATACGGAGAAACAGG - Intergenic
1015313762 6:131793982-131794004 AAGTGGCTCTAGTGAGAAACTGG - Intergenic
1020277224 7:6632037-6632059 AGGTGGGTCTGTGCAGATACGGG + Intergenic
1022875800 7:34528119-34528141 TGGTGGGGCTACAGAGAAAAGGG - Intergenic
1022942796 7:35255829-35255851 AGGTGTGTCTGGGGAGAGACAGG - Intergenic
1023114904 7:36853208-36853230 AGGAGGGTCTAGGGAGGAGCTGG + Intergenic
1027131406 7:75593831-75593853 AGGTGGGTTTACGGAAGAAGTGG - Intronic
1035576385 8:709402-709424 TGGTGGGCACACGGAGAAACAGG - Intronic
1042682820 8:71405406-71405428 AGGTGGCTCAAAGGAGAAAGGGG - Intronic
1044187999 8:89279534-89279556 AGGCAGGCCTACTGAGAAACAGG - Intergenic
1047061704 8:121234534-121234556 AGGTGGGGATACATAGAAACAGG - Intergenic
1055312408 9:74996517-74996539 AGCTGTGTCTATGAAGAAACAGG + Exonic
1058180324 9:101790478-101790500 AGGTGGGTGTGCGGAGAAACTGG + Intergenic
1059360271 9:113736771-113736793 AGGAGGCTCAACGGAGAAAGTGG - Intergenic
1060455054 9:123784476-123784498 AGGTGTGTCCAAGGAGCAACCGG + Intronic
1060544250 9:124451062-124451084 AGGTGGTACTACTGAGAGACTGG + Intergenic
1188681600 X:33015023-33015045 TGGTGGGGCTGCGGAGAAAATGG + Intronic