ID: 1100849706

View in Genome Browser
Species Human (GRCh38)
Location 12:98696473-98696495
Sequence CTGTGGCAGTGTTGGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1043
Summary {0: 1, 1: 6, 2: 70, 3: 200, 4: 766}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100849706_1100849716 11 Left 1100849706 12:98696473-98696495 CCTACTTCCCAACACTGCCACAG 0: 1
1: 6
2: 70
3: 200
4: 766
Right 1100849716 12:98696507-98696529 TTTCAACACGAGTTTGGGTCAGG 0: 1
1: 0
2: 6
3: 145
4: 999
1100849706_1100849713 5 Left 1100849706 12:98696473-98696495 CCTACTTCCCAACACTGCCACAG 0: 1
1: 6
2: 70
3: 200
4: 766
Right 1100849713 12:98696501-98696523 ATCCAATTTCAACACGAGTTTGG 0: 1
1: 2
2: 10
3: 68
4: 249
1100849706_1100849714 6 Left 1100849706 12:98696473-98696495 CCTACTTCCCAACACTGCCACAG 0: 1
1: 6
2: 70
3: 200
4: 766
Right 1100849714 12:98696502-98696524 TCCAATTTCAACACGAGTTTGGG 0: 1
1: 11
2: 164
3: 958
4: 2647

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100849706 Original CRISPR CTGTGGCAGTGTTGGGAAGT AGG (reversed) Intronic
900024706 1:261000-261022 CTGTGTCAGTGTGGGGCGGTGGG + Intergenic
900028315 1:350405-350427 CTGTGTCAGTGTGGGGCGGTGGG + Intergenic
900107416 1:989789-989811 ATGTGGAAGTGTTGGGAGGTGGG - Intergenic
900304898 1:2000947-2000969 CTGTGACAGTGAAGGGAAGGGGG - Intronic
900729048 1:4239997-4240019 GTGTAGCAGTGTTGGGAGGTGGG + Intergenic
900807463 1:4776758-4776780 CTCAGGCACAGTTGGGAAGTGGG - Intronic
901834746 1:11916832-11916854 GTGTGGCAGTGTTGGGAGGTGGG - Intergenic
901910143 1:12450573-12450595 CTGTCGCAGTGCTGGGCACTAGG + Intronic
902279408 1:15363354-15363376 ATGTGGCAGTATTGAGAGGTGGG - Intronic
903344373 1:22675075-22675097 CTGTGGCAGCGGTGAGAAGATGG - Intergenic
903359456 1:22767673-22767695 CTGGGCCAGTGGTGGGAAGGAGG - Intronic
903555726 1:24191777-24191799 ATGCGACAGTGTTGGGAAGTAGG - Intergenic
903619376 1:24686764-24686786 CTGTGGCTGTGTTTTGATGTTGG - Intergenic
904283128 1:29435293-29435315 GTGTGGCAGTGTTGGGAGGTGGG + Intergenic
904378686 1:30097074-30097096 CTGTGGTGGTGTTGAGAAATTGG + Intergenic
904607439 1:31705407-31705429 CTGTGGCAGTGGTGGGGCCTGGG + Intergenic
904796638 1:33061189-33061211 GTGTGGCAGTATTGAGAGGTGGG + Intronic
904975556 1:34453475-34453497 ATGCAACAGTGTTGGGAAGTAGG - Intergenic
905203629 1:36330365-36330387 CTTTGGCAGGTTTGGGAAGGGGG - Intergenic
905737243 1:40338198-40338220 CTGTGGCTGTAGTGGAAAGTGGG - Intergenic
905854678 1:41301474-41301496 ATGTGATAGTGTTGGGAGGTGGG + Intergenic
906472861 1:46145672-46145694 ACGTGGCAGTGTTGGGAGGTAGG - Intronic
906617801 1:47246515-47246537 ATGTGGCAGTGTTGAGATGTGGG - Intergenic
906629899 1:47357873-47357895 ATGTGGCAGTGTTGGGACGTGGG - Intronic
906701386 1:47860671-47860693 GTGTGGCAGTATTGGGAGGTGGG + Intronic
907083333 1:51644965-51644987 CTGCAACAGTGTTGGGAAGTGGG + Intronic
907235937 1:53047733-53047755 CTGAGGCAGTGTGGGGAAATGGG - Intronic
907320500 1:53599226-53599248 ATGTGGCAGTGTTGAGAGGTGGG + Intronic
907615057 1:55915338-55915360 CTGTAACAGTGTTGAGAAGCAGG - Intergenic
907710947 1:56880904-56880926 ATGTGGCAGAGATGGGAAATGGG + Intronic
907816005 1:57918896-57918918 ATGTGGTGGTATTGGGAAGTGGG - Intronic
908499698 1:64730744-64730766 ATGTGGCAGTATTGGGAGGTGGG - Intergenic
909669534 1:78172554-78172576 ATGTGGCAGTGTTGGGAGGTGGG + Intergenic
909792393 1:79695424-79695446 ATGTGGCAGTAGTGAGAAGTGGG - Intergenic
910031106 1:82724812-82724834 CTGTGGCAGTGTAACAAAGTTGG + Intergenic
910051719 1:82982085-82982107 CTGTAGCACTGCTGGGAAATAGG + Intergenic
910723008 1:90308368-90308390 ATGTGGCAGTGTTGGGAGGTGGG + Intergenic
911389402 1:97220114-97220136 ATGTGGCAGTATTGAGAGGTGGG + Intronic
912025181 1:105161017-105161039 ATGTGGTAGTGTTGAGAGGTGGG - Intergenic
912107801 1:106303052-106303074 ATGTGGCAGTGTTGAGAGATGGG - Intergenic
912145948 1:106794619-106794641 CTGGGGCAGTGGGGGGAGGTGGG + Intergenic
912200500 1:107452490-107452512 CTGTGGTAGTATTGGGAAGTGGG + Intronic
912269813 1:108197843-108197865 ATGTGGCCGTGTTGGGAGGAGGG + Intronic
912395614 1:109340793-109340815 CTGTGGTAGTGTAGAGATGTCGG + Exonic
912478865 1:109962239-109962261 CTGTGGCAGTATTGAGAGGTAGG - Intergenic
912526016 1:110283255-110283277 ATGTGGCGGTGTTGGGAAGTGGG - Intergenic
913034769 1:114953150-114953172 TTGTGGCATTGTTAGGAAGTAGG - Intronic
913318898 1:117575245-117575267 CTGTGGGAGTCTAGGGAAGGGGG - Intergenic
913349314 1:117840790-117840812 CCTGGGCAGTGTTTGGAAGTGGG + Intergenic
914456731 1:147843463-147843485 ATGTCGCAGTGTTGGGAGGTGGG - Intergenic
914977521 1:152379866-152379888 CTGAAGCAGTATCGGGAAGTTGG + Intergenic
915644904 1:157263221-157263243 CTGTAACAGTGTTGAGAGGTGGG - Intergenic
916204837 1:162306467-162306489 TTGTGGGAGATTTGGGAAGTGGG - Intronic
916328010 1:163585015-163585037 GTGCAACAGTGTTGGGAAGTGGG - Intergenic
916379261 1:164190153-164190175 ATGTGGCAGTATTGAGAGGTGGG - Intergenic
916502177 1:165396534-165396556 CTGTGGCAAGGTGGGGCAGTGGG + Intergenic
916549570 1:165837130-165837152 ATGTGGCAGTGTTGGGAAGTGGG - Intronic
916692970 1:167208823-167208845 GTGTGTCTGTGTTGAGAAGTAGG - Intergenic
916801433 1:168220106-168220128 CTGTTTCAGTATTGGGAAGGGGG - Intergenic
917617778 1:176764183-176764205 ATGTGGCAGTATTGGTAGGTGGG - Intronic
917656555 1:177131999-177132021 ATGTGGCAATGTTGGGAGGTGGG - Intronic
917678740 1:177344731-177344753 ATGTGGCAGTGTTGGGAGGTGGG - Intergenic
918212436 1:182362999-182363021 CTGGGGGTGTGTTGGGAGGTGGG - Intergenic
918550848 1:185740544-185740566 ATGTGTCAGTGTTGGGAGGTAGG + Intronic
918667189 1:187166317-187166339 TTGTGGTGGTGTTGGGAAGTGGG + Intergenic
918681621 1:187362306-187362328 ATGTGACAGTGTTGAGAGGTGGG - Intergenic
919211552 1:194493319-194493341 CTGTTCAAGTGATGGGAAGTGGG - Intergenic
920554246 1:206892477-206892499 GTGTGGCAGTATTGAGAGGTGGG - Intergenic
920834002 1:209490971-209490993 CTGAGGCAGAGTGGGGCAGTGGG - Intergenic
921422893 1:214969088-214969110 GTGTGACGGTGTTGGGAGGTGGG + Intergenic
921423009 1:214970592-214970614 GTGTGACAGTGTTGGGAGGTGGG + Intergenic
921661646 1:217809719-217809741 GTGTGGCAGTTTTGGGAGGTGGG - Intronic
921700902 1:218267450-218267472 ATGTGGCAGTGTTGGGAGATGGG - Intergenic
921815388 1:219557464-219557486 ATGTGGCAGTATTGAGAGGTGGG - Intergenic
922348355 1:224715847-224715869 ATGTGGCGGTACTGGGAAGTGGG - Intronic
922601870 1:226862340-226862362 GTGTAGCGGTGTTGGGAGGTGGG - Intergenic
923065597 1:230514415-230514437 ATGTGGCAATGTTGGGAGGTGGG + Intergenic
923108441 1:230871885-230871907 GTGTGGCAGTATTGAGAGGTGGG + Intergenic
923220241 1:231886170-231886192 ATGTGGCAGTGTTAGGAGGTGGG - Intronic
923389886 1:233503732-233503754 CTCTGCCAGTGTTGGGAATATGG - Intergenic
923441488 1:234024774-234024796 ATGTGGCAGTATTGAGAGGTGGG - Intronic
923544214 1:234912557-234912579 GTGTGGCAGTGTTGAGAGGTGGG + Intergenic
924066743 1:240231117-240231139 GTGTGGCAGTATTGAGAAGAAGG - Intronic
924429024 1:243980575-243980597 ATGTGGCAGTATTGAGAGGTGGG + Intergenic
924516805 1:244773044-244773066 ATGTGGCAGTATTGAGAAGTGGG - Intergenic
924793785 1:247277467-247277489 ATGTGGCAGTGTTGAGAAATGGG - Intergenic
924814563 1:247430480-247430502 ATGTGGCTGTTTTGGGAAATGGG - Intronic
924956532 1:248933600-248933622 CTGTGTCAGTGTGGGGCGGTGGG - Intergenic
1062899497 10:1131764-1131786 CTGAAACAGTGTTTGGAAGTGGG + Exonic
1062953239 10:1521494-1521516 TTGAGGCAATGTTGGGAAGTCGG + Intronic
1063525115 10:6778043-6778065 AAGAGACAGTGTTGGGAAGTGGG - Intergenic
1063582920 10:7325275-7325297 GTGTGGCTGTGTTTGAAAGTGGG - Intronic
1064017645 10:11785027-11785049 ATGTGGCTGTGTTGGAAAGGGGG - Intergenic
1064125182 10:12653278-12653300 ATGTGGCAGTATTGTGAGGTGGG - Intronic
1064149427 10:12850176-12850198 CTGTGGCAGGGTTAGCAAGGTGG + Intergenic
1064920295 10:20509373-20509395 GTGTGGTGGTGTTGGGAGGTGGG + Intergenic
1065317660 10:24479971-24479993 ACGTGGCAGTGCTGGGAGGTGGG - Intronic
1065771673 10:29083960-29083982 GTGTGGCAGTATTGAGAGGTGGG + Intergenic
1065775474 10:29115699-29115721 ATGTGGCAGTGTTGGGAAGTGGG + Intergenic
1065884352 10:30063788-30063810 ATGTGGCAGTGTTGAGAGATGGG + Intronic
1066312741 10:34213408-34213430 ATGTGGTGGTGTTGGGAGGTGGG - Intronic
1066649933 10:37644775-37644797 ATGTGGCAGTATTGAGAGGTGGG + Intergenic
1067032827 10:42890314-42890336 ATGTGGCAGTATTGAGAGGTGGG + Intergenic
1067276641 10:44841098-44841120 ATGTGGCAGTATTGAGAGGTGGG + Intergenic
1067306278 10:45067104-45067126 ATGTAGCAGTATTGGGAGGTGGG - Intergenic
1067469422 10:46525101-46525123 CTGTGTCTGTGTTTGGATGTGGG - Intergenic
1067512622 10:46908476-46908498 CTGTGGCAGTGTTAGGAGGTGGG + Intergenic
1067649622 10:48143346-48143368 CTGTGGCAGTGTTAGGAGGTGGG - Intergenic
1068153691 10:53168539-53168561 ATGTGGAAGTGTTGGGAAGTGGG + Intergenic
1068429869 10:56917542-56917564 GTGTGGCAGTGTGGGGAGGTAGG - Intergenic
1068631544 10:59303660-59303682 GTGTGGCAGTGTTGGGAGGTGGG + Intronic
1069108612 10:64414561-64414583 ATGTGACAGGGTTGGGAGGTGGG - Intergenic
1069556942 10:69404798-69404820 ATGTGGCAGTGTTGGGAGGTAGG - Exonic
1069587211 10:69615784-69615806 GTGTGGCAGTATTGAGCAGTGGG - Intergenic
1069887479 10:71633193-71633215 CAGTGGCAGTATTGAGAGGTGGG - Intronic
1070171655 10:73937708-73937730 GTGTTGCAGTGTGGGGAGGTAGG + Intergenic
1070414021 10:76172206-76172228 ATGTGGCAGTGTTGAGAGATGGG - Intronic
1071162079 10:82759026-82759048 ATGGGGCAGTGTTGGGAGGTAGG + Intronic
1071230468 10:83580009-83580031 CTGTGCCACAGTTGGGAAGGGGG + Intergenic
1071264195 10:83949642-83949664 TTGTGCCAGTGTTGGGAGGTGGG + Intergenic
1071339891 10:84635894-84635916 ATGTGGCAGTGTTGAGTAGTGGG + Intergenic
1071436630 10:85653623-85653645 ATGTGGCAGTATTGAGAGGTGGG + Intronic
1071555957 10:86601741-86601763 GTGTGGCAGTATTGGGAGGTGGG - Intergenic
1071822730 10:89294564-89294586 ATGTGGCAGTGTTGGGAGGTGGG - Intronic
1071880280 10:89889678-89889700 ATGTGGCAGTGTGGGGAGGTGGG + Intergenic
1072025557 10:91452469-91452491 GTGTAGCAGTGTTGAGAGGTCGG + Intronic
1072056024 10:91756800-91756822 ATGTGGCAGTATTGAGAGGTAGG - Intergenic
1072995695 10:100241864-100241886 TTGTGACAGTTTTGGGAGGTGGG - Intronic
1073732805 10:106310642-106310664 GTATGGTAGTGTTGGGAGGTAGG + Intergenic
1073752483 10:106544489-106544511 CTGTGGCTGTCTGGGTAAGTAGG + Intergenic
1074524157 10:114250011-114250033 GGGTGGCAGTGTTGGGATGAGGG - Intronic
1075161157 10:120025701-120025723 ATGTGACAGTGTTGGAAGGTGGG - Intergenic
1075291020 10:121230983-121231005 ATGAGGCAGTGTTGGGAGGGAGG - Intergenic
1075360688 10:121830222-121830244 GTGTGGTAGTGTTGGGAGATGGG + Intronic
1076451001 10:130556906-130556928 ACGTGGCAGTGTTGAGAGGTGGG + Intergenic
1076502936 10:130951104-130951126 CTGTGGCTATGTTGAGAATTAGG + Intergenic
1076544253 10:131233796-131233818 GTGTGGCCATGTTGGGAGGTGGG + Intronic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1076709479 10:132324056-132324078 GTGTGGGTGTGTTGGGAGGTGGG - Intronic
1076803299 10:132842959-132842981 ATGTGGCAGTATTGAGAGGTGGG - Intronic
1077071429 11:675843-675865 CTCACGCAATGTTGGGAAGTCGG + Intronic
1077114568 11:877714-877736 CTGTGGCACTGTGGGGAGGCGGG + Intronic
1077268402 11:1663749-1663771 GTGTGGCAGCGTAGGGAGGTGGG + Intergenic
1077272477 11:1687869-1687891 GTGTGGCAGCGTAGGGAGGTGGG - Intergenic
1077515590 11:3000189-3000211 GTGTGGCAGTGTTGGGTTGTGGG - Intergenic
1077822868 11:5767344-5767366 CTGTAGTGGTATTGGGAAGTGGG - Intronic
1078470575 11:11582868-11582890 CTGTGGCTGTGGTGAGGAGTTGG - Intronic
1078847928 11:15138428-15138450 GTGGGGCAGTGTTGGGAGTTGGG - Intronic
1078907112 11:15697839-15697861 CTGTGGCAGTCTTGTCATGTTGG - Intergenic
1079211337 11:18463168-18463190 ATGTGGCAGTATTGAGAGGTGGG + Intronic
1079323320 11:19470631-19470653 ATGTAACAGTGTTGGGAAATGGG - Intronic
1079712591 11:23705119-23705141 GTGTGGCAATGTTGGGAGATGGG - Intergenic
1079996170 11:27297247-27297269 ATGTGGCAATATTGAGAAGTAGG - Intergenic
1080578615 11:33623123-33623145 CTGGGGCAGGTGTGGGAAGTGGG - Intronic
1081469378 11:43355772-43355794 ATGTGGCAGTGTTGGGAGATGGG + Intergenic
1081534602 11:43987742-43987764 TTCGGGCTGTGTTGGGAAGTCGG - Intergenic
1083235543 11:61348542-61348564 CTATGGTAGTGTTAGGACGTGGG + Exonic
1083829094 11:65219652-65219674 CTGAAGCAGAGTTGGGAGGTGGG + Intergenic
1084559816 11:69897442-69897464 GTGCAGCAGTATTGGGAAGTGGG - Intergenic
1084616919 11:70242610-70242632 ATGTGACAGTGTTGGGAGGTGGG - Intergenic
1084726006 11:70942515-70942537 ATGTGGGGGTGTTGGGAGGTGGG - Intronic
1085233622 11:74993937-74993959 ATATGGCAGTGTTGAGAGGTGGG - Intronic
1085413922 11:76307733-76307755 CTGTGTGTGTGTTGGGAGGTGGG - Intergenic
1085503304 11:77041269-77041291 CTGGGGTAGTGGTGGGAAGAAGG - Exonic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1085757862 11:79216523-79216545 ATGTGGTAGTGTTGGGAGGTAGG + Intronic
1085909960 11:80811494-80811516 GTGAGGCAGTGTTGGCAGGTGGG - Intergenic
1087402578 11:97685894-97685916 ATGTTGCAATGTTGGGATGTGGG + Intergenic
1087790673 11:102403680-102403702 ATGTGGCGGTCTTGGGAGGTGGG + Intronic
1088164261 11:106913556-106913578 GTGTGGCAGTGCTGGGAGATGGG - Intronic
1088177378 11:107069075-107069097 GTGTGGCAGTATTGAGAGGTTGG + Intergenic
1088553521 11:111038429-111038451 CTGTGGCAGTGATGATAAGAAGG - Intergenic
1088713144 11:112526038-112526060 CTGGTGCAGTGATGGGAGGTGGG + Intergenic
1088915621 11:114225660-114225682 ATGCAGCAGTGTTGGGAGGTGGG - Intronic
1088978295 11:114835365-114835387 GTGTGGTAGTATTGGGAGGTGGG - Intergenic
1089504884 11:118956438-118956460 CTCTGGCAGGGGTGGGAAGGGGG + Intronic
1089754513 11:120676724-120676746 ATGTGGCAGTGCTGGGAAGTGGG - Intronic
1089925726 11:122255527-122255549 GTGTGGCAGTGTTGAGAGGTCGG + Intergenic
1091129993 11:133138022-133138044 ATGTGGCAGTGTTGGAAAGTGGG + Intronic
1091289765 11:134431894-134431916 CTGTGGTGGTCTTGGGAGGTGGG + Intergenic
1091451398 12:574434-574456 CTGTAATAGTGTTGAGAAGTGGG + Intronic
1091529395 12:1339828-1339850 CTGTGGCAGTGTTGGCACAAGGG + Intronic
1091877333 12:3946729-3946751 GTGTGACAGTGTTGAGAGGTGGG + Intergenic
1092333636 12:7608512-7608534 CAGTGGCAGTGTTGGCATGGGGG - Intergenic
1092905064 12:13093556-13093578 CTGTGGCAGTGGATGGAAGCTGG - Intronic
1093177695 12:15931677-15931699 GTGTGGCAGTGTTGGGAGATGGG + Intronic
1094074014 12:26452545-26452567 GTGTGGTGGTGTTGGGAGGTAGG + Intronic
1094441712 12:30485427-30485449 CTGTGGCAGGGCTGGGAAAATGG - Intergenic
1094784314 12:33828510-33828532 ATGTGGCAATGTTGGAAGGTGGG + Intergenic
1094794434 12:33954469-33954491 TTGTGGTGGTGTTGGGAAGTGGG - Intergenic
1095106285 12:38237075-38237097 GTGTGGTGGTGTTGGGAAGTGGG - Intergenic
1095149287 12:38771957-38771979 GTGTGACAGTGCTGGGAGGTGGG + Intronic
1095529836 12:43173968-43173990 GTGCAACAGTGTTGGGAAGTGGG + Intergenic
1096059830 12:48687289-48687311 CTCCGAAAGTGTTGGGAAGTAGG + Intergenic
1096734337 12:53640833-53640855 ATGTGGCAGTATTGAGAGGTGGG + Intronic
1096905975 12:54935904-54935926 GTGTGGTAGTGTTGGGAGGTGGG - Intergenic
1097512777 12:60564890-60564912 CAGTGGCAGTGTTGGAACCTGGG + Intergenic
1097923794 12:65105782-65105804 GTGTGGCGGTGTTGGGAGGTGGG - Intronic
1097954222 12:65467039-65467061 CTGATGCAGTCTTTGGAAGTTGG + Intronic
1098115460 12:67171761-67171783 ATGCAGCAGTGTTGGGAGGTGGG + Intergenic
1098158966 12:67629554-67629576 TTGTGGCAGTAGTGAGAAGTAGG + Intergenic
1100708311 12:97226242-97226264 CTGTGGCAGTATTGAGATGTAGG - Intergenic
1100849706 12:98696473-98696495 CTGTGGCAGTGTTGGGAAGTAGG - Intronic
1100864561 12:98843178-98843200 ATGTGGCAGTGTTGGCAGATGGG + Intronic
1100872317 12:98923028-98923050 GTGTGGCAGTGTGGGGAGATAGG + Intronic
1100916689 12:99431878-99431900 ATGTGGCCGTGTTGGCAGGTGGG + Intronic
1101104822 12:101429369-101429391 GTGTGGCAGTATTGAGAAGTGGG + Intergenic
1101219642 12:102624867-102624889 ATGTAATAGTGTTGGGAAGTGGG - Intergenic
1101735110 12:107457612-107457634 CTGTCCCTGTGTTGGGAATTGGG - Intronic
1101778618 12:107816061-107816083 ATGTGACAATGTTGGGAGGTGGG + Intergenic
1101784513 12:107871450-107871472 GTGTGGCAGTATTGAGAGGTGGG - Intergenic
1101940258 12:109094607-109094629 GTGTGGCAGTATTGAGAGGTGGG + Intergenic
1102686666 12:114730206-114730228 CTCTGGCAGGGTTGGGGAGTGGG - Intergenic
1102804526 12:115767952-115767974 CTGTGGCAGAGTTGAGTAGTTGG + Intergenic
1103209758 12:119157638-119157660 CTGAGGCATATTTGGGAAGTGGG - Exonic
1103228455 12:119307878-119307900 ATGTGCCAGTGATGGGAAGCCGG + Intergenic
1103237966 12:119389743-119389765 TTGTGGAAGTGATGGGAGGTGGG - Intronic
1103705163 12:122867391-122867413 CTGGGGCAGGGTAGGGAAGGGGG + Exonic
1103776370 12:123369564-123369586 CTAAGACAGTGTTGGGAAGTTGG + Intergenic
1103857266 12:123981330-123981352 ATGTGACAGTGTTGAGAGGTGGG + Intronic
1104707618 12:130959154-130959176 GTGTGGCCGTGGTGGAAAGTAGG - Intronic
1105342356 13:19539163-19539185 ATGTGGCAGTATTGAGAGGTGGG - Intergenic
1105774040 13:23639752-23639774 CTGAGGCAGTGGTGGGAGGGAGG + Intronic
1106551866 13:30778971-30778993 ATGTGGCAATGTTGGGAAAGGGG + Intergenic
1106552108 13:30780974-30780996 CTGTGGCTGTGTTGGGAGTTGGG + Intergenic
1106830430 13:33575500-33575522 CTGTGGTGATGTTGGGAGGTGGG + Intergenic
1106872973 13:34041957-34041979 ATGTGGCAGTATTGAGAGGTGGG + Intergenic
1106950041 13:34873148-34873170 ATGTGGCAGTATTGGGAGGCGGG - Intergenic
1107260569 13:38485573-38485595 CTGAAACAGTGTTGGGAGGTGGG - Intergenic
1107421363 13:40249959-40249981 ATGTGGCAATGTTGGGAGGTGGG - Intergenic
1107522872 13:41200935-41200957 ATGTGGCAGTATTGAGAGGTGGG + Intergenic
1107610208 13:42105393-42105415 GTGTGGTGGTGTTGGGAGGTGGG - Intronic
1107739412 13:43433400-43433422 GTGTGACAGTGTTGGGAGGTGGG - Intronic
1107805098 13:44146285-44146307 GTGTGGTGGTGTTGGGAGGTGGG - Intronic
1107897204 13:44976989-44977011 GTGTGGCAGTGTTGAGAGGTGGG - Intronic
1107998661 13:45886905-45886927 ATGTGACAGTGTTGGGAAGTAGG - Intergenic
1108697760 13:52917758-52917780 ATGCAGCAGTGTTGGGAGGTAGG - Intergenic
1109732640 13:66436173-66436195 TTGTGGCACTGTTAGGAGGTGGG + Intronic
1110027536 13:70560228-70560250 ATGTGGTAGTGTTGGGAGGTAGG + Intergenic
1110125082 13:71932483-71932505 GTGTGGTGGTGTTGGGAGGTGGG + Intergenic
1110348774 13:74481331-74481353 ATGTGGCAGTGTTAGGACATGGG - Intergenic
1110354236 13:74548342-74548364 TTGTGGCAGTATTGAGAGGTAGG + Intergenic
1110354310 13:74549610-74549632 ATGTGGCAGTGTTGAGAGGTAGG + Intergenic
1110487285 13:76061370-76061392 ATGCAACAGTGTTGGGAAGTGGG + Intergenic
1110525114 13:76526888-76526910 ATGTGACAGTATTGAGAAGTAGG - Intergenic
1110759919 13:79220236-79220258 GTGTGGTGGTGTTGGGAGGTGGG - Intergenic
1110829449 13:80013340-80013362 ATGTGGCAGTGTTGGAAAGTGGG + Intergenic
1110941396 13:81354582-81354604 TTGTAGCGGTGTTGGGAGGTGGG + Intergenic
1110994164 13:82084298-82084320 ATGCAGCAGTGTTGGGAGGTGGG - Intergenic
1111415648 13:87940183-87940205 CTGTGGAGGTGTTGGGAGGGCGG + Intergenic
1111521419 13:89409820-89409842 TTGTGGCAGTATTTGGAGGTGGG + Intergenic
1111840597 13:93445341-93445363 CTATGACAGTATTAGGAAGTAGG - Intronic
1112353107 13:98653177-98653199 AAGTGGCAGAGCTGGGAAGTAGG + Intergenic
1112406035 13:99121044-99121066 ATTTGGCAGTGTTGTGAAGGTGG + Intergenic
1113071303 13:106423893-106423915 CTGTGGAAGGCCTGGGAAGTAGG + Intergenic
1114211792 14:20622172-20622194 ATGTGTCAGTGTTGGGAGATGGG - Intergenic
1114990717 14:28284985-28285007 ATGTGGCAGTGTTGGGAAGTAGG - Intergenic
1115074858 14:29376076-29376098 AAGTGGCAGTGTTGGGCAATGGG - Intergenic
1115151133 14:30286940-30286962 GTGTGTCAATGTTGGGAGGTGGG - Intergenic
1115369951 14:32602187-32602209 CTTTGGCTGTGTGTGGAAGTAGG + Intronic
1115695861 14:35898078-35898100 CTGTGGCAGTATGTGGAGGTAGG + Intronic
1115820745 14:37210262-37210284 ATGGGGCAGTCTTGGGGAGTGGG - Intronic
1116271749 14:42779376-42779398 TGGTGGCAATGTTGGGATGTGGG - Intergenic
1116416343 14:44682166-44682188 ATGCAGCAGTGTTGGGAGGTGGG - Intergenic
1116864894 14:50024071-50024093 CTGGGGCAGTGTGGGGTAGGAGG - Intergenic
1117067578 14:52025804-52025826 CTGTGGCAGTATTGAGAGGTAGG - Intronic
1117575779 14:57095750-57095772 CTGTGACAGTATTGGGAGGTGGG - Intergenic
1118838857 14:69496226-69496248 CTGTGCCAGGGCTGGGAAGTGGG - Intronic
1118889275 14:69894466-69894488 CTGTGGCAGCGGTGGGAGATAGG + Intronic
1119128137 14:72147560-72147582 ATGCAACAGTGTTGGGAAGTGGG - Intronic
1120073730 14:80132670-80132692 ATGTGGCAGTGTTGGAAGGTGGG + Intergenic
1120387469 14:83864371-83864393 CTGTTTCAGTATTGGCAAGTAGG + Intergenic
1120427866 14:84373493-84373515 TTGTGGCATTGTTGGGAAGTGGG - Intergenic
1120468374 14:84890795-84890817 CTGTGACGGTGTTTGGAGGTGGG - Intergenic
1120731095 14:88002373-88002395 GTGTGGCAGTAGTGGGAAGTGGG - Intergenic
1120736355 14:88057475-88057497 CTGTGGCTGTGGTGGGGGGTGGG + Intergenic
1121187725 14:91991092-91991114 ATGTGGCAGTATTGGGAGGTAGG + Intronic
1121649274 14:95545179-95545201 CGGTGGCAGAGGTGGGAAGAAGG + Intergenic
1122001714 14:98662726-98662748 ATGTGGAGGTGTTGGGAGGTGGG - Intergenic
1122438443 14:101714016-101714038 ATGTGGCAGTATTGGGAGGTGGG + Intergenic
1122526068 14:102385351-102385373 AAGTGGCAGTGCTGGGAGGTGGG - Intronic
1122815578 14:104310523-104310545 CCTTGGCAGTGCTGGGATGTAGG + Intergenic
1122984298 14:105205229-105205251 CTGTGGAAGGCTGGGGAAGTTGG + Intergenic
1123049163 14:105532323-105532345 CTGTGGCAGGGCTGGGAAGCAGG + Intergenic
1123433437 15:20237494-20237516 CGGTGGCAGTGGTGGGAGCTTGG - Intergenic
1123632051 15:22268301-22268323 GTGCAGCAGTGTTGGGATGTGGG + Intergenic
1123704665 15:22942528-22942550 CTGGAGCAGTGTGGGGCAGTGGG - Intronic
1124498316 15:30202248-30202270 ATTTGGTAGTATTGGGAAGTAGG + Intergenic
1124745267 15:32336426-32336448 ATTTGGTAGTATTGGGAAGTAGG - Intergenic
1124936716 15:34179414-34179436 ATGTGACAGTGTTGAGAGGTGGG - Intronic
1125275780 15:37989924-37989946 ACTTGGCAGTGTTGAGAAGTGGG - Intergenic
1125477458 15:40056721-40056743 TTGTGACAGTGTTGGGAACACGG + Intergenic
1125548616 15:40527552-40527574 GTGTGGCAGTATTGGGAAGTGGG + Intergenic
1126243972 15:46481790-46481812 CTGTGGCAGTGTTAGAAGGTGGG + Intergenic
1126568860 15:50128529-50128551 CTGTGACAGTAGAGGGAAGTGGG - Intronic
1126765219 15:52004806-52004828 ATGCAGCAGTGTTGGGAGGTGGG - Intronic
1126977971 15:54207214-54207236 ATGTGGCAGTGTTGGGAGGTGGG + Intronic
1127395316 15:58539912-58539934 CTGTGGGAGTGCTGGGATGAAGG - Intronic
1127417332 15:58770874-58770896 CTGAGGCATTGTTGGGTGGTTGG - Intergenic
1128364051 15:66984423-66984445 ATGTAGCAGTGTTGGGAGGTGGG - Intergenic
1128997448 15:72307251-72307273 CTGTTGAAGGGTGGGGAAGTGGG - Intronic
1129739254 15:77982039-77982061 CTGCGGCAGAGGTGAGAAGTGGG + Intergenic
1129846700 15:78771150-78771172 CTGCGGCAGAGGTGAGAAGTGGG - Exonic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130255199 15:82322741-82322763 CTGTGGCAGAGGTGAGAAGTGGG + Intergenic
1130362091 15:83198858-83198880 GTGTGGTGGTGTTGGGAGGTGGG - Intronic
1130599775 15:85267265-85267287 CTGTGGCAGAGGTGAGAAGTGGG - Intergenic
1130759651 15:86805390-86805412 AAGTGGCAGTGTTGGGCAGCGGG - Intronic
1130890005 15:88125684-88125706 CTGTGGCAGGGTGGGGTGGTGGG - Intronic
1130905814 15:88240337-88240359 CTGTGGCAGTGATGGGACACAGG + Intronic
1132477175 16:146056-146078 GTGTGGCAGCGTTGAGAGGTGGG + Intergenic
1132524981 16:409985-410007 CTGTGGCCTTGTTTGGAAATGGG - Intronic
1132860920 16:2071357-2071379 CTGTGTCTGTGTTGGGATGTGGG + Intronic
1133101423 16:3482396-3482418 CTCTGGCTGTCGTGGGAAGTCGG + Intronic
1133827366 16:9290390-9290412 ATGCTACAGTGTTGGGAAGTGGG - Intergenic
1134010735 16:10850539-10850561 ATGTGGCGTTGTTGGGAGGTGGG - Intergenic
1134017241 16:10897445-10897467 ATGTGGCAGTATTGAGAGGTGGG - Intronic
1134084785 16:11348904-11348926 CTGGGGCAGTGGTGGAAGGTAGG + Intronic
1134217978 16:12331058-12331080 CTGTGTCTGTGTTTGGAAGGGGG + Intronic
1134419196 16:14070808-14070830 CTGAGCCAGTGTTGGGATCTGGG - Intergenic
1135533570 16:23275312-23275334 CTGTGCCAGACTTGGGAAGATGG + Intergenic
1135673860 16:24397536-24397558 GTGTGGCAGCATTGGGATGTAGG - Intergenic
1135804194 16:25527273-25527295 CTGTGGCAGGATTGGGAGGTGGG - Intergenic
1136467835 16:30457369-30457391 CTGTGGCAGAGCTGGGGAGAAGG - Intergenic
1137399475 16:48141603-48141625 CTGTGGCAGAGATGGGTGGTAGG - Intronic
1137731279 16:50692607-50692629 ATGTGTGTGTGTTGGGAAGTGGG + Intergenic
1137731328 16:50692946-50692968 GTGTGTGAGTGTTGGGAAGCAGG + Intergenic
1138110090 16:54316801-54316823 CTGTGGAAGCGCTGGGAAGCAGG - Intergenic
1138266442 16:55663244-55663266 GTGTGGGAGTGTTGGGAGGAGGG + Intronic
1138346046 16:56320831-56320853 CTGGGACAGTGGTGGGAAGAGGG + Intronic
1138425350 16:56928476-56928498 ATGTGGCAGCATTGGGAAATAGG + Intergenic
1139475763 16:67201891-67201913 CTGAGGCAGGGGTGGGGAGTTGG - Intronic
1139682181 16:68573581-68573603 ATTTGACAGTGTTGGGGAGTGGG + Intronic
1139819295 16:69707767-69707789 CTGTGGCAGAATTGAGAGGTGGG - Intronic
1139924560 16:70479013-70479035 CTCAGGCAGTCCTGGGAAGTGGG + Intronic
1139939730 16:70596562-70596584 CTGAGGCAGTGGTGGGAAATGGG - Intronic
1140050919 16:71480286-71480308 CTGAGGCAGTGCTGGGATGAGGG - Intronic
1140541736 16:75762121-75762143 ATGTGGCAGTATTGAGAAGTGGG + Intergenic
1140568898 16:76078589-76078611 ATGTGGCAGTGTTGTGAAGTAGG - Intergenic
1141366680 16:83450061-83450083 CTGGGTCAGAGTTGGGATGTCGG - Intronic
1141469458 16:84228639-84228661 GTGTCCCAGGGTTGGGAAGTGGG - Intronic
1141721815 16:85760083-85760105 CGGGGGCTGTGTTGGGAGGTGGG + Intergenic
1141897387 16:86967060-86967082 CTGTGGCAGTGTGGAGAAGGGGG + Intergenic
1141956594 16:87376079-87376101 CTGTGGCAGTGGAGGGCAGGGGG - Intronic
1141970947 16:87482086-87482108 GTGCGGCAGTGTTGGGACATGGG - Intronic
1142026223 16:87815435-87815457 ATGTGGCCGTGTTTGGAAGCAGG + Intergenic
1142113360 16:88343799-88343821 TTGTGGCAGTCTTGAGAGGTGGG - Intergenic
1142281079 16:89147822-89147844 TTGGGGGACTGTTGGGAAGTAGG - Intronic
1143442794 17:6988549-6988571 GTGTAGCAGTATTGGGAGGTAGG + Intronic
1143716519 17:8775291-8775313 ATGTGGCAGTGTTGAGAGGTGGG + Intergenic
1145070566 17:19802106-19802128 TTGGGGAAGTGTTGGGAATTAGG - Intronic
1145272555 17:21412606-21412628 CTGAGGCTGTGCTGGGAAGGGGG - Intronic
1145793750 17:27643922-27643944 CTGTGGCAGTGGTTGGGTGTAGG - Intronic
1146730139 17:35186196-35186218 GTGTGGCAATGTTAGGAGGTGGG - Intronic
1146841905 17:36162106-36162128 CTGTGGCCATGTTGGGATCTGGG + Intergenic
1146854216 17:36250066-36250088 CTGTGGCCATGTTGGGATCTGGG + Intronic
1146870119 17:36373958-36373980 CTGTGGCCATGTTGGGATCTGGG + Intronic
1146877476 17:36425039-36425061 CTGTGGCCATGTTGGGATCTGGG + Intronic
1147073000 17:37974582-37974604 CTGTGGCCATGTTGGGATCTGGG + Intergenic
1147084522 17:38054120-38054142 CTGTGGCCATGTTGGGATCTGGG + Intronic
1147100469 17:38178086-38178108 CTGTGGCCATGTTGGGATCTGGG + Intergenic
1147160346 17:38566006-38566028 CTGTGGCAGTGTGGGGAACCAGG + Intronic
1147331636 17:39702781-39702803 CTGTGACAGTCCTGTGAAGTAGG + Intronic
1147512412 17:41082224-41082246 ATGCAGCAGTGTTGGGAGGTGGG + Intergenic
1147514580 17:41103401-41103423 ATGCCGCAGTGTTGGGAGGTTGG + Intronic
1148320716 17:46749859-46749881 CTGTGGCAATGTTGGGCACGTGG - Exonic
1148356897 17:46981298-46981320 ATGTGGAGGTGTTGGGAGGTGGG + Intronic
1148809255 17:50279821-50279843 CTCTGGCTGTGTGGGGAGGTGGG + Exonic
1149521051 17:57318543-57318565 CTGTGTCAGGGTTGGGGCGTTGG + Intronic
1149579881 17:57742236-57742258 ATGTAACAGTGTTGGGAGGTGGG - Intergenic
1150083410 17:62261132-62261154 CTGTGGCCATGTTGGGATCTGGG + Intergenic
1150495363 17:65603941-65603963 ATGCAGCAGTGTTGGGAGGTGGG - Intronic
1150622350 17:66817541-66817563 TTATGGCAGTGTTGGGAGGTGGG + Intergenic
1150837149 17:68574507-68574529 ATGTGGCAATGTTGAGAAGTGGG - Intronic
1150857442 17:68766652-68766674 ATGTGGTTGTGTTGGGAGGTGGG - Intergenic
1151413827 17:73948464-73948486 CTGGGGCAGTGGTGGGGTGTCGG + Intergenic
1152548031 17:81012742-81012764 CTGAGGCTGTATAGGGAAGTGGG - Intergenic
1152627110 17:81392962-81392984 CGGAGGCAGTGATGGGAACTCGG + Intergenic
1152823899 17:82451650-82451672 CTCAGGCAGTGATGGGAAGGGGG + Intergenic
1153181116 18:2434841-2434863 ATGGAGAAGTGTTGGGAAGTGGG + Intergenic
1153185101 18:2477683-2477705 ATGTGGCAGTATTGAGAGGTGGG - Intergenic
1153753835 18:8260595-8260617 GTGTGGCAGTGTTGGGAGATGGG - Intronic
1153969095 18:10208486-10208508 ATATGGCAGTGTTGGGAGGTGGG - Intergenic
1154064949 18:11098582-11098604 GTGCAGCAGTGTTGGGAGGTGGG + Intronic
1154295772 18:13145973-13145995 ATGTGGCAGTGTTGAGAGGTGGG - Intergenic
1154295877 18:13147263-13147285 ATGTGGCAGTGTTGAGAGGCGGG + Intergenic
1154498587 18:14980900-14980922 GTGTGGCAGCATTGGGAGGTGGG + Intergenic
1154987185 18:21563807-21563829 ATGTGACAGTGTTTGGAGGTGGG + Intronic
1155420067 18:25646262-25646284 GTGTGGTGGTGTTGGGAGGTGGG + Intergenic
1155553037 18:26987070-26987092 ATGGGGCAGTGTTGGGAGATGGG + Intronic
1155735186 18:29212988-29213010 ATGTGGCAGTGTTGGGAGGTGGG - Intergenic
1155848717 18:30743502-30743524 ACGTGGCAGTGTAGGGATGTAGG - Intergenic
1155853073 18:30796739-30796761 CTGTGGCAGTGTGGAGGGGTGGG - Intergenic
1156195269 18:34767777-34767799 GTGAGGCAGTGTTGAGAGGTGGG - Intronic
1156485146 18:37460814-37460836 CTCTGGCAGTCTTGGAAACTTGG + Intronic
1156524925 18:37758001-37758023 GTGTGGCAGTGTAGGGAGGCAGG + Intergenic
1156546540 18:37969247-37969269 CAGTGGCAGGGCTGGGAGGTTGG + Intergenic
1156622003 18:38864039-38864061 CTGAGGCTGTGCTGGGAAGCAGG - Intergenic
1156646626 18:39170337-39170359 GTATGGCAGTGTTGGGTGGTGGG + Intergenic
1156654883 18:39273165-39273187 TCGTGGCAGTGGTGGGAGGTAGG + Intergenic
1157636583 18:49162565-49162587 GTGTGGCAGTATTGAGAAGTGGG - Intronic
1157771887 18:50356209-50356231 ATGTGGTAGTGTTGGGAGGTGGG + Intergenic
1157795909 18:50575048-50575070 ATGCAACAGTGTTGGGAAGTGGG + Intronic
1157874777 18:51261928-51261950 CTGTGGTAGTGTTGGAGAGTAGG + Intergenic
1158613384 18:58963394-58963416 CAGTGGCAGTGAAGGAAAGTGGG + Intronic
1158897033 18:61923756-61923778 GTGTGGCAGTGTTGAGGGGTGGG - Intergenic
1158902894 18:61982860-61982882 GTGTGTCAGTGTTGGGAGGTGGG - Intergenic
1159454574 18:68644539-68644561 CTGCAACAGTGTTGGGAGGTGGG + Intergenic
1159743439 18:72201756-72201778 CATTGGCAGTCTTGAGAAGTTGG - Intergenic
1160654278 19:254188-254210 CTGTGGCAGTGTGGGGCGGTGGG + Intergenic
1161948970 19:7456793-7456815 CTGTGACCTTGTTGGGAGGTTGG + Intronic
1162147893 19:8624471-8624493 GTGCAACAGTGTTGGGAAGTGGG + Intergenic
1162195719 19:8983037-8983059 GTGTGGCAGTATTGAGAGGTGGG + Intergenic
1162244563 19:9389092-9389114 ATGTGGCAGTATTCAGAAGTGGG - Intergenic
1163101304 19:15098711-15098733 CTGTGGCAGTCATGGTGAGTTGG - Intergenic
1163439578 19:17314859-17314881 GGGTGGCAGTGATGGGAAGGGGG + Intronic
1163577332 19:18118358-18118380 CTGTGGCAGCAGTGGGAAGGGGG + Intronic
1163887099 19:19975598-19975620 ATGTGGCAGTGTTGGGAGGGGGG + Intergenic
1164598283 19:29544668-29544690 TACTGGCAGTGTTGGGAAGCTGG + Intronic
1164756244 19:30691892-30691914 CTGTGGCAGTGGTGGGCACCCGG + Intronic
1164807876 19:31130804-31130826 ATGTGATAGTGTTGAGAAGTGGG - Intergenic
1165442652 19:35839237-35839259 CTGGGGTAGTGATGGGAAGCTGG + Exonic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
1167041478 19:47025248-47025270 CTGTGGCAGTTGAGGGAAGGAGG + Intronic
1167148133 19:47694674-47694696 CTGGGGCAGCGCTGGGAAGGGGG - Exonic
1168311515 19:55463314-55463336 CTGAGGCAGTGGTCTGAAGTGGG + Intergenic
1168431041 19:56280830-56280852 ATGCAGCAGTGTTGGGAGGTGGG - Intronic
1168727478 19:58595191-58595213 CTGTGTCAGTGTGGGGCGGTGGG - Intergenic
924963619 2:56925-56947 CAGGGGCTGTGGTGGGAAGTGGG + Intergenic
925166405 2:1718632-1718654 CTGTGGCAGGTTTGGGTGGTAGG - Intronic
925387443 2:3472040-3472062 CTGCAGGAGTGGTGGGAAGTTGG + Intronic
925507129 2:4579705-4579727 GTGTGGCAGTGTTGGGGAAGTGG - Intergenic
926589632 2:14726602-14726624 ATGTGGCAGTATTGGGAGGTAGG - Intergenic
926942148 2:18149840-18149862 AGGTGGCAGTATTGAGAAGTGGG - Intronic
927356747 2:22182187-22182209 GTGGGGCAGTGTTGAGAAATGGG - Intergenic
927410893 2:22825206-22825228 GTGTGGCAGTGTTGAGAAGTGGG + Intergenic
927523742 2:23719222-23719244 CTGTTACAGTCTTGGGAAGAAGG - Intergenic
927611250 2:24543409-24543431 AGGTGGCAGTGTTGGGAGGCAGG - Intronic
927878880 2:26676487-26676509 GTGTGGCAGTATTGAGAAGTGGG + Intergenic
928288211 2:30011965-30011987 GTGTGGCAGTGTTGGGAGGTGGG + Intergenic
928653775 2:33428202-33428224 TTGTTGCAGATTTGGGAAGTGGG - Intergenic
928825928 2:35420909-35420931 ATGTGGCAGTGTTTGGAGGTAGG - Intergenic
928946890 2:36779622-36779644 CTGTTGGAGGGTTGGGAGGTGGG - Intronic
929693398 2:44093293-44093315 ATGGGGAAGTGTTGGGATGTGGG + Intergenic
929732390 2:44509654-44509676 GTATGGCAGTGTTGGGAGGTGGG + Intronic
929875374 2:45792339-45792361 GTGTGGTGGTGTTGGGAGGTGGG - Intronic
930256745 2:49102000-49102022 ATGTGGTAGTATTGAGAAGTAGG - Intronic
930674698 2:54187828-54187850 TAGTGCCAGTGTTGGGAGGTGGG + Intronic
931409942 2:62019552-62019574 GTGCAGCAGTGTTGGGAGGTAGG - Intronic
931580113 2:63762813-63762835 ATGTGGCAGTATTGAGAGGTGGG - Intronic
931909126 2:66875839-66875861 CTCTGGCAGTGTTTGCAAGGTGG - Intergenic
932559780 2:72856975-72856997 ATGTGGCAGTGTTGGGAGGTGGG - Intergenic
932654132 2:73593745-73593767 CTGTGGCAGAGGTGGGAGGCTGG - Intronic
932802701 2:74755957-74755979 ATGTAACAGTGTTGGGAGGTAGG - Intergenic
933063052 2:77761984-77762006 ATGTGGCAGTGTTGAGAGGTGGG + Intergenic
933775573 2:85769408-85769430 GTGTGCCAGTGCTGGGAAGGCGG + Intronic
934673086 2:96229115-96229137 ATGTGGCAGTGTTGAGAGGTGGG - Intergenic
935026937 2:99285955-99285977 ATGTGGCAGTATTGAGAGGTGGG + Intronic
935422451 2:102883885-102883907 CTGAGTCAGTTTTGGGGAGTTGG + Intergenic
935643196 2:105309817-105309839 GAGTGGTAGTGTTGGGAGGTGGG + Intronic
935903535 2:107818165-107818187 ATGTGGCAGTGTTGGGAAGTGGG + Intergenic
936571074 2:113616003-113616025 CTGTGTCAGTGTGGGGCGGTGGG + Intergenic
936610125 2:113994194-113994216 GTGTGGCAGTGTTGAGAGGTGGG - Intergenic
936697353 2:114966268-114966290 ATGTGGCAGTCTTGGGAGGTGGG + Intronic
937047956 2:118862396-118862418 CAGTGGCAGTGTTGGGTTTTTGG + Intergenic
937675904 2:124589924-124589946 ATGCAGCAGTGTTGGGAGGTGGG + Intronic
937858416 2:126689483-126689505 AGGTGGCAGTGATGGGAGGTGGG + Intronic
937858920 2:126693094-126693116 AGGTGGCAGTGATGGGAGGTGGG + Intronic
938190944 2:129280118-129280140 ATGTAGCACTGTTGGGAGGTGGG - Intergenic
938851742 2:135267505-135267527 CTGTGGCAGTATTGAGAGGTGGG - Intronic
939175853 2:138746556-138746578 TTGTGGCAGTTTTGGGAAGCTGG - Intronic
939417952 2:141924844-141924866 CTATGGCAGTGGGTGGAAGTGGG + Intronic
940123206 2:150291952-150291974 ATGCAACAGTGTTGGGAAGTGGG - Intergenic
940823195 2:158380939-158380961 CTATGTGACTGTTGGGAAGTAGG - Intronic
940866282 2:158820686-158820708 ATGTGGCAGAGTTGAGAGGTGGG + Intronic
941380339 2:164784917-164784939 ATGTGACCGTGTTGGGAGGTGGG + Intronic
941590746 2:167417165-167417187 ATGTGGCAGTATTGAGAGGTGGG + Intergenic
941635069 2:167927374-167927396 ATGTGGCAGTATTGAGAGGTGGG - Intergenic
941644386 2:168024413-168024435 ATGTGACTGTGTTGGGAGGTAGG + Intronic
942180907 2:173379669-173379691 ATGTGGCAGTGTTGAGAGTTGGG - Intergenic
942259985 2:174150119-174150141 ATGCAGCAGTGTTGAGAAGTGGG + Intronic
942657466 2:178229217-178229239 TTGTGGCAGTATTGGGAGGTGGG - Intronic
942817373 2:180067630-180067652 ATGTGGCAGTTTCGGGACGTGGG - Intergenic
943322698 2:186465296-186465318 ATGTGGCAGTGTTGAGAGGTGGG + Intergenic
943678474 2:190742119-190742141 TTGTGACAGTATCGGGAAGTGGG + Intergenic
944326739 2:198414662-198414684 GTGTGGCAGTATTGAGAGGTGGG + Intronic
944539610 2:200743167-200743189 CTGTGGCTGAGTTGGGAAAGCGG - Intergenic
944693281 2:202177763-202177785 ATGCAGCAGTGTTGGGAGGTGGG - Intronic
944918684 2:204388061-204388083 ATGTGGCAGTATTGAGAGGTAGG + Intergenic
944977019 2:205065546-205065568 GTGTAGCCGTGTTGGGAAGTGGG + Intronic
945183486 2:207115716-207115738 ATGGGGGAGTGTTGGGAACTGGG - Intronic
945762169 2:213927215-213927237 ATGTGGCAGTATTCGGAGGTAGG - Intronic
945899710 2:215524148-215524170 GTGTGGCAGTGTTGGGACATGGG + Intergenic
946308547 2:218870286-218870308 CTGAAGCATTGTTGGAAAGTAGG - Intronic
946612408 2:221473392-221473414 CTGTGGCATTTTTGTGATGTGGG - Intronic
946875159 2:224122038-224122060 AGGTGGCAGTGTTGGGAGGTGGG - Intergenic
947016789 2:225629856-225629878 ATGCAGCAGTGTTGGGAGGTGGG - Intronic
947052324 2:226059333-226059355 ATGTGGCAGGATTGAGAAGTGGG - Intergenic
947105396 2:226663223-226663245 ATGCGGCAGTGTTGAGAGGTGGG - Intergenic
947449899 2:230198200-230198222 CTGTGGAAGTGTGTGGAAGAGGG - Intronic
947691571 2:232141692-232141714 CTGTGGTAGAGATGGGAAGTAGG + Intronic
947709818 2:232306560-232306582 CTGTGTTTGTGTTGGGAAGGAGG + Intronic
948320956 2:237068971-237068993 ATATGGCAGTATTGAGAAGTGGG + Intergenic
948469539 2:238168154-238168176 CTGTGGCAGTGATGGGGCCTGGG + Intronic
1168854746 20:1000881-1000903 CTGTGGGAGAATTGGGAGGTGGG - Intronic
1169087440 20:2836130-2836152 CTGGGGCAGGGGTGGGAAGAGGG + Exonic
1169148532 20:3270728-3270750 AGGTGGCAGTGCCGGGAAGTGGG - Intronic
1169288714 20:4330909-4330931 ATGTGGCAGTATTGGGAAGTAGG - Intergenic
1169296700 20:4406216-4406238 GTGTGACAGTGTTTGGAGGTGGG - Intergenic
1169395042 20:5221625-5221647 ATGTGGCAGTATTGAGAGGTGGG + Intergenic
1169744883 20:8933581-8933603 GTGTCACAGTGTTGGCAAGTGGG - Intronic
1170309173 20:14974238-14974260 CAGTGGCAGTATTGAGAGGTGGG - Intronic
1170481498 20:16769495-16769517 ATGTGGCAGTGTTGGAAGGTGGG - Intronic
1170557061 20:17523352-17523374 ATGTGGAAGTGTTGGGGAGAGGG + Intronic
1170709654 20:18778872-18778894 CTGTCACAGTGGAGGGAAGTAGG + Intergenic
1170836536 20:19889338-19889360 CAGTGGCAGAGGTGGGAGGTGGG + Intronic
1170883009 20:20314057-20314079 ATGTGGCAGTGTTGGGAGGTGGG - Intronic
1171020665 20:21581684-21581706 GTGTGTCAATGCTGGGAAGTGGG - Intergenic
1171198637 20:23223612-23223634 GTGTGACAGTGTTGGGAGGTGGG - Intergenic
1171210105 20:23310374-23310396 CTGTTGCAGGGTGAGGAAGTGGG - Intergenic
1171324653 20:24280815-24280837 CTGAGGCAGTGTTGTAAAATCGG - Intergenic
1171348506 20:24484865-24484887 ATGTGGCAGTGTTTGGAGGTGGG + Intronic
1172634853 20:36403363-36403385 TTGTGACAGTCTTGGGAGGTGGG - Intronic
1172804446 20:37601366-37601388 ATGTGGCAGTATTGAGAGGTGGG + Intergenic
1172952274 20:38729765-38729787 CTGGGGCAGTGTTGGAAACCTGG + Intergenic
1173058610 20:39640174-39640196 CAGGCACAGTGTTGGGAAGTGGG - Intergenic
1173366393 20:42389470-42389492 TTGCAGCAGTGTTGGGAGGTGGG + Intronic
1173584209 20:44169750-44169772 ATGTGGCAGTATTGAGAGGTGGG + Intronic
1173752265 20:45486788-45486810 CTGAGGCAGGGTGGGGAAGCGGG + Intergenic
1174285369 20:49468963-49468985 CTATGGAAGTTTTGGGAAGGGGG + Intronic
1174457571 20:50660588-50660610 CTGTGGCAGTGTTGGGAGGCGGG - Intronic
1175136686 20:56829473-56829495 CGGTGGCAGGGTTAGCAAGTGGG - Intergenic
1175297983 20:57922442-57922464 GTGTGCCACTGTTGGGGAGTGGG + Intergenic
1176251178 20:64120797-64120819 ATGTGGCAGTATTGAGAGGTGGG + Intergenic
1177529465 21:22340962-22340984 CTGAGGCTGTGTAGGGCAGTGGG + Intergenic
1177652673 21:23978908-23978930 TTGCGGCAGTGTTGAGAGGTGGG + Intergenic
1178563822 21:33664512-33664534 CTGTGGCAGTGTAGGGAGGTGGG - Intronic
1178786285 21:35656703-35656725 ATGTGGCAGTGTTGGGAGGTGGG + Intronic
1179345928 21:40557182-40557204 GTGTGGCAGTGTTGGGAGGTGGG + Intronic
1179947529 21:44688358-44688380 CTGTGGTGGTCTTGGGAAGGTGG - Intronic
1180213248 21:46308644-46308666 ATGTGGCAGTATTGAGAGGTGGG + Intronic
1180213257 21:46308701-46308723 ATGTGGCAGTATTGAGAGGTGGG + Intronic
1180259168 21:46656018-46656040 GTGTGGTGGTGTTGGGAGGTGGG + Intronic
1180262919 21:46686993-46687015 CTGTGTCAGTGTGGGGCGGTGGG - Intergenic
1180319955 22:11310800-11310822 ATGTGACAGTGTTGAGAGGTGGG - Intergenic
1181051320 22:20239518-20239540 CAGTGGCAGGGGTGGGGAGTTGG - Intergenic
1181443668 22:22952064-22952086 TTGTGGCAACGTTGGGAGGTGGG + Intergenic
1181719484 22:24762909-24762931 ATGTGGCAGCATTGGGAAGTGGG - Intronic
1182759295 22:32708986-32709008 GCGGGGCAGTGATGGGAAGTGGG + Intronic
1182909371 22:33968601-33968623 CTGTCGCAGTGCTGGGAATCAGG - Intergenic
1182939173 22:34258060-34258082 ATGTGCCAGTGTTGAGAGGTAGG + Intergenic
1182989693 22:34755188-34755210 ATGTGGCAGTATTGAGAAGTGGG - Intergenic
1183222213 22:36522715-36522737 CTGCGGCAGTGTCGGGAGGTAGG + Intronic
1183505945 22:38208938-38208960 AGGTGGCAGTGGTGGGAAATGGG + Intronic
1183669407 22:39263609-39263631 GTGTGGCAATGTTGAGAGGTGGG - Intergenic
1183765180 22:39866692-39866714 CTGTGACAGTGTTTGAAAGCAGG - Intronic
1183968347 22:41457206-41457228 ATGTGGCAGTATTCAGAAGTGGG - Intergenic
1184118730 22:42437054-42437076 GTGTGGCGGGGTTGGGGAGTTGG - Intergenic
1184281186 22:43438388-43438410 CACTAGGAGTGTTGGGAAGTGGG + Intronic
1184537476 22:45097089-45097111 GTGCAGCAGTGTTGGGAGGTGGG + Intergenic
1184771611 22:46600220-46600242 CTGTTCCAGTGGTGGGATGTGGG + Intronic
1184812507 22:46845976-46845998 CTGTGGGAGGGCTGGGATGTTGG + Intronic
1185048601 22:48541606-48541628 CTGTGTCGGTGTTGGGAGGGTGG + Intronic
949255820 3:2044615-2044637 ATGTGGCAGTATTTGGAGGTGGG + Intergenic
949486046 3:4539633-4539655 ATGTGGCAGTGTTGAGAAGTGGG + Intronic
949738325 3:7200238-7200260 ATGTGGCAGTGTTAGGAGGTAGG - Intronic
949950421 3:9224530-9224552 TTGTGGCAATTTTGGGAAGGCGG - Intronic
950851583 3:16067271-16067293 GTGTGACAGTGTTGGGAGGTGGG + Intergenic
950855082 3:16097212-16097234 CTGTGGTACTGCTGGGAGGTGGG + Intergenic
951327707 3:21324992-21325014 CTGTGGCAGTGTCAGGAGTTGGG - Intergenic
951480295 3:23154184-23154206 ATGCAGCAGTTTTGGGAAGTGGG - Intergenic
952254814 3:31685906-31685928 ATGTGGCAGTGTTAGGAAGTGGG + Intronic
952306628 3:32152659-32152681 CTGTGGCAGTGTTGGGAGGTGGG - Intronic
952494533 3:33904276-33904298 GTGTGGTAGTGTTGGGAGATGGG + Intergenic
952935135 3:38391656-38391678 ATGTGACAGTGTTGGGAGATGGG + Intronic
953467095 3:43131615-43131637 CTATGGCAGTATTGGTGAGTGGG - Intergenic
953744425 3:45563146-45563168 CAATGGCAGTATTGAGAAGTGGG + Intronic
953948816 3:47172015-47172037 CTGTAGCAGTATTGGCAAATGGG + Intergenic
954722193 3:52574359-52574381 GTGCAACAGTGTTGGGAAGTGGG - Intronic
954830603 3:53418116-53418138 CAGTGGAAGTGATGGTAAGTGGG + Intergenic
955074696 3:55602584-55602606 CTGTGGCAGTGTTGCTCAGGAGG + Intronic
955373356 3:58372967-58372989 CTGTTGAAATGTTGGGAACTGGG + Intronic
955498929 3:59564786-59564808 ATGTGGCAGTGTTGGCAGGTGGG - Intergenic
955880148 3:63534939-63534961 ATGTGGCAATGTTGGGAGGTGGG - Intronic
956158374 3:66322032-66322054 ATGTGGCAGTGTTGAGAGGCAGG - Intronic
956287033 3:67621525-67621547 ATGTGGCAGTATTGAGAGGTGGG + Intronic
956544782 3:70388877-70388899 ATGTGGCAGTGTTGGGAGGTTGG + Intergenic
957079958 3:75628903-75628925 CTGTGTCAGTGTGGGGTGGTGGG + Intergenic
957300145 3:78381377-78381399 GTGTGGCAGTGTTGGGAGGTGGG - Intergenic
957898818 3:86461301-86461323 CTGTGGTGGTGTTTGGAGGTAGG - Intergenic
958017039 3:87950227-87950249 GTTTGGCAGTATTGGGAGGTGGG - Intergenic
958270300 3:91491275-91491297 ATGTGGCAGTATTGAGAGGTGGG + Intergenic
958683521 3:97361792-97361814 AAGTGGCAGTATTGAGAAGTAGG - Intronic
958781087 3:98543304-98543326 CTGTGACAGTGTTGAGAGGTGGG + Intronic
958863687 3:99474751-99474773 ATGTGGCAGTATTGGGAGATGGG + Intergenic
959194555 3:103163023-103163045 ATGTGATAATGTTGGGAAGTGGG - Intergenic
959328911 3:104976903-104976925 TTGAGGAAGTGTTGGGAAGTGGG + Intergenic
959554818 3:107704724-107704746 GAGTAACAGTGTTGGGAAGTAGG - Intronic
959795421 3:110422186-110422208 CAGTGGAAGTTTTGGGAGGTGGG + Intergenic
960231969 3:115238889-115238911 ATGCAACAGTGTTGGGAAGTTGG - Intergenic
961064024 3:123858756-123858778 GTGTGTCAGTGTTGAGAGGTGGG - Intronic
961313600 3:126019342-126019364 ATGTGGCAGTATTGAAAAGTGGG - Intronic
961331109 3:126139005-126139027 TTGTGGCAGAGGTGGGAGGTGGG - Intronic
961398989 3:126620953-126620975 CTGTGGCCGTGTGGTGGAGTTGG - Intronic
961582804 3:127896643-127896665 GTGTGGCAGTGTTGGGAGGTGGG - Intergenic
961587300 3:127943083-127943105 ATGTGGCAGTGTTGGAAGGTGGG - Intronic
961622007 3:128231652-128231674 CTGGGGCAGGGTTGGGAATCAGG - Intronic
962020568 3:131496894-131496916 CTGGGCCAGTGTTGGGAGGGTGG - Intronic
962177488 3:133169187-133169209 ATGTAACAGTGTTGAGAAGTGGG - Intronic
962288985 3:134114581-134114603 ATGTGGCAGCATTGGGAAGTTGG - Intronic
962399178 3:135042323-135042345 ATGTAACAGTGTTGAGAAGTGGG - Intronic
962619185 3:137160019-137160041 GTGTGGCAGTGTTGGAAGGTGGG + Intergenic
962683412 3:137823302-137823324 ATGTGGCAGTATTGAGAGGTGGG + Intergenic
962712455 3:138099583-138099605 GTGTGGCAGTGTTGAGAGGTGGG + Intronic
962771167 3:138611600-138611622 GTGTGGCAGTATTGGGAAGTGGG + Intronic
963122079 3:141784786-141784808 ATGTGGCAGTGTTGGAGAGGTGG + Intronic
963534793 3:146514159-146514181 CTGTACCAGTGTTGGAAACTAGG - Intergenic
963845890 3:150157820-150157842 ATGCAACAGTGTTGGGAAGTGGG - Intergenic
964028914 3:152113522-152113544 TTGTGGCAGTATTGAGATGTGGG - Intergenic
964578976 3:158209191-158209213 TTGCGGCAGTGTTGGGAGGTGGG + Intronic
964871096 3:161314406-161314428 ATGTGGTGGTATTGGGAAGTAGG + Intergenic
965259946 3:166468959-166468981 ATGTAAAAGTGTTGGGAAGTGGG - Intergenic
966043311 3:175518795-175518817 CTGTGGCAGTATTGAGAGGTGGG - Intronic
966622575 3:181981850-181981872 CTGTGGCAGGGTTGGGATAGAGG + Intergenic
966894961 3:184437668-184437690 GTGTGGCAGTATTGAGAGGTGGG + Intronic
967755611 3:193165096-193165118 CGGTTACAGTGTTGGAAAGTAGG + Intergenic
967762907 3:193244932-193244954 ATGTGGTAGTATTGAGAAGTGGG - Intronic
968041881 3:195595847-195595869 CTGGGGGGGTGTTGGGGAGTGGG - Intergenic
968840032 4:2996583-2996605 CTGTGACAGTATTGGGAGGTAGG - Intronic
969327437 4:6452077-6452099 CTGTGTAAGTGTGGGGAGGTTGG + Intronic
969391776 4:6896163-6896185 CTGTGCTAGTGTTAGGAGGTTGG + Intergenic
969500077 4:7547329-7547351 CTCTGGAAGTGGAGGGAAGTGGG - Intronic
969950388 4:10829630-10829652 CAGTGACAGTATTAGGAAGTGGG + Intergenic
969965139 4:10986361-10986383 ATGTGGTAGTATTAGGAAGTTGG + Intergenic
970140974 4:12981732-12981754 GTGTAGCAGTGTTGGGAGGTGGG + Intergenic
971333842 4:25704641-25704663 CTGTGGCAGTGCTGGAAGGTGGG - Intergenic
971443226 4:26712886-26712908 ATGTGGTAGTGTTGGGAGATGGG - Intronic
971575109 4:28263036-28263058 GTGTGGCAGTGTTGGAATGGGGG + Intergenic
972137670 4:35912223-35912245 GTGTGGCAGTGTTGGGAAGCAGG + Intergenic
972529360 4:39947863-39947885 TTGCAGCAGTGTTGGGAATTGGG - Intronic
972741324 4:41889507-41889529 ATTTCGCAGTGTTGGGAGGTGGG + Intergenic
973962628 4:56127006-56127028 ATGTGACAGTGTTGGGAGATGGG + Intergenic
974094344 4:57346192-57346214 ATGTGGCAGTATTGAGAAGTGGG + Intergenic
974384444 4:61186887-61186909 ATGTGGCAGTATTGAGAGGTGGG + Intergenic
974696346 4:65378632-65378654 CTGTGGCAGAGTTGAGGAGTTGG + Intronic
974818800 4:67039930-67039952 ACATGGCAGTGTTGGGAGGTGGG + Intergenic
975385974 4:73760808-73760830 ATGTGGCAATATTGAGAAGTGGG + Intergenic
975572456 4:75832012-75832034 GTGTGGCAGTATTGGGAGATGGG + Intergenic
975641203 4:76501980-76502002 ATGTGGCAGTATTGAGAAGTGGG + Intronic
975688348 4:76940507-76940529 GTGTGGTGGTGTTGGGAGGTAGG + Intergenic
975836437 4:78427073-78427095 ATGTGGCAGTATTGAGAGGTGGG + Intronic
976691548 4:87872814-87872836 CAGTGGCAGAGTTGGAAAGATGG - Intergenic
977263119 4:94822250-94822272 TTGTGGTGGTGTTGGGAGGTGGG - Intronic
977411247 4:96668044-96668066 CAGTGGGTGTGTTGGGAAATGGG + Intergenic
977436637 4:97004918-97004940 ATGTGACAGTGTTGGGAGGTGGG - Intergenic
977810444 4:101349528-101349550 CTAAGGCAGATTTGGGAAGTTGG + Intergenic
978206898 4:106090321-106090343 CTGAGGCTGTGCAGGGAAGTGGG + Intronic
978521453 4:109619868-109619890 CTGTGTCAGCCTTGTGAAGTAGG + Intronic
978605246 4:110472561-110472583 CAGTGGCAGTGTTGTGAGGTGGG + Intronic
978838694 4:113184210-113184232 GTGTGGGAGTTTTGGGAAATGGG + Intronic
978945513 4:114491059-114491081 ATTTGGCAGTGTTTGGAGGTGGG + Intergenic
979550661 4:121987581-121987603 GTGTGGCAGTATTGAGAGGTGGG + Intergenic
979601390 4:122589944-122589966 ATGTGTCTGTGTTGGGAGGTGGG - Intergenic
979772657 4:124548174-124548196 TTGTGACAGTGTTGAGAAGTGGG + Intergenic
979791073 4:124781562-124781584 CTGTGGTAGGGGTGGGAAATGGG + Intergenic
979901857 4:126230748-126230770 ATGTGGCAGTATTGAGAAGTGGG + Intergenic
980002154 4:127502450-127502472 CTGTGGCAGTTTGGGGAAGCAGG + Intergenic
980297874 4:130945662-130945684 CTGTGGCAGTATTGTTAAGCAGG + Intergenic
980595232 4:134946832-134946854 GTATGGCAGTGTTGAGAAGTGGG - Intergenic
980779103 4:137474014-137474036 ATATGGCAGTGTTGGGAGGTGGG - Intergenic
981061562 4:140430830-140430852 GTGTGGCAGTGCTGGAAAGTGGG + Intergenic
981179711 4:141726112-141726134 ATGTGGCAGTATTGAGAGGTGGG - Intronic
981361042 4:143845929-143845951 ATGTGGCAGTATTGAGAAATAGG - Intergenic
981371781 4:143966931-143966953 ATGTGGCAGTATTGAGAAATAGG - Intergenic
981488106 4:145309027-145309049 ATTTGGCAGTGTTTGGAGGTGGG - Intergenic
981515086 4:145599029-145599051 ATGTGACAGTGTTGGAAGGTGGG - Intergenic
981847404 4:149185112-149185134 ATGTGGCAGTTTTGAGAGGTGGG - Intergenic
981849369 4:149210602-149210624 ATGTGGCAGTGTTGAGAGGTGGG - Intergenic
982331290 4:154184660-154184682 CTGTGGCAGTATTAAGAGGTAGG + Intergenic
982515017 4:156335132-156335154 ATGTGGCAGTATTTAGAAGTGGG + Intergenic
982761745 4:159292514-159292536 GTGTGTCTGTGTTGGGGAGTGGG - Intronic
983054797 4:163089231-163089253 CTGTAGTGGTATTGGGAAGTGGG - Intergenic
983302806 4:165948731-165948753 ATGTGGCAGTATTGAGAGGTGGG - Intronic
983452847 4:167928879-167928901 ATATGACAGTGTTGGGAGGTGGG + Intergenic
983589637 4:169393635-169393657 CTGTGACAGTTTTGGTAACTAGG - Exonic
983634502 4:169883399-169883421 ATGTGGCAGTATTGAGAGGTGGG + Intergenic
983671239 4:170240278-170240300 GTGCAACAGTGTTGGGAAGTTGG - Intergenic
983852643 4:172601332-172601354 ATGTGGTAGTGTTGGGAGGTAGG + Intronic
983949920 4:173627622-173627644 CAGTGGCTGTGTTGTGAAGATGG + Intergenic
984841601 4:184073252-184073274 GTGTAGCGGTGTTGGGAGGTGGG + Intergenic
984877981 4:184386323-184386345 CTGAGTCTGTGTTGGGAAGAAGG + Intergenic
984902120 4:184594702-184594724 AGGTGGTGGTGTTGGGAAGTGGG + Intergenic
985130599 4:186734871-186734893 AGGTGGCCGTGTTGGGAGGTGGG - Intergenic
985184599 4:187302213-187302235 GTGTGAGAGTGTTGGGAAGGGGG - Intergenic
985375615 4:189334282-189334304 ATGTGGCAGTATTGAGAAGTGGG - Intergenic
985468034 5:16087-16109 ATGTGGCAGTGTGGGGCGGTGGG + Intergenic
985938883 5:3118387-3118409 GTTTGGCAGTGTTGGGAAACTGG - Intergenic
986028131 5:3870229-3870251 CTGTGGCAGGGTGGGGGACTTGG + Intergenic
986270812 5:6229048-6229070 CTGTGGGACTGTTGGGAAGTTGG + Intergenic
986291556 5:6403678-6403700 CTGTGATAGTGTTGAGAGGTAGG - Intergenic
986306933 5:6523030-6523052 CTGAGGCAGGGATGGGAGGTCGG + Intergenic
986503007 5:8420370-8420392 TTGTGGCAGTGTTGGGAGGTAGG + Intergenic
986504866 5:8439229-8439251 ATGTGGTAGTGTTGAGAGGTTGG - Intergenic
986691136 5:10314885-10314907 ATGTGGCAGTGCTGAGAGGTGGG + Intergenic
986761090 5:10880333-10880355 TTGTGGCAGGGTGGGGAAGAAGG + Intergenic
986788916 5:11141858-11141880 ATGTAACAGTGTTGAGAAGTGGG + Intronic
986992292 5:13568559-13568581 GTATGGCAGTGTTGGGAGGTAGG + Intergenic
987342800 5:16953431-16953453 CTGGGGCAGTGTCTGGAACTAGG - Intergenic
987754395 5:22082126-22082148 CTTTTGCAGTTTTGGGAGGTGGG + Intronic
987799005 5:22668710-22668732 ATGTGGCAGTATTGAGAGGTTGG - Intronic
987803230 5:22725671-22725693 GTGTGGCAGTATTAGGAGGTAGG - Intronic
988867172 5:35348191-35348213 CTGTTGGAGTGTGGGGAACTAGG - Intergenic
989313729 5:40052580-40052602 CTTTAGCAGTGTGGGGTAGTTGG - Intergenic
989349020 5:40463388-40463410 GTGTGGCAGTTTAGGGAGGTGGG + Intergenic
989419390 5:41218708-41218730 ATGTGCCAGGGTTGGGGAGTGGG + Intronic
989487695 5:42011209-42011231 ATGTGGCAGTGTTGAGAGGCGGG + Intergenic
989644843 5:43620071-43620093 ATGTGGCAATATTGGGAGGTGGG - Intronic
989648155 5:43659007-43659029 CTGTGGAAGTGTTGGTCAGATGG + Intronic
990339939 5:54812578-54812600 TTGTGGCAGTATTGAGAGGTGGG + Intergenic
991334961 5:65536867-65536889 TTGTGGCAGTGTTAAGAGGTAGG + Intronic
991633205 5:68677708-68677730 ATGTGGTAGTATTTGGAAGTAGG + Intergenic
992356107 5:75985329-75985351 ATGCAGCAGTGTTGGGAGGTGGG - Intergenic
992664624 5:78995041-78995063 GTGTGGCAGTGTTGGGAGGTGGG + Intergenic
992667448 5:79025165-79025187 CTCTGGCACTGCTGGGAAATCGG + Intronic
992770263 5:80041066-80041088 ATGTGGCGGTGTTGGGAGGTAGG - Intronic
993063218 5:83066707-83066729 GTAAGGTAGTGTTGGGAAGTGGG + Intronic
993111247 5:83659990-83660012 CCCTGGCAGGGTTGGGAAGTGGG - Intronic
993259058 5:85634935-85634957 ATGTGGCAGTATTGAGATGTGGG - Intergenic
993440767 5:87954281-87954303 CTGTGGCAGGGGTGAGGAGTAGG - Intergenic
993808743 5:92446621-92446643 TTGTGAATGTGTTGGGAAGTTGG - Intergenic
993810965 5:92475064-92475086 ATGTGGCAGTATTGGGAAGTGGG + Intergenic
994046379 5:95315039-95315061 GAGTGGCAGTGTGGGGCAGTAGG - Intergenic
994051274 5:95365499-95365521 CTGTGGTAGTATGGGGCAGTGGG + Intergenic
994680947 5:102887152-102887174 ATGTGGCACTGTTGGGAGATGGG + Intronic
994752772 5:103759245-103759267 CTTTGGCAGAGTTGGTAAGAAGG + Intergenic
994838284 5:104886068-104886090 ATGTGGGAGTGTTGAGAGGTAGG + Intergenic
994859040 5:105163982-105164004 GTATGGCAGTGTTGGGATATGGG - Intergenic
995941772 5:117594346-117594368 CCTTGGCAGTGTTTGGAAGCGGG - Intergenic
997146519 5:131440111-131440133 CAGGGGCAGTGTGGGGATGTTGG + Intronic
997239571 5:132296528-132296550 CTGTGGCACCTGTGGGAAGTGGG + Intronic
997429457 5:133827415-133827437 CAGGGGCAGTGTTGGGAGGCAGG - Intergenic
997668703 5:135652906-135652928 ATGCAACAGTGTTGGGAAGTAGG + Intergenic
997862594 5:137431531-137431553 GTGTGGTGGTGTTGGGAGGTGGG + Intronic
997870704 5:137502859-137502881 CTGTGGAAGTGGGGTGAAGTGGG - Intronic
998277331 5:140769281-140769303 TTGTGGCAATGTTAGGAGGTAGG - Intergenic
998403008 5:141857805-141857827 CTGTGCCAATATTGGGAAGCTGG - Intronic
998593742 5:143505735-143505757 ATGTGACAGTGCTGGCAAGTGGG - Intergenic
998781557 5:145662540-145662562 ATGTGGCAGTATTGAGAGGTAGG + Intronic
999168606 5:149573238-149573260 ATGTGGTGGTGTTGGGAGGTGGG - Intronic
999186040 5:149709699-149709721 CTGTGGCAGTGGAGGTAAGTGGG + Intergenic
999229878 5:150055429-150055451 CTGTTGCAGTGTTGTCAAGTGGG - Intronic
999453416 5:151695374-151695396 ATGCAGCAGTGTTGGGAGGTGGG - Intergenic
999590862 5:153143760-153143782 CTGTGGTGGTGGTGGCAAGTTGG - Intergenic
999617806 5:153443532-153443554 ATGTGGCAGTATTGAGAGGTGGG - Intergenic
999984540 5:156990730-156990752 CTGTCAGAGTGTTGGGAAGTAGG + Intergenic
1000153448 5:158526979-158527001 GTATGGCAGTATTGAGAAGTGGG + Intergenic
1000897199 5:166869301-166869323 TTGTGGCAGTGTTAGGAAGTTGG - Intergenic
1001318081 5:170658453-170658475 ATGTGGCAGTATTGCGAGGTAGG - Intronic
1001450592 5:171821431-171821453 CTGTGGCTATGTTTGGAAGCTGG + Intergenic
1001487760 5:172131836-172131858 ATGTAACAGTGTTGGGAGGTGGG + Intronic
1001581728 5:172803135-172803157 CTGGAGCACTGTTGGGAAGAGGG + Intergenic
1001701065 5:173706759-173706781 GTGTGACAGTATTAGGAAGTGGG - Intergenic
1002445958 5:179290115-179290137 GTGTGGCAGTGTTGGAAGGTGGG + Intronic
1002476152 5:179467558-179467580 GTGTGGGCGTGTTGGGAAGGTGG - Intergenic
1002745675 5:181469966-181469988 CTGTGTCAGTGTGGGGCGGTGGG - Intergenic
1003054496 6:2806024-2806046 CTGGGCCAGTTTTGTGAAGTAGG + Intergenic
1003863578 6:10343703-10343725 ATGTGGCAGTATTGAGACGTGGG - Intergenic
1003987174 6:11448401-11448423 CTGTGGTGGTGTTGGCAGGTGGG - Intergenic
1004064872 6:12234072-12234094 CTGTATCAGGGTTAGGAAGTTGG + Intergenic
1004173494 6:13317924-13317946 TTGTGGCAGTATTGAGAAGTGGG + Intronic
1004735673 6:18404024-18404046 GTGTAGTAGTGTTGGGAGGTGGG - Intronic
1004842729 6:19605854-19605876 TTGTGGTGGTGTTGGGAGGTGGG - Intergenic
1005142498 6:22649573-22649595 ATGTGCCAGTGTTGGGAAGTGGG + Intergenic
1005229484 6:23683988-23684010 ATGTGTCAGTGTTGGGAGGTGGG - Intergenic
1005353545 6:24960469-24960491 GTGCAGCAGTGTTAGGAAGTGGG - Intronic
1005475747 6:26205955-26205977 CTGTGGCAGTGAAGGGGAGCTGG - Intergenic
1005559554 6:27024387-27024409 GTGGGGCAGTATTGGAAAGTGGG - Intergenic
1006504439 6:34479127-34479149 ATGTGGCTGTGTTGGGAGGTAGG - Intronic
1007193019 6:40036118-40036140 ATGTGGCAGTGTTGGGAGTTGGG - Intergenic
1008356375 6:50558786-50558808 ATGTGGCAGTTTTGAGAGGTGGG + Intergenic
1008984849 6:57530080-57530102 ATGTGGCAGTATTGAGAGGTGGG - Intronic
1009172896 6:60423024-60423046 ATGTGGCAGTATTGAGATGTGGG - Intergenic
1009983912 6:70759353-70759375 CTGTGGCAGGGTGGGGAGGTTGG + Intronic
1010125042 6:72421658-72421680 ATGTGGAAGTGTTGGGAGGTGGG - Intergenic
1010265871 6:73866278-73866300 GTATGGCAGTGTTGGGAGATGGG + Intergenic
1010878481 6:81138556-81138578 CTCTGGCTGTGTTCAGAAGTAGG - Intergenic
1010955755 6:82089148-82089170 GTGTGGTAGTGATGGGAGGTGGG + Intergenic
1010984691 6:82410440-82410462 ATGTGGCAGTGTCGGGAGGTGGG - Intergenic
1011044055 6:83062477-83062499 ATGTGGCAGTGTTGAGACATAGG - Intronic
1011133842 6:84078560-84078582 GTGTGGCAGTTTTGGGAGGTGGG + Intronic
1011690950 6:89868563-89868585 CTGTGGAAGACTTGGGATGTGGG + Exonic
1012212139 6:96532456-96532478 ATGTGGCAGTATTGGGAAGTAGG + Intronic
1012433572 6:99191159-99191181 ATGTGGCAGTGTTGGGAGGTGGG + Intergenic
1012778870 6:103531456-103531478 CTGTGGCAGTGTTAGGAGGTGGG + Intergenic
1013120581 6:107137197-107137219 ATGTGGCAGTGTTGGGAGGTGGG - Intergenic
1013418243 6:109943749-109943771 CTGGAGCATTGTTGGGGAGTGGG - Intergenic
1013951758 6:115791269-115791291 CTGTGGCAGTATTGAGACATAGG - Intergenic
1015035513 6:128649472-128649494 GTGTGGCAATGCTGGGAGGTGGG + Intergenic
1015169868 6:130240605-130240627 ATGTGACTGTGTTGGGAAGTGGG + Intronic
1015942052 6:138462499-138462521 CTGTGGTAGTGTTGGAAGTTGGG - Intronic
1016064481 6:139665027-139665049 GTGTGGTAGTGCTGGGAGGTGGG - Intergenic
1016068078 6:139704565-139704587 ATGTGGCAGTGTTGGGAGGTGGG + Intergenic
1016212032 6:141548900-141548922 ATGTGGCAGTATTGAGAGGTGGG - Intergenic
1016291230 6:142530460-142530482 CTGTGTCACTGTTGAGTAGTGGG - Intergenic
1016349965 6:143156215-143156237 CTGTGGCCTTGTTGGAAATTGGG + Intronic
1016665538 6:146635675-146635697 AAGTGGGAGTGTTGGGAGGTGGG - Intronic
1017196705 6:151709130-151709152 CTGGGGCAGTGTCGGGCAGAGGG - Intronic
1017232497 6:152088469-152088491 ATGTGGCAGTATTGAGAAGTGGG + Intronic
1017934884 6:158996862-158996884 ATATGGCAGTGTTGGGAAGTGGG + Intronic
1017973385 6:159332584-159332606 TGGTGCAAGTGTTGGGAAGTAGG + Intergenic
1018035161 6:159875415-159875437 ATGTGGCAGTGTTGGGCGGTGGG + Intergenic
1018059388 6:160078790-160078812 TTGTGGCAGCTTTGGGAAGAGGG + Intronic
1018413408 6:163579469-163579491 GTGTGGAAGTGTTGGGAGGTGGG - Intergenic
1018626165 6:165780955-165780977 ATGTGGTAGTGTTGGGTGGTGGG + Intronic
1018940066 6:168303316-168303338 ATGTGGTGGTGTTGGGAGGTGGG + Intronic
1018990598 6:168670800-168670822 CTGGGGCAGTGTCAGGCAGTGGG + Intronic
1019234592 6:170599693-170599715 ATGTGGCAGTGTGGGGAGGTGGG - Intergenic
1019547785 7:1586773-1586795 CTGAGGCAGTCTTGGGAGGCTGG + Intergenic
1019723355 7:2586903-2586925 CTGTGGGAGTGTTAGGCAGAGGG + Intronic
1019996152 7:4725621-4725643 GTGTGGCTGTGTTGGGAGGACGG + Intronic
1020630619 7:10635417-10635439 ATGTAACAGTGTTGGGATGTGGG - Intergenic
1020638435 7:10725445-10725467 TTGTAACAGTGTTGAGAAGTGGG - Intergenic
1020750110 7:12130018-12130040 GTGTGGCAGTGTTGGGAGGTGGG + Intergenic
1021246917 7:18274539-18274561 ATGTGGCAGTGTTGGGAGGTAGG - Intronic
1021378192 7:19934889-19934911 CTGTGGCATGGGTGGGAATTGGG - Intergenic
1022466585 7:30656350-30656372 CCGTGGCAGTGAGGGGAAGGGGG - Intronic
1022522882 7:31019341-31019363 CTGTGGCTGTGGTGGGCTGTGGG - Intergenic
1023083330 7:36545874-36545896 CGGAGGCAGTGGTGGGAAATGGG - Intronic
1023715274 7:43037574-43037596 ATGTGGCAGTATTGGGAGGTGGG + Intergenic
1024022688 7:45386205-45386227 ACGTGGCAGTGCTGGGAGGTGGG + Intergenic
1024229903 7:47355847-47355869 CTGAGGCTCTGCTGGGAAGTGGG + Intronic
1024233535 7:47380629-47380651 CTCTGGAAGTCTTGGCAAGTTGG + Intronic
1024392756 7:48834250-48834272 CTGTGTATGTGTTGGGGAGTAGG + Intergenic
1024536964 7:50444034-50444056 CTATGGCAGCATTGGGCAGTAGG - Intergenic
1025063005 7:55827193-55827215 CTGTTGCAGTGTTGGCTAGCTGG - Intronic
1025147185 7:56514927-56514949 ATGTGGCAGTGTTGGGGGGTGGG - Intergenic
1025268185 7:57485061-57485083 CTGTGGCAGTGCTTGGGTGTCGG + Intergenic
1025300999 7:57819715-57819737 CTGTGGCAGTGCTTGGGTGTCGG + Intergenic
1026241123 7:68576068-68576090 ATGTGGCAGTATTGAGAGGTGGG - Intergenic
1026312216 7:69196373-69196395 CTGTAGCATTGTTGGGAGTTTGG - Intergenic
1026319182 7:69254182-69254204 ATGTGGCAGTGTTAGGGGGTGGG + Intergenic
1026432349 7:70359711-70359733 GTGTGGCAGTGTTGGGAGGTGGG - Intronic
1026500470 7:70939252-70939274 ATGTGGCAGTATTGAGAGGTGGG - Intergenic
1026512583 7:71039223-71039245 CTGTGGCAGTATTGAGATGTGGG + Intergenic
1027711044 7:81601742-81601764 GTGTGGTGGTGTTGGGAGGTGGG + Intergenic
1027716135 7:81673050-81673072 ATGTGGCAGTGTTGAGAAGTAGG + Intergenic
1028136900 7:87231431-87231453 CTTTGGCAGTTGTGGGATGTGGG + Intergenic
1028447688 7:90943888-90943910 GTGTGGCAGTGTTGGGAGGTGGG + Intronic
1028534076 7:91871845-91871867 ATGTGGCAGTATTGAGAGGTGGG + Intronic
1029234188 7:99099595-99099617 CTGTGGCAGCGGTGGGAGGTGGG + Intronic
1029654851 7:101917531-101917553 CTCTGCCAGTGTTGGGGAGTGGG + Intronic
1029789242 7:102825232-102825254 ATGTGGCAGTATTGAGAGGTGGG + Intronic
1030040467 7:105445498-105445520 ATGTGGCAGTGTTGGGAGGTGGG - Intronic
1030161407 7:106512166-106512188 CTGAGACAGTCTGGGGAAGTGGG - Intergenic
1030758765 7:113324240-113324262 CTTAGGCAGTATTTGGAAGTGGG + Intergenic
1030879569 7:114861002-114861024 ATGTGGCAGTATTGAGAGGTGGG + Intergenic
1031016999 7:116586018-116586040 CTGGGGCAGTTTAGGGCAGTGGG - Intergenic
1031407933 7:121407742-121407764 GTGTGGCTGTGTTGGGAGGTGGG + Intergenic
1031906306 7:127463880-127463902 ATGTGGCAGTATTGAGAAGCAGG + Intergenic
1032150640 7:129426677-129426699 AGGTGGCAGTGAGGGGAAGTGGG - Intronic
1032573596 7:133028474-133028496 CTGTGGCAGTATTGAGAGGTGGG + Intronic
1032770949 7:135055190-135055212 ATGTGCCAGTGTTGGGAGGTAGG - Intronic
1033475560 7:141688787-141688809 CTGTGGCAGGGCAGGGAAGATGG - Intronic
1033983230 7:147191815-147191837 CTGTGGCAGTGTTATGCAGATGG - Intronic
1034106390 7:148494363-148494385 AGCTGGCAGTGTTGGGAGGTGGG - Intergenic
1034165082 7:149019325-149019347 GTGTGGCAGTGTTGGGAGATGGG + Intronic
1034526656 7:151668040-151668062 ATGTGGCAGTGTTGAGAGGTGGG + Intronic
1034551183 7:151821770-151821792 CTTTGCCAGTGCTGGGACGTTGG + Intronic
1034881355 7:154765002-154765024 ATGTGGAGGTGTTGGGAGGTGGG - Intronic
1035513970 8:215783-215805 CTGTGTCAGTGTGGGGCGGTGGG + Intergenic
1037009342 8:13821179-13821201 GTGTAACAGTGTTGGGAGGTAGG - Intergenic
1037615108 8:20512138-20512160 CTGTGGCATTGTTTGGGAATCGG - Intergenic
1038001940 8:23399374-23399396 ATGTGGCAGTTTTGAGAGGTGGG + Intronic
1038448667 8:27623749-27623771 ATGTGGCAGTGTTGAGAGGTGGG - Intergenic
1038692535 8:29775981-29776003 GTGTGGCTGTGTTGGAAGGTGGG - Intergenic
1039204455 8:35135375-35135397 GTGTGGCAGTATTGAGACGTGGG - Intergenic
1039622106 8:39007337-39007359 GTGTGCCAGTGTTGGGAGGTGGG - Intronic
1039850940 8:41364485-41364507 GTGTGGCGGTGTTGGGACATGGG + Intergenic
1040074294 8:43213548-43213570 ATGTGGCAGGGTTGGGAGGTGGG + Intergenic
1040626729 8:49158216-49158238 GTGTGGCAGTGTTGGGAGGCGGG - Intergenic
1040906009 8:52470409-52470431 GTGTGGCAGTGCTGGGAGGTGGG + Intergenic
1040947359 8:52897495-52897517 ATGTGGCAATGTTGGGAGGTGGG - Intergenic
1041719053 8:60960003-60960025 ATGTGACAGTGTTGGGAAGTAGG - Intergenic
1041938369 8:63359813-63359835 TTGTGACAGTGTGGGGAGGTGGG + Intergenic
1042076536 8:65001453-65001475 CGGTAGCAGTGTTGGGAGGTAGG - Intergenic
1042113526 8:65407215-65407237 ATGTGGTAGTGTTGAGAGGTGGG - Intergenic
1042330231 8:67572260-67572282 ATGTGGTGGTGTTGGGAGGTGGG + Intronic
1042650329 8:71033528-71033550 ATGTGGCAATGTTGGGATGTGGG + Intergenic
1043169082 8:76941433-76941455 ATGTGGCAGTATGGAGAAGTGGG - Intergenic
1043563203 8:81519298-81519320 ATGTGGCAGTATTGAGAGGTGGG - Intergenic
1044163851 8:88955593-88955615 ACGTGGCAGTGTTAAGAAGTGGG + Intergenic
1044231575 8:89785064-89785086 ATGTGGTGGTGTTGGGAGGTGGG - Intronic
1044282531 8:90373194-90373216 ATGTGGCTGTGTTGGGAGATAGG + Intergenic
1044433602 8:92136398-92136420 GTGTGGCAGTGTCAGGAGGTGGG - Intergenic
1044872502 8:96633084-96633106 ACATGGCAGTGTTGGGAGGTGGG - Intergenic
1044923894 8:97193432-97193454 GTGTGGCAGTATTGGGAGGTGGG + Intergenic
1045037890 8:98190695-98190717 CAATGGCAGAGTTGGGTAGTTGG + Exonic
1045194028 8:99911850-99911872 ATGTGGCTGTGTTGGGAGGTGGG - Intergenic
1045339464 8:101240047-101240069 ATGTGACAATGTTGGGAGGTGGG + Intergenic
1045425748 8:102064299-102064321 CCCTGGCAGTGTTGGGGAGTGGG - Intronic
1045518112 8:102878962-102878984 ATGTGGCAGTATTGAGAGGTAGG + Intronic
1045606293 8:103781039-103781061 TTCTGGCAGTGTTGGGAGGCTGG + Intronic
1045803787 8:106133044-106133066 ATGTGGCAGTTTTGGGGAGATGG + Intergenic
1046227812 8:111307968-111307990 GTGTGGCAGTGTTGGGAAGTGGG - Intergenic
1047559692 8:125973171-125973193 ATGCAACAGTGTTGGGAAGTGGG - Intergenic
1047617328 8:126573535-126573557 ATGTGACAGTGTTAGGAAGCAGG + Intergenic
1047957472 8:129986446-129986468 ATGTGGCAGTGTTCAGAGGTGGG + Intronic
1048040012 8:130717973-130717995 GTGTGACAGTGTTGGGAGGTGGG + Intergenic
1048131293 8:131700550-131700572 GTGTGGCAGAGTTGGGACCTGGG - Intergenic
1048463539 8:134642720-134642742 CTGTGCGAGTGCTGGGAAGCTGG - Intronic
1048602577 8:135933690-135933712 ATGTGGCAGTATTGAGAGGTGGG + Intergenic
1049036525 8:140080677-140080699 GCATGGCAGTGTTGGGAGGTGGG - Intronic
1049202631 8:141349172-141349194 GTGTGACAGTGTTGGGATGAGGG + Intergenic
1049260595 8:141636949-141636971 CTGTGGCCCTGTTGGGAGGGTGG + Intergenic
1049284643 8:141767896-141767918 ATGTGGTAGTGTTGGGAGGTGGG - Intergenic
1049392654 8:142380169-142380191 CTGTGGAGTTGTTGGGAGGTGGG - Intronic
1049440108 8:142605706-142605728 TTGTGGCAGTGTTGAGAGGTGGG - Intergenic
1050046996 9:1557259-1557281 CTGTGGCTTTGTTTGGAAATAGG + Intergenic
1050151513 9:2622626-2622648 CAGGCGCAGTGTTGGGAAGGAGG + Intronic
1050249481 9:3729545-3729567 GTGTGGCAGAGTAGGGAAGTGGG - Intergenic
1050328875 9:4524955-4524977 CTGTGGCAGTATTGGAAGGCAGG - Intronic
1050352205 9:4750958-4750980 TTGAGACAGTGTTGGGAGGTGGG - Intergenic
1050437756 9:5628582-5628604 CTGTGGCTGTGGTGGGCGGTAGG - Intergenic
1050470366 9:5982414-5982436 ATGTGGCAGTATTGAGAGGTGGG + Intronic
1050868321 9:10532943-10532965 GTGTGGCAGTGTTGGGATGTAGG + Intronic
1051169710 9:14308154-14308176 CTGTTTCAGTGTTGGAATGTTGG - Intronic
1051201641 9:14633355-14633377 CAGTGGGAATGTTGGGCAGTAGG - Intronic
1051297089 9:15608213-15608235 ATGTGACAGTTTTGAGAAGTGGG - Intronic
1051306771 9:15718213-15718235 CTGTGGCAGTGGTGGCCAGGGGG + Intronic
1051695963 9:19768137-19768159 ATGTGGCAGTATTGAGAGGTGGG - Intronic
1051726185 9:20089692-20089714 CTGTGGCAGTGGTGGGCAGGGGG - Intergenic
1052116701 9:24657179-24657201 TTGTAACAGTGTTGGGAGGTGGG - Intergenic
1052199552 9:25761678-25761700 CTGTGGCAGTGGTGGCTACTAGG - Intergenic
1052222066 9:26036532-26036554 ATGTGGCAGTATTGAGAAATGGG - Intergenic
1052439174 9:28471491-28471513 GTGTAGCAGTGTTGGGAGGTGGG - Intronic
1052554473 9:29996746-29996768 GTGTGGCAATGTTGAGAGGTGGG + Intergenic
1052760097 9:32581468-32581490 ATGTGGTAGTGGTGGGGAGTGGG - Intergenic
1053351105 9:37413860-37413882 TTGTGACAGTGTTGAGAAATGGG - Intergenic
1054172369 9:61854194-61854216 CTGTGGCAGTGCTTGGGTGTCGG + Exonic
1054665170 9:67726611-67726633 CTGTGGCAGTGCTTGGGTGTCGG - Intergenic
1054719677 9:68592471-68592493 CTGTGGTGGGGTTGGGGAGTGGG - Intergenic
1054765601 9:69040068-69040090 ATGTGGCAGTATTGAGAGGTGGG - Intronic
1054910008 9:70445990-70446012 ATGTGGCAGTGTTGGGAGGTAGG + Intergenic
1055140469 9:72871430-72871452 ATGTGGCAGTATTGAGAGGTGGG - Intergenic
1056145600 9:83725796-83725818 ATGTGGCAGTGTTGGGAGGTGGG - Intergenic
1056456853 9:86768518-86768540 CTGGGAAAGTGTTGGGAAGCTGG - Intergenic
1056995067 9:91448555-91448577 GTGTGGCAGTGTTGGGAGGTGGG - Intergenic
1057056258 9:91963585-91963607 ATGTGATAGTGTTAGGAAGTGGG + Intergenic
1057510596 9:95676425-95676447 GTGTGGCAGTGTTGGCAGGTGGG - Intergenic
1057569458 9:96193466-96193488 GTGTGGCAGCGTTGGGAGGTGGG - Intergenic
1057642382 9:96836709-96836731 ATGTAGCAGTGTTGGGAGGTGGG + Intronic
1058444268 9:105040635-105040657 GTGTGGCAGTGTTGGGAGGTGGG - Intergenic
1058532155 9:105916662-105916684 ACATGGCAGTGTTGGGAGGTGGG - Intergenic
1058546116 9:106061750-106061772 ATGGAGCAGTGTTGGGAAGTGGG + Intergenic
1058637913 9:107054805-107054827 CTGATGAAGTGTTGGGAAGAGGG - Intergenic
1059192952 9:112344281-112344303 TTGTGGCAGTGTTGGGAGATGGG + Intergenic
1059341691 9:113601025-113601047 CTGGGGCAGGGTGGGGAAGGAGG + Intergenic
1059985974 9:119821012-119821034 CAGTGGCTGAGGTGGGAAGTAGG + Intergenic
1060106559 9:120876753-120876775 CTGCGGCAGGGTTGGGATGGGGG - Intronic
1060315412 9:122505491-122505513 ATGTGTCAGTGTTGAGAGGTGGG - Intergenic
1060356327 9:122912484-122912506 CTGTTGTAGTGGTGGGGAGTAGG - Intronic
1060601715 9:124882463-124882485 CAGGGGGAGTGCTGGGAAGTGGG + Intronic
1061433426 9:130545505-130545527 ATGTGGCAGTATCAGGAAGTGGG + Intergenic
1061497122 9:130981516-130981538 CTGTGGCCCTGAGGGGAAGTGGG - Intergenic
1061617930 9:131792389-131792411 CAGTGGCATTCGTGGGAAGTGGG - Intergenic
1062298752 9:135851556-135851578 TTGTGGCAGTGTTGGGAGAATGG - Intronic
1062304537 9:135896808-135896830 ATGTGGCAGTGGTGAGAGGTGGG + Intronic
1062674827 9:137735664-137735686 ATATGGCAGTGTTGTGAGGTGGG + Intronic
1203580147 Un_KI270745v1:36118-36140 CTGTGTCAGTGTGGGGCGGTGGG - Intergenic
1185920499 X:4086816-4086838 TTGTGGCAATGTTGGGAGGTGGG + Intergenic
1186186142 X:7021457-7021479 CTCTGGCAGTGTTGAGTAATTGG - Intergenic
1186233382 X:7480223-7480245 CTGTGGCAGCAAAGGGAAGTTGG + Intergenic
1186445847 X:9628203-9628225 CTGTGGCACTGTTGACATGTAGG + Intronic
1186607095 X:11103426-11103448 GTGTGGCAGTGCTGGGAGCTGGG - Intergenic
1186642899 X:11474718-11474740 GTGTGGTGGTGTTGGGAGGTGGG + Intronic
1187428122 X:19197005-19197027 CTGTGGCAGAGTAGGGATGGGGG - Intergenic
1187686888 X:21824650-21824672 TTGTGGCGGTGTTGAGAGGTGGG + Intergenic
1188038056 X:25340601-25340623 GTGTGGCGGTATGGGGAAGTGGG + Intergenic
1188819732 X:34760369-34760391 TTGTATCAGTGTTGAGAAGTGGG + Intergenic
1189030729 X:37446988-37447010 GCGTGGCAGTGTTGGGAGATGGG - Intronic
1189421306 X:40860639-40860661 ATGTGGCAGTATTGAGAAGTGGG - Intergenic
1189773462 X:44449150-44449172 AGGTGGCAGTGTTAGGAGGTGGG + Intergenic
1190021504 X:46882425-46882447 GTGTGGCAGTGTTGGGAGATGGG + Intergenic
1190030085 X:46963674-46963696 CTGGGGCAGTGGTAGGAGGTAGG + Intronic
1190074390 X:47305536-47305558 ATGCAGCAGTGTTGGGAGGTGGG + Intergenic
1190139871 X:47833434-47833456 ATGTAGCAGTATTGAGAAGTAGG + Intergenic
1190272663 X:48878478-48878500 ATGCAGCAGTGTTGGGAGGTGGG - Intergenic
1190369188 X:49725528-49725550 GTGTGGCAGTGTTGGGAGGTGGG + Intergenic
1190523622 X:51305800-51305822 GTGTGGCAGTGTTGAGAGGTAGG + Intergenic
1190643871 X:52506581-52506603 CCGTGGCAGTGTTGGGAGGTGGG + Intergenic
1190690615 X:52910174-52910196 GTGCTGCAGTGTTGGGAGGTGGG + Intergenic
1190695368 X:52945618-52945640 GTGCTGCAGTGTTGGGAGGTGGG - Intronic
1190862889 X:54360196-54360218 GTGTGGCAGTGGTGGGAATAGGG - Intergenic
1191692829 X:63958622-63958644 ATGTGGCAGTATTGAGAGGTGGG + Intergenic
1191764638 X:64684095-64684117 GTATGGCAGTGTTCGGTAGTAGG + Intergenic
1192388160 X:70695008-70695030 ATGTGGCAGTGTTAGGACTTGGG - Intronic
1192463476 X:71338105-71338127 GTGTGGCCATGTTGGGAGGTGGG + Intergenic
1192491259 X:71578960-71578982 CTGTGGCAGTGTCGGGGAAGTGG + Intronic
1192593103 X:72378196-72378218 ATGTGGCAGTGTTGGGAGGTGGG + Intronic
1192836849 X:74808936-74808958 ATGCAACAGTGTTGGGAAGTGGG + Intronic
1193424821 X:81328817-81328839 GTGTGGCAGTGTTGGGAGGAGGG + Intergenic
1193618687 X:83723537-83723559 CTGTGGCAGGTTTGGTAAATGGG + Intergenic
1195436631 X:104852001-104852023 ATGTGGCAGTGTTGGAAAGTGGG - Intronic
1196003662 X:110812752-110812774 ATGTGGTGGTGTTGGGAGGTAGG + Intergenic
1196015623 X:110937437-110937459 GTGTGTCAGTATTGGGAAGTGGG + Intergenic
1196015912 X:110939727-110939749 GTGTGACAGTGTTGGGAGGTGGG + Intergenic
1196138760 X:112237927-112237949 CTGTTCCAGTGTTAGGAAGGTGG + Intergenic
1196223380 X:113138068-113138090 GTGTGGAGGTGTTGGAAAGTGGG - Intergenic
1196301988 X:114058379-114058401 TTGAGGCTGTGATGGGAAGTGGG + Intergenic
1196397131 X:115276520-115276542 ATGTGGCAGTGTTGGGAGGTAGG - Intergenic
1196413855 X:115449745-115449767 ATGTGGCAGTGTTGGTAGATGGG + Intergenic
1196500429 X:116374599-116374621 GTGTGGCAGTGTTGGAAGGTGGG - Intergenic
1196729943 X:118930621-118930643 TTGCAGCAGTGTTGGGAAGTGGG + Intergenic
1196939413 X:120760883-120760905 ATGTGGCAGTGTTGAGAAGTGGG - Intergenic
1196972356 X:121123619-121123641 ATGTGGTGGTGTTGGGAGGTGGG + Intergenic
1197124685 X:122930439-122930461 ATGTGGCAGTATTGAGAGGTAGG + Intergenic
1197231716 X:124011883-124011905 ATGTGGCAGTACTGAGAAGTGGG - Intronic
1197324331 X:125073625-125073647 CTGTGGCATTGTAGGTATGTGGG + Intergenic
1197367175 X:125578568-125578590 CTGTGGAGGTGTTGGGAGGTGGG - Intergenic
1197400956 X:125990360-125990382 GTGCAACAGTGTTGGGAAGTGGG + Intergenic
1197711689 X:129676152-129676174 AGGTGACAGTGTTAGGAAGTGGG - Intergenic
1198193588 X:134336535-134336557 GTGTGGCAATGTTGGCAAGTGGG - Intergenic
1198588655 X:138150622-138150644 ATGTAGCAGTGTTGAGAGGTAGG + Intergenic
1199154696 X:144533798-144533820 TTGTGGCAGTGTGGAGAAGTAGG - Intergenic
1199336946 X:146629437-146629459 CTGTGGCAGTGTAGGAAACATGG + Intergenic
1199554684 X:149093549-149093571 GTATGGCGGTGTTGGGAGGTGGG + Intergenic
1199779785 X:151047763-151047785 GTGCAGCAGTATTGGGAAGTGGG + Intergenic
1199919286 X:152380870-152380892 GTGTGGCAGTGTTGGGAGGTGGG + Intronic
1199929413 X:152503424-152503446 GTGTGGCAGTGATGTGATGTGGG - Intergenic
1200291083 X:154874596-154874618 ATGCGACAGTGTTGGGAGGTAGG - Intronic
1201070515 Y:10143708-10143730 ATGTGACAGTGTTGAGATGTGGG + Intergenic
1201287859 Y:12394336-12394358 CTTTGGCAGTGTTGTGGATTTGG - Intergenic
1201584823 Y:15548863-15548885 CTTTGGCTGTGTTGGGAAGAGGG + Intergenic
1201795203 Y:17889669-17889691 CACTGGGAGTGCTGGGAAGTGGG + Intergenic
1201806352 Y:18016315-18016337 CACTGGGAGTGCTGGGAAGTGGG - Intergenic
1201856397 Y:18549087-18549109 TTGTGATAGTGTTGGGAGGTAGG - Intronic
1201876924 Y:18771297-18771319 TTGTGATAGTGTTGGGAGGTAGG + Intronic
1201903988 Y:19071145-19071167 CTGTGGCAGTTTTTGGACTTAGG - Intergenic
1202053773 Y:20807825-20807847 TTGTGATAGTGTTGGGAAGTAGG + Intergenic
1202149041 Y:21828194-21828216 CTGTGGGAGTGTTGTGAGTTTGG + Intergenic
1202356645 Y:24058751-24058773 ACTTGGGAGTGTTGGGAAGTGGG + Intergenic
1202514133 Y:25611359-25611381 ACTTGGGAGTGTTGGGAAGTGGG - Intergenic
1202589968 Y:26472478-26472500 ATGTGGCAGTATTGAGAGGTGGG + Intergenic