ID: 1100849852

View in Genome Browser
Species Human (GRCh38)
Location 12:98698037-98698059
Sequence TTATGTGGTCCCTCAATATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100849848_1100849852 26 Left 1100849848 12:98697988-98698010 CCCTGGATACAGTGTAGCGACTT 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1100849852 12:98698037-98698059 TTATGTGGTCCCTCAATATGTGG 0: 1
1: 0
2: 0
3: 8
4: 116
1100849849_1100849852 25 Left 1100849849 12:98697989-98698011 CCTGGATACAGTGTAGCGACTTG 0: 1
1: 0
2: 0
3: 7
4: 156
Right 1100849852 12:98698037-98698059 TTATGTGGTCCCTCAATATGTGG 0: 1
1: 0
2: 0
3: 8
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100849852 Original CRISPR TTATGTGGTCCCTCAATATG TGG Intronic
913608526 1:120488935-120488957 TTATGTTGGCCTTCAATATGTGG + Intergenic
913986904 1:143573735-143573757 TTATGTTGGCCTTCAATATATGG - Intergenic
914370270 1:147018715-147018737 TTATGTTGGCCTTCAATATATGG + Intergenic
914484424 1:148094698-148094720 TTATGTTGGCCTTCAATATATGG - Intergenic
914582676 1:149032903-149032925 TTATGTTGGCCTTCAATATATGG - Exonic
1063815603 10:9768007-9768029 TTTTATGGCCCCTCAATATGGGG - Intergenic
1063985017 10:11493144-11493166 TAATGTGGTCCCGAAATGTGCGG + Exonic
1065012073 10:21429917-21429939 ATATGTGGGCCCTCATTATCTGG - Intergenic
1074612374 10:115034513-115034535 TTATGTGGTCTCTGAAGATATGG + Intergenic
1078245056 11:9566576-9566598 TAATGTGGTCCCTCCGTTTGGGG - Intergenic
1079628206 11:22641542-22641564 ATATGTGTTACCTCAATCTGGGG - Intronic
1081117851 11:39227015-39227037 TTATGTAGTGCCTTAAAATGAGG + Intergenic
1081469087 11:43352987-43353009 TTATGTGCTTCCTCAGTAGGTGG + Intergenic
1084626902 11:70314704-70314726 TTATGTGGTCCCTAAATACTAGG + Intronic
1087109915 11:94453826-94453848 TTATGTTCTACCTCAATTTGAGG - Intronic
1088622850 11:111704344-111704366 TTCTCTGTTCCCTCAATATCTGG + Intronic
1091535157 12:1400078-1400100 TGATGTGGTATCTCATTATGGGG + Intronic
1095244514 12:39903533-39903555 TTCTGGGGTCCCTCCGTATGTGG + Intronic
1097029936 12:56082860-56082882 TTGTGTGGAGGCTCAATATGGGG + Intronic
1097450506 12:59732679-59732701 TTATGAAGTCCCTCAGAATGTGG - Intronic
1097965571 12:65576187-65576209 TTATATGTTCCCTAAATATTTGG - Intergenic
1098225617 12:68319523-68319545 TTATGAGGTTCCTAAATATAAGG - Intronic
1098413315 12:70204729-70204751 TTAAGTTGTCCCTCTATATAGGG + Intergenic
1098472726 12:70864373-70864395 TTCTGTGGTCCCCTAATCTGTGG + Intronic
1098581488 12:72104272-72104294 CTATGTGGTCCTTCCATGTGAGG + Intronic
1100849852 12:98698037-98698059 TTATGTGGTCCCTCAATATGTGG + Intronic
1100867636 12:98874128-98874150 TTTTGTGGTACCTAAATATTTGG - Intronic
1101050497 12:100858388-100858410 ATATGTGGTCCGTCATTATGAGG + Intronic
1105485989 13:20833317-20833339 TACTGTTGTCCCTCAATATCCGG + Intronic
1107059583 13:36143583-36143605 TTATTTGTTCCTTCAATATTTGG - Intergenic
1108750703 13:53445601-53445623 TTACGTGGTCCCTGAATTTCTGG + Intergenic
1109642812 13:65212474-65212496 TTATAAGATCCCTCAATAAGTGG - Intergenic
1111402977 13:87765361-87765383 TAATGTGGTTCCCCAAAATGTGG + Intergenic
1114277449 14:21159542-21159564 TTATGTGGTTCCCAAATATTTGG + Intergenic
1114277917 14:21164696-21164718 TTATGTGGTTCCCAAATATTTGG - Intergenic
1114537101 14:23429925-23429947 TTCTGGGGTCCGCCAATATGGGG - Intronic
1114542845 14:23475474-23475496 TTATGTGGCACCTTAATATAGGG + Intronic
1114755688 14:25256938-25256960 TTATGTGTTCCAACAAAATGAGG - Intergenic
1116055946 14:39863946-39863968 TTATGTGGTTCCTAAAAAGGTGG + Intergenic
1119348054 14:73942512-73942534 TCCTGTGGTCCCTGACTATGAGG - Exonic
1129296097 15:74600960-74600982 ATATGTGGACCCTCTAGATGGGG - Intronic
1130095399 15:80851808-80851830 GTATGAGGTCCCTCAAGAAGTGG - Intronic
1136150636 16:28346034-28346056 TTTTTTGGTCCCTCAATGGGAGG - Intronic
1136166873 16:28459872-28459894 TTTTTTGGTCCCTCAATGGGAGG - Intronic
1136196102 16:28655160-28655182 TTTTTTGGTCCCTCAATGGGAGG + Intronic
1136212442 16:28769283-28769305 TTTTTTGGTCCCTCAATGGGAGG + Intronic
1136257163 16:29049195-29049217 TTTTTTGGTCCCTCAATGGGAGG + Intronic
1140366854 16:74388530-74388552 TTTTTTGGTCCCTCAATGGGAGG + Intronic
1148514721 17:48205906-48205928 ATATGTGCTCCATCAAAATGAGG + Intronic
1149387495 17:56156398-56156420 TAATGTGGTCCCTCTTTAAGAGG - Intronic
1150949681 17:69789168-69789190 TTATGTGGCCTCTCCATGTGTGG + Intergenic
1157643379 18:49241605-49241627 TTATTTGGTCCCTCTACAAGTGG - Intronic
1158382571 18:56949809-56949831 TTATGTTGTCTCTCCATATATGG + Intronic
1160157108 18:76442382-76442404 TGATGTGGTCCCTCTCGATGTGG + Exonic
1163388518 19:17015329-17015351 TCATGTGGTCCCTCAAGGGGTGG + Intronic
1167496363 19:49821239-49821261 CTATTGGGTCCCTCAATCTGAGG - Intronic
1168604786 19:57749870-57749892 CTATGTGGTCCTTCATGATGAGG + Intronic
925203843 2:1990364-1990386 TTCTGTGGTTCCTCAATTTGTGG + Intronic
926757226 2:16245839-16245861 TTGTGTGGTGGCACAATATGGGG + Intergenic
929409790 2:41685226-41685248 ACATGTGCTCCTTCAATATGAGG + Intergenic
929523643 2:42678888-42678910 TTAAGTGATCCCTCACTATCTGG - Intronic
930508198 2:52311216-52311238 TTATTAGCTCCCTCAAAATGGGG - Intergenic
938086136 2:128403333-128403355 GTATGTGCGCCCACAATATGGGG + Intergenic
939311168 2:140479136-140479158 TTATTTTGTCTCTCAATAAGTGG + Intronic
943904492 2:193480556-193480578 TTTTGTGGTACCTGAATCTGGGG + Intergenic
944615756 2:201458324-201458346 TTATTTTTTCACTCAATATGTGG + Intronic
947734948 2:232449539-232449561 TTATGTGGCCCCTCACTAAAAGG + Intergenic
1169035523 20:2448096-2448118 TTATGTGTTCTCTCAATTTTGGG - Intergenic
1177892361 21:26821696-26821718 TTATATGGTCCCACAGTTTGTGG + Intergenic
1185293447 22:50040662-50040684 TTATGTAATCCCTCAATAAAAGG + Intronic
951105665 3:18739182-18739204 TTTTGGGGTTGCTCAATATGTGG - Intergenic
953502262 3:43448555-43448577 TTATGTTGTACATCTATATGAGG - Intronic
953555916 3:43946737-43946759 TTTTGTGGTTCCTCAAAAAGTGG - Intergenic
954980715 3:54742852-54742874 TTTTCTGGTCCCTGACTATGAGG + Intronic
955492845 3:59500251-59500273 TTTTGTGGTCCAGGAATATGGGG + Intergenic
956329480 3:68089782-68089804 TTAGCTGGTCCCTCAATGTCTGG + Intronic
956334353 3:68146534-68146556 TTATGTGGGTCCCCAAGATGGGG - Intronic
958456350 3:94336570-94336592 TTAGGTGATGCCTCAATATAAGG - Intergenic
964199522 3:154102727-154102749 TTATGTGGACCAACAATGTGTGG + Intergenic
964754543 3:160081876-160081898 TCAGGTGGTCCCTCCATTTGGGG + Intergenic
974396933 4:61349251-61349273 AAATGTGTTCCATCAATATGTGG + Intronic
974783656 4:66588619-66588641 TTATGTGGTCTAACATTATGGGG - Intergenic
975969649 4:80017759-80017781 TTTTCTGGTCCCTCAGGATGTGG - Intronic
979856575 4:125640074-125640096 TTATATGCTACCTTAATATGTGG + Intergenic
980863615 4:138528937-138528959 TCATGGGGTACCTGAATATGGGG + Intergenic
981193907 4:141896077-141896099 TGATGTGGTGCCCCAGTATGGGG + Intergenic
981670010 4:147275992-147276014 TGAAGTCGTTCCTCAATATGAGG + Intergenic
983388396 4:167096534-167096556 TTCTTTAGTCCCTCAATATTTGG + Intronic
989129121 5:38087068-38087090 TCTTGTGGTCCCTTGATATGAGG + Intergenic
989191442 5:38673559-38673581 TTATGTGCTGCCTCAACATTTGG + Intergenic
992296252 5:75329850-75329872 TTATGTGCTCACCCAGTATGTGG + Intergenic
994852536 5:105074336-105074358 TAAAGTGGTACCTGAATATGGGG - Intergenic
1001112955 5:168913343-168913365 TGTTGTGGTCACTTAATATGAGG - Intronic
1003994060 6:11520342-11520364 TTATCTATTCCCTCAATCTGAGG + Intergenic
1004770506 6:18775834-18775856 TTGTGTTGTCACTCAATTTGTGG - Intergenic
1016075240 6:139788202-139788224 TTCTCTGGTCCCTCAAGATTAGG + Intergenic
1022176660 7:27877508-27877530 GTATGTGTTCCTTCAATATGGGG + Intronic
1023885643 7:44352585-44352607 TGATGTGGTTCCTCAATGTATGG + Intergenic
1031282807 7:119825717-119825739 TTATGTAGTCCATCAATTTATGG + Intergenic
1032819044 7:135507927-135507949 TTATTTGGTCCCCCAAATTGGGG + Intronic
1034433784 7:151053573-151053595 TGATGTGGTCCCTCAGAGTGAGG - Intergenic
1034866520 7:154647075-154647097 TTATGGGGTCCCCCAGTATCAGG - Intronic
1037631584 8:20661588-20661610 TTTTCTGTTCCCTAAATATGTGG + Intergenic
1039731097 8:40279572-40279594 TTCTGAGTTTCCTCAATATGCGG + Intergenic
1041967021 8:63689989-63690011 TAATGTGATCCCCAAATATGGGG - Intergenic
1050487625 9:6150669-6150691 CTATGTGGGCCCTCAATGAGTGG + Intergenic
1051111925 9:13649006-13649028 TTATGTGCTGCCTCAACATCTGG - Intergenic
1052086250 9:24269936-24269958 ATATGTGGTCTCTATATATGGGG - Intergenic
1052508943 9:29390037-29390059 TTTTGTGATCCCAAAATATGTGG + Intergenic
1055134500 9:72812393-72812415 TTAAGTGTTCCTTGAATATGTGG + Intronic
1186298900 X:8177689-8177711 TTAAGTGGTCCCTCCACATTTGG + Intergenic
1186472657 X:9833513-9833535 TTATGAGGTCCCTAATTAGGAGG - Intronic
1188442812 X:30230090-30230112 TTGTGTGGTCCCTGATTTTGAGG - Intergenic
1196035575 X:111140135-111140157 GTATTTGGTCCCCCAACATGTGG + Intronic
1199607573 X:149587756-149587778 TTCTGTGGCCCCTCTATGTGGGG + Intergenic
1199622140 X:149711655-149711677 TTCTGTGGCCCCTCTATGTGGGG - Intronic
1199626961 X:149750252-149750274 TTCTGTGGCCCCTCTATGTGGGG - Intergenic
1199629039 X:149763218-149763240 TTCTGTGGCCCCTCTATGTGGGG + Intergenic
1199631550 X:149781611-149781633 TTCTGTGGCCCCTCTATGTGGGG - Intergenic
1199895291 X:152120705-152120727 TTCTGTGGCCCCTCACTGTGGGG + Intergenic
1199947049 X:152678822-152678844 TTCTGTGGTCCCTCTATGTGGGG - Intergenic
1199962632 X:152789632-152789654 TTCTGTGGTCCCTCTATGTGGGG + Intergenic
1202063093 Y:20908728-20908750 TAATTTTGTGCCTCAATATGTGG - Intergenic
1202335548 Y:23805964-23805986 TTATGTAGTCCGTCAGTATATGG + Intergenic
1202535219 Y:25864095-25864117 TTATGTAGTCCGTCAGTATATGG - Intergenic