ID: 1100850912

View in Genome Browser
Species Human (GRCh38)
Location 12:98710014-98710036
Sequence TACATGTGTGCTACCACGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1069
Summary {0: 1, 1: 1, 2: 2, 3: 77, 4: 988}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100850906_1100850912 25 Left 1100850906 12:98709966-98709988 CCTGGGTTCAAGAGATTCTCATG 0: 202
1: 7746
2: 97461
3: 171932
4: 206132
Right 1100850912 12:98710014-98710036 TACATGTGTGCTACCACGCATGG 0: 1
1: 1
2: 2
3: 77
4: 988
1100850910_1100850912 -4 Left 1100850910 12:98709995-98710017 CCTCCTGAGTAGCTGGGACTACA 0: 40849
1: 157871
2: 218647
3: 208196
4: 128589
Right 1100850912 12:98710014-98710036 TACATGTGTGCTACCACGCATGG 0: 1
1: 1
2: 2
3: 77
4: 988
1100850905_1100850912 28 Left 1100850905 12:98709963-98709985 CCTCCTGGGTTCAAGAGATTCTC 0: 2061
1: 50893
2: 109045
3: 168761
4: 180981
Right 1100850912 12:98710014-98710036 TACATGTGTGCTACCACGCATGG 0: 1
1: 1
2: 2
3: 77
4: 988
1100850911_1100850912 -7 Left 1100850911 12:98709998-98710020 CCTGAGTAGCTGGGACTACATGT 0: 267
1: 30305
2: 152779
3: 251755
4: 217785
Right 1100850912 12:98710014-98710036 TACATGTGTGCTACCACGCATGG 0: 1
1: 1
2: 2
3: 77
4: 988
1100850908_1100850912 2 Left 1100850908 12:98709989-98710011 CCTGAGCCTCCTGAGTAGCTGGG 0: 435
1: 97726
2: 204181
3: 239713
4: 155666
Right 1100850912 12:98710014-98710036 TACATGTGTGCTACCACGCATGG 0: 1
1: 1
2: 2
3: 77
4: 988

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100850912 Original CRISPR TACATGTGTGCTACCACGCA TGG Intronic
900211564 1:1458861-1458883 CACAGGTGTGCCACCACGCCTGG + Intronic
900217344 1:1488903-1488925 TACAGGTGTGCCACCATGCATGG + Intronic
900224371 1:1526161-1526183 TACAGGTGCGCCACCACGCCTGG + Intronic
900281322 1:1871315-1871337 TAGATGTGTGCCACCATGCCTGG - Intronic
900508586 1:3044294-3044316 TACATGTGAGCCACCACACCTGG - Intergenic
901282588 1:8050757-8050779 CACATGTGAGCCACCACGCCTGG - Intergenic
901508159 1:9699729-9699751 TAGGTGTGTGCCACCACGCCTGG + Intronic
901561645 1:10076519-10076541 CACACGTGAGCTACCACGCCTGG + Intronic
901712092 1:11123742-11123764 TACATGTGAGCCACCATGCCTGG + Intronic
901888477 1:12241081-12241103 CAGATGTGTGCTACCATGCCTGG + Intronic
902526602 1:17062720-17062742 TAGATGTGTGCCACCGCGCCTGG + Intergenic
902565867 1:17310952-17310974 TAGCTGCGTGCTACCACGCCCGG - Intronic
902874204 1:19331285-19331307 TACAGGTGTGCCACCGCGCCCGG + Intergenic
902930695 1:19729288-19729310 TACAGGCGTGCCACCACGCCTGG + Intronic
903073542 1:20743384-20743406 CAGATGTGAGCTACCACTCACGG - Exonic
903234092 1:21938251-21938273 TACAGGCGTGCCACCACGCCTGG + Intergenic
903276890 1:22227894-22227916 CAGATGTGTGCCACCACGCCTGG + Intergenic
903710419 1:25319466-25319488 TACAGGTGTACCACCACGCCTGG - Intronic
904026524 1:27507289-27507311 CAGGTGTGTGCTACCACGCCTGG + Intergenic
904055006 1:27664227-27664249 TAGGTGTGTGCCACCACGCCCGG - Intergenic
904216288 1:28922768-28922790 TAGGTGTGTGCTACCATGCCCGG + Intronic
904233100 1:29093760-29093782 CAGGTGTGTGCCACCACGCACGG - Intronic
904394605 1:30210607-30210629 TACAGGTATGCCACCACGCCTGG + Intergenic
904594884 1:31637502-31637524 TACATGTGTACCACCATGCCCGG - Intronic
905169520 1:36101034-36101056 TAGGTGTGTGCCACCACGCCTGG + Intronic
905192390 1:36245444-36245466 TAGATGTGAGCCACCACGCCTGG + Intronic
905248055 1:36628398-36628420 TACATACGTGCCACCACGCCCGG - Intergenic
905729567 1:40287532-40287554 TACAGGCGTGCCACCACGCCTGG - Intronic
906106234 1:43294260-43294282 TAGGTGTGTGCTACCACCCCTGG - Intergenic
906395901 1:45464281-45464303 TACAGGTGTGCCACCATGCCTGG - Intronic
906404714 1:45532767-45532789 TAGATGGGTGCCACCACGCCTGG + Intergenic
906628014 1:47341509-47341531 CAGGTGTGTGCTACCACGCCTGG + Intronic
906629754 1:47356801-47356823 GAGATGTGTGCCACCACGCCAGG + Intronic
907117338 1:51980283-51980305 TAGATGTGTGCCACCACGGCTGG - Intronic
907134788 1:52129937-52129959 CAGATGCGTGCTACCACGCCCGG - Intergenic
907222482 1:52917078-52917100 TAGGTGTGTGCCACCACGCCTGG - Intronic
907386352 1:54128044-54128066 GAGATGTGTGCTTCCACGGAGGG - Intergenic
907789710 1:57650283-57650305 TACAGGTGTGCCACCACGCCTGG + Intronic
908375399 1:63533064-63533086 AACATGTGTGCTCACACACACGG + Intronic
908476568 1:64494299-64494321 TTCATGTGTCTTACCAGGCAAGG - Intronic
908554090 1:65239800-65239822 TAGGTGTGTGCCACCACGCCTGG + Intergenic
908776973 1:67649813-67649835 TACAGGTGTGCCACCAAGCCTGG - Intergenic
908992861 1:70114543-70114565 CACATGTGTGCCATCACGCCTGG - Intronic
910302996 1:85728352-85728374 CACATGTGTGCCACCATGCCTGG + Intergenic
911037219 1:93563833-93563855 CAGGTGTGTGCTACCACGCCTGG + Intronic
911168358 1:94745153-94745175 CAGGTGTGTGCTACCACGCCTGG - Intergenic
911329395 1:96509885-96509907 TGCAGGTGTCCTACCACTCAAGG + Intergenic
911872989 1:103122836-103122858 TACAGGTGTGCCACCACACCTGG + Intergenic
912245616 1:107959116-107959138 CAGGTGTGTGCTACCACGCCTGG - Intronic
913962633 1:143352150-143352172 CAGGTGTGTGCTACCACGCCTGG - Intergenic
913964024 1:143359962-143359984 CAGGTGTGTGCTACCACGCCTGG + Intergenic
914056988 1:144177735-144177757 CAGGTGTGTGCTACCACGCCTGG - Intergenic
914058389 1:144185566-144185588 CAGGTGTGTGCTACCACGCCTGG + Intergenic
914120759 1:144780805-144780827 CAGGTGTGTGCTACCACGCCTGG - Intergenic
914122158 1:144788631-144788653 CAGGTGTGTGCTACCACGCCTGG + Intergenic
914249412 1:145909155-145909177 TAGGCGTGTGCTACCACGCCTGG - Intronic
914688121 1:150000686-150000708 TACATATGTGGGACCAGGCATGG + Intronic
914885757 1:151583074-151583096 TACAGGTGTGCCACCACGCCTGG + Exonic
915155337 1:153871039-153871061 CAGATGGGTGCTACCACGCCTGG + Intronic
915382349 1:155453210-155453232 TAGGTGTGTGCTACCACGCCTGG - Intronic
915469490 1:156117054-156117076 TAAGTGTGTGCCACCACACATGG + Intronic
915834557 1:159165137-159165159 CACATGGATGCCACCACGCAGGG - Intergenic
916046281 1:161002119-161002141 TACAGGTGTGCCACCATGCCTGG - Intronic
916419147 1:164620048-164620070 CAGATGTGTGCTACCACGCCTGG - Intronic
916799716 1:168204976-168204998 TAGGTATGTGCTACCACGCCTGG - Intergenic
916809099 1:168290049-168290071 CAGATGTGTGCCACCACGCCTGG - Intronic
917164997 1:172101999-172102021 CAGATGTGTGCCACCACGCCTGG + Intronic
917983461 1:180290332-180290354 TAGGTGTGTGCTACCATGCTTGG + Intronic
918623103 1:186627980-186628002 TACAGGTGTGCCACCATGCCTGG - Intergenic
919666448 1:200297369-200297391 CAGATGTGTGCCACCACGCCTGG + Intergenic
919720945 1:200834767-200834789 CACATGTGTGCCATCACGCCTGG - Intronic
919842761 1:201621472-201621494 TACAGGCGTGCCACCACGCCTGG + Intergenic
919870762 1:201819611-201819633 TAGTTGTGTGCCACCACGCCTGG + Intronic
919918174 1:202152050-202152072 CAAGTGTGTGCTACCACGCCTGG + Intronic
920140890 1:203811956-203811978 TAGATGTGTGCCACCATGCTTGG + Intronic
920181743 1:204136253-204136275 TACAGGTGTGCCACCATGCCCGG - Intronic
920231394 1:204472635-204472657 TAGACGTGTGCCACCACGCCTGG - Intronic
920313731 1:205063484-205063506 CACGTGTGTGCTACCATGCCTGG - Intronic
920382712 1:205544862-205544884 CAGACGTGTGCTACCACGCCTGG + Intergenic
920442121 1:205988367-205988389 TACAGGTGTGCCACCACACCTGG + Intronic
920453548 1:206079696-206079718 CAGGTGTGTGCTACCACGCCGGG + Intronic
921499323 1:215881281-215881303 TACGCGTGTGCTACCACACCCGG + Intronic
922291430 1:224212141-224212163 CAGATGTGTGCCACCACGCCTGG - Intergenic
922476354 1:225909409-225909431 CAGGTGTGTGCTACCACGCCTGG - Intronic
922520410 1:226245738-226245760 TAGCTGTGTGCCACCACGCCTGG + Intronic
922760945 1:228130178-228130200 TACAGGTGTGCTACTATGCCTGG - Intergenic
922822251 1:228492765-228492787 TACAGGCGTGCCACCACGCCTGG + Intronic
923586355 1:235275992-235276014 CAGGTGTGTGCTACCACGCCTGG - Intronic
923668218 1:236017526-236017548 CACGTGTGTGCCACCACGCCTGG + Intronic
923668764 1:236022124-236022146 TACAAGTGTGCCACCATGCCTGG - Intronic
923698570 1:236279358-236279380 TAGGTGTGTGCCACCACACACGG - Intronic
923800442 1:237204151-237204173 CAGATGTGTGCCACCACGCCTGG + Intronic
923815343 1:237371296-237371318 CAGGTGTGTGCTACCACGCCTGG + Intronic
924128804 1:240883931-240883953 TAGACGTGTGCCACCACGCCTGG - Intronic
924470805 1:244341036-244341058 TAGACGTGAGCCACCACGCATGG - Intergenic
1063512751 10:6662323-6662345 CAGATGTGTGCCACCACGCCTGG - Intergenic
1064596966 10:16955091-16955113 TAGATGTGAGCCACCATGCACGG - Intronic
1064616382 10:17162563-17162585 TAGATGTGAGCCACCACGCTCGG - Intronic
1064674607 10:17748589-17748611 CACATGAGTGCTAACACTCATGG + Intergenic
1065038956 10:21671376-21671398 TAGATGTGAGCCACCACGCCCGG - Intronic
1065246044 10:23758827-23758849 CACGTGTGTGCTACCACACCTGG + Intronic
1065324682 10:24540374-24540396 TAGGTGTGTGCCACCACGCCTGG + Intronic
1065469455 10:26062374-26062396 TACAGGCGCGCTACCATGCATGG - Intronic
1065732869 10:28725263-28725285 CAGATGTGTGCCACCACGCCTGG + Intergenic
1065870010 10:29948109-29948131 CAGATGTGTGCCACCACGCCTGG + Intergenic
1066121910 10:32297426-32297448 CACATGTCTGCCACCACGCCCGG + Intronic
1066386841 10:34948374-34948396 TACAGGTGTGCCACCATGCCCGG - Intergenic
1066630558 10:37455603-37455625 TACGTGTGTACCACCACGCGTGG + Intergenic
1067106334 10:43369405-43369427 TAGGTGTGTGCCACCACGCCAGG + Intergenic
1067290788 10:44938201-44938223 TACGTGTGTGCCACCATGCCTGG - Intergenic
1067363817 10:45606603-45606625 TAGGTGTGAGCTACCACGCCCGG - Intergenic
1067411279 10:46066775-46066797 TAGGTGTGTGCCACCACGCCAGG - Intergenic
1067917301 10:50414261-50414283 TACAGGTGTGCCACCATGCCTGG - Intronic
1068107252 10:52634194-52634216 CAGGTGTGTGCCACCACGCATGG - Intergenic
1068761953 10:60722301-60722323 TACAGGTGTGCTGCCACACCTGG - Intronic
1069401003 10:68046687-68046709 TAGATGTGAGCTACCTCGCCTGG - Intronic
1069401021 10:68046826-68046848 CAGATGTGTGCCACCACGCTTGG - Intronic
1069460052 10:68586149-68586171 TACATGTGTGCCACTATGCCTGG + Intronic
1069715670 10:70519715-70519737 CAGGTGTGTGCTACCACGCCGGG + Intronic
1070254864 10:74805262-74805284 TACAGGCGTGCCACCACGCCTGG - Intergenic
1070497612 10:77038680-77038702 TACGTGTGTGCCACCACACTCGG + Intronic
1070885982 10:79899765-79899787 CAGATGTGTGCCACCACGCCTGG + Intergenic
1070912171 10:80128173-80128195 TAGGCGTGTGCTACCACGCCTGG + Intergenic
1072242087 10:93506083-93506105 TACAGGTGCGCTACCATGCCTGG + Intronic
1072420718 10:95289312-95289334 TACAGGTCTGCTACCAGGCTCGG + Intronic
1073216057 10:101836984-101837006 TAGGTGTGTGCCACCACGCCAGG - Intronic
1073341365 10:102747217-102747239 TACAGGTGTGCCACCATGCCTGG - Intronic
1073375483 10:103030571-103030593 TACAGGTGTGCCACCACGCCTGG - Intronic
1073472827 10:103733893-103733915 CAGGTGTGTGCTACCACGCCTGG + Intronic
1073771203 10:106737580-106737602 CAGATGTGTGCCACCACGCCTGG - Intronic
1075151783 10:119939530-119939552 CAGGTGTGTGCTACCACGCCCGG - Intronic
1075271550 10:121056381-121056403 TAGGTGTGTGCCACCACGCCCGG + Intergenic
1077057778 11:603843-603865 TAGGTGTGTGCTACCACGCCCGG + Intronic
1077149920 11:1067664-1067686 TACAGGTGCGCCACCACGCCTGG + Intergenic
1077664759 11:4097732-4097754 CAGATGTGTGCCACCACGCCTGG + Intronic
1078023921 11:7676663-7676685 TAGGTGTGAGCTACCACACACGG + Intronic
1078214328 11:9298621-9298643 TAGATGTGTGCCACCACGGCTGG - Intronic
1078260108 11:9698241-9698263 TAGTTGTGTGCCACCACGCCTGG + Intronic
1078685392 11:13525695-13525717 TGCATGTGTTCTACAACACATGG + Intergenic
1079029937 11:16979170-16979192 TACAGGCGCGCTACCACGCCTGG + Intronic
1079256515 11:18835664-18835686 CAGATGTGTGCCACCACGCCTGG + Intergenic
1079295300 11:19227942-19227964 TACAGGTGTGCTGCCATGCCCGG - Intronic
1079944008 11:26718591-26718613 TACATGTGCGCCACCATGCCTGG + Intronic
1080439769 11:32281574-32281596 CAGACGTGTGCTACCACGCCTGG - Intergenic
1080731759 11:34963417-34963439 TACAGGTGTGCCACCATGCCTGG + Intronic
1080757168 11:35212964-35212986 CAGATGTGTGCCACCACGCCCGG + Intronic
1080807473 11:35667508-35667530 TACAGGTGTGCCACCATGCCTGG + Intronic
1081034065 11:38119271-38119293 TAGATGTGTGCCACCATGCAAGG - Intergenic
1081542941 11:44049275-44049297 TAGGTGTGTGCCACCACGCCTGG - Intronic
1081876449 11:46411609-46411631 CAGATGTGTGCCACCACGCCCGG + Intronic
1082052283 11:47781080-47781102 TACATCTGTGCCACCACACCTGG - Intronic
1082069813 11:47930124-47930146 TAGGTGTGTGCTACCACCCCTGG + Intergenic
1083019178 11:59488822-59488844 CAGATGTGTGCCACCACGCCTGG - Intergenic
1083615281 11:64023135-64023157 TACAGGTGAGCCACCACGCCTGG + Intronic
1084119687 11:67061859-67061881 TACAGGTGTGTCACCACGCCTGG - Intronic
1084141803 11:67236271-67236293 TAGGTGTGTGCCACCACGCCTGG + Intronic
1084201951 11:67565379-67565401 CATATGTGTGCCACCACGCCTGG + Intergenic
1084290837 11:68165610-68165632 TACAGGTGTGCCACCATGCCTGG + Intronic
1084301110 11:68253299-68253321 TAGATGCCTGCTACCATGCACGG + Intergenic
1085307205 11:75493540-75493562 TACAGGCATGCTACCACGCCAGG + Intronic
1085487872 11:76883585-76883607 CAGGTGTGTGCTACCACGCTTGG + Intronic
1085542988 11:77289586-77289608 TAGATGTGCACTACCATGCATGG - Intronic
1085592051 11:77772449-77772471 CACATGTAAGCTACCACGCCTGG + Intronic
1085909643 11:80806740-80806762 TAGATGTGTGCTACCATGCCTGG - Intergenic
1086223675 11:84481526-84481548 TATATGTGTGATACTACGTATGG - Intronic
1086491990 11:87364790-87364812 TACATTTGTGCTACCACAATGGG - Intergenic
1087838952 11:102903091-102903113 TACAGGCGTGCCACCACGCAGGG - Intergenic
1088649345 11:111943640-111943662 TAGATGCGTGCCACCACGCCTGG + Intronic
1089056108 11:115586374-115586396 TAGTTGTGTGCCACCACGCCTGG + Intergenic
1089254214 11:117185733-117185755 CAGATGTGTGCCACCACGCCTGG - Intronic
1089270541 11:117298946-117298968 CAAGTGTGCGCTACCACGCAGGG + Intronic
1089425638 11:118372110-118372132 TAAATGTGTGCCACCATGCCCGG - Intronic
1089530434 11:119124829-119124851 TACAGGTGTGTCACCACGCCTGG - Intronic
1089734674 11:120541631-120541653 TACAGGTGTGCCATCACGCCTGG + Intronic
1089737514 11:120560189-120560211 TAGGTGTGTGCCACCACGCCCGG + Intronic
1090213605 11:124940959-124940981 TAAATGTATGCTGCCAGGCATGG + Intergenic
1090361169 11:126173675-126173697 TAGGTGTGTGCCACCACGCCTGG - Intergenic
1091064735 11:132499051-132499073 TCAAGGTGTGCTACCATGCACGG - Intronic
1091484944 12:877204-877226 TAGATATGTGCCACCACGCCCGG + Intronic
1092201471 12:6586577-6586599 TAGATGTGTGCTACCACACCTGG - Intronic
1092362967 12:7853457-7853479 TACAGGTGCGCCACCACGCCTGG - Intronic
1092394756 12:8115929-8115951 TAGGTGTGTGCTACCATGCCTGG + Intergenic
1092412177 12:8262160-8262182 TACAGGTGTGCCACCATGCCTGG - Intergenic
1092450929 12:8601263-8601285 CAGATGTGTGCTACCATGCCTGG + Intergenic
1092940564 12:13403619-13403641 CAGGTGTGTGCTACCACGCCTGG + Intergenic
1093247147 12:16753833-16753855 TTCAGGTGTGCTACCACACCTGG - Intergenic
1093420989 12:18974659-18974681 GGCACGTGTGCTACCACGCCTGG - Intergenic
1093454335 12:19349967-19349989 CAGGTGTGTGCTACCATGCATGG - Intronic
1093470219 12:19493256-19493278 CACGTGTGTGCTACCATGCCTGG - Intronic
1094015875 12:25863578-25863600 CAGGTGTGTGCCACCACGCATGG - Intergenic
1094062454 12:26328655-26328677 CAGATGTGTGCCACCACGCCTGG - Intergenic
1094371701 12:29745478-29745500 TACAGGTGTGCCACCATGCCTGG - Intronic
1094529197 12:31257503-31257525 TAGATGTGTGCCACCACGCCTGG + Intergenic
1094561781 12:31561344-31561366 TAGGTGTGTGCCACCACGCTTGG - Intronic
1095273907 12:40256304-40256326 TACAAGTGTGCCACCATGCCTGG - Intronic
1095420137 12:42016920-42016942 TACAGGTGCGCCACCACGCCTGG + Intergenic
1095469261 12:42519337-42519359 TAGATGTGTGCCACCATGCCCGG + Intronic
1096087881 12:48878400-48878422 CAGGTGTGTGCTACCACGCCCGG + Intergenic
1096128650 12:49139470-49139492 CAGATATGTGCTACCACGCCTGG + Intergenic
1096221560 12:49832201-49832223 TAGATGTGAGCTACCATGCCTGG + Intergenic
1096247280 12:49998754-49998776 CAGATGTGTGCCACCACGCCCGG - Intronic
1097522554 12:60687791-60687813 TACAGGTGTGTTACCATGCCTGG - Intergenic
1097870149 12:64595208-64595230 TAGTTGTGTGCCACCACGCCAGG + Intergenic
1098035060 12:66293243-66293265 TAGGTGTGTGCCACCACGCCTGG + Intergenic
1098269115 12:68753001-68753023 TAGGTGTGTGCCACCACGCCTGG - Intronic
1098538680 12:71625547-71625569 CACATGCGTGCTACCATGCCTGG - Intronic
1098690579 12:73482363-73482385 TAACTGTGTGCCACCATGCACGG + Intergenic
1099458120 12:82889132-82889154 CAGATGTGTGCCACCACGCCTGG - Intronic
1100310872 12:93393378-93393400 TAGATGTGAGCCACCACGCCCGG + Intronic
1100319674 12:93478522-93478544 CAGATGTGAGCTACCACGCCTGG + Intronic
1100321938 12:93503521-93503543 CACATGTGTGCTACCATGCCTGG + Exonic
1100385155 12:94099291-94099313 CAGGTGTGTGCTACCACGCCTGG - Intergenic
1100525635 12:95416842-95416864 CAGATGTGTGCCACCACGCCTGG - Intergenic
1100536569 12:95516249-95516271 TAGATGCATGCTACCACGCCTGG + Intergenic
1100850912 12:98710014-98710036 TACATGTGTGCTACCACGCATGG + Intronic
1101042044 12:100765651-100765673 CAGATGTGAGCTACCACGCCTGG + Intronic
1101767152 12:107712285-107712307 TGCATGGTTGCTGCCACGCATGG - Exonic
1102097956 12:110255428-110255450 CAGATGTGTGCTACCATGCTCGG + Intergenic
1102147246 12:110663457-110663479 TACAGGTGTGCTACCATGCCTGG - Intronic
1102236094 12:111295638-111295660 CACATGTGAGCCACCACGCCTGG - Intronic
1102266415 12:111490063-111490085 TACACGTGTGCCATCACGCCTGG - Intronic
1102298028 12:111752080-111752102 TAAATGTGTGCCACCACACCTGG - Intronic
1103095260 12:118127217-118127239 TACAGGTGTGCCACCACACCTGG + Intronic
1103762399 12:123260633-123260655 TAGGTGTGAGCTACCACGCCTGG - Intergenic
1103809939 12:123605298-123605320 TAGATGTGAGCCACCACGCCTGG + Intronic
1103819407 12:123685559-123685581 TAGGTGTGTGCCACCACGCCTGG + Intronic
1103862055 12:124023413-124023435 TAGATGTGAGCCACCACGCCTGG + Intronic
1104701761 12:130910050-130910072 CAGATGTGTGCCACCACGCCTGG + Intergenic
1104796148 12:131520718-131520740 CAGATGTGTGCCACCACGCCAGG - Intergenic
1104852261 12:131882672-131882694 TAGATGTGAGCTACCACACCTGG - Intergenic
1105436666 13:20384854-20384876 TAGGTGTGTACCACCACGCATGG + Intergenic
1105504751 13:20999883-20999905 TAGGTGTGTGCCACCACGCCTGG - Intronic
1105754995 13:23455858-23455880 TACAGGTGTGCCACCACACCTGG + Intergenic
1106149530 13:27085321-27085343 CAGATGTGTGCCACCACGCCTGG + Intronic
1106334773 13:28774242-28774264 CACATGTGTGCCACCACGCCTGG + Intergenic
1106809619 13:33347376-33347398 CACATGTGTGCCACCACACCTGG + Intronic
1106866363 13:33968401-33968423 TACAGGTGTGCCACCACGCCTGG + Intergenic
1107291828 13:38863325-38863347 CAGATGTGAGCCACCACGCATGG + Intronic
1107601090 13:42013195-42013217 CACGTGTGTGCCACCACGCCTGG + Intergenic
1107829222 13:44359592-44359614 CAGATGTGTGCCACCACGCCTGG - Intergenic
1108035254 13:46284585-46284607 TAGATGTGAGCCACCACGCCTGG - Intergenic
1108382343 13:49866439-49866461 TAAATGTGTGCCACCACACCTGG - Intergenic
1109160313 13:58964849-58964871 CAGATGTGTGCCACCACGCCCGG - Intergenic
1109211044 13:59536568-59536590 CAGGTGTGTGCTACCACGCCTGG + Intergenic
1109494700 13:63153634-63153656 CAGGTGTGTGCTACCACGCCTGG - Intergenic
1109495808 13:63170317-63170339 TACAGGCATGCCACCACGCAAGG - Intergenic
1110406971 13:75161848-75161870 TACATGCATGATACCACGTATGG - Intergenic
1111544933 13:89719968-89719990 TACATGTGTGCTACCACAGCCGG + Intergenic
1111738572 13:92173826-92173848 TAGGTGTGTGCTACCAAGCCTGG - Intronic
1112285695 13:98102604-98102626 CAGATGTGTGCCACCACGCCTGG + Intergenic
1112390689 13:98981332-98981354 TAGATGTGAGCTACCATGCCTGG + Intronic
1112419160 13:99231686-99231708 TAGATGTGAGCCACCACGCCTGG + Intronic
1112757338 13:102652232-102652254 TAAGTGTGTGCTACCACGCCTGG - Intronic
1113026248 13:105944513-105944535 TTAATGTGTGCTACTACCCATGG + Intergenic
1113171718 13:107512249-107512271 TAGGTGTGTGCTACCTCGCCTGG - Intronic
1113479604 13:110610821-110610843 CAGGTGTGTGCTACCACGCCCGG - Intergenic
1114042564 14:18692622-18692644 TACAGGTGTGCCACCACACCCGG + Intergenic
1114420703 14:22580275-22580297 TAGGTGTGTGCTACCACACCTGG - Intronic
1114443395 14:22769061-22769083 TACAGGTGTGCCACCACACCTGG + Intronic
1114448739 14:22810319-22810341 TACAGATGTGCTACCATGCCCGG - Intronic
1115137513 14:30128642-30128664 CAGATGTGTGCCACCACGCCCGG + Intronic
1115612114 14:35058731-35058753 CAGGTGTGTGCCACCACGCATGG - Intronic
1115715545 14:36099092-36099114 TAGATGTGAGCCACCACGCCTGG - Intergenic
1115820697 14:37209842-37209864 TACAAGTGTGCCACCACACCTGG + Intronic
1116011941 14:39361579-39361601 CAGATGTGTGCCACCACGCCTGG + Intronic
1116729129 14:48599426-48599448 CAGATGTGAGCTACCACGCCTGG + Intergenic
1116815579 14:49580728-49580750 TACAGGTCTGCCACCACGCCTGG - Intronic
1117673003 14:58126943-58126965 TAGGTGTGTGCTACCATGCCTGG + Intronic
1118210619 14:63762710-63762732 CAGATGTGAGCTACCATGCATGG + Intergenic
1118642988 14:67809697-67809719 CAGATGTGAGCTACCACGCCTGG + Intronic
1118649729 14:67877803-67877825 TAGACGTGTGCTACCACGCCTGG + Intronic
1120363734 14:83539922-83539944 TGCATGTGAGCCACCACGCCAGG + Intergenic
1120719808 14:87878625-87878647 TAGGTGTGTGCCACCACGCCTGG + Intronic
1121058654 14:90882938-90882960 TAGGTGTGTGCCACCACGCCTGG + Intronic
1121473009 14:94171072-94171094 CAGGTGTGTGCTACCACGCTCGG + Intronic
1121755237 14:96396952-96396974 TAGGTGTGTGCCACCACGCCTGG - Intronic
1122909073 14:104817723-104817745 TACATGTGAGCCACCACACCTGG - Intergenic
1123471364 15:20556239-20556261 TAGGTGTGTGCCACCACGCCTGG + Intergenic
1123646639 15:22444129-22444151 TAGGTGTGTGCCACCACGCCTGG - Intergenic
1123678107 15:22733186-22733208 TAGACATGTGCTACCACGCCTGG + Intergenic
1123731665 15:23151234-23151256 TAGGTGTGTGCCACCACGCCTGG + Intergenic
1123749803 15:23348617-23348639 TAGGTGTGTGCCACCACGCCTGG + Intergenic
1124282173 15:28372512-28372534 TAGGTGTGTGCCACCACGCCTGG + Intergenic
1124300528 15:28539106-28539128 TAGGTGTGTGCCACCACGCCTGG - Intergenic
1124330304 15:28807451-28807473 TAGACATGTGCTACCACGCCTGG + Intergenic
1124475971 15:30034873-30034895 TACAGGTGTGCCACCACACCTGG - Intergenic
1124914691 15:33958446-33958468 CAGATGTGTGCTACCATGCCTGG - Intronic
1124921193 15:34028419-34028441 TAGATGTGTGCCACCATGCTTGG - Intronic
1124929756 15:34108103-34108125 CAGATGTGTGCCACCACGCCTGG + Exonic
1125130790 15:36281602-36281624 CAGATGTGTGCTACCATGCCTGG + Intergenic
1125517969 15:40333423-40333445 TACAGGTGTGCCACCACACCTGG - Intronic
1125518281 15:40334940-40334962 CACATGTGTGTTTTCACGCACGG - Exonic
1125876571 15:43152535-43152557 CAGATGTGTGCCACCACGCCTGG + Intronic
1125962234 15:43841161-43841183 TAGGTGTGTGCTACCACGCCTGG + Intronic
1126649272 15:50905637-50905659 TACAGGTGTGCCACCATGCCCGG + Intergenic
1126652764 15:50942057-50942079 TAGGTGTGTGCCACCACGCGTGG + Intronic
1126970874 15:54110135-54110157 TAGGTGTGTGCTACCAGGCCTGG - Intronic
1127246912 15:57187036-57187058 CAGATGTGTGCCACCACGCCTGG - Intronic
1127530093 15:59835253-59835275 TAGGTGTGTGCCACCACGCCTGG - Intergenic
1128116334 15:65109012-65109034 CAGATGTGTGCCACCACGCCTGG - Intronic
1128205963 15:65852267-65852289 TACAAGTGTGCCATCACGCCTGG + Intronic
1128337055 15:66793662-66793684 TAGATGTGAGCCACCACGCCCGG - Intergenic
1128504970 15:68261797-68261819 CAGATGTGTGCTACCACGTCTGG + Intergenic
1129819162 15:78585058-78585080 TACAGGTGTGCCACCATGCCCGG + Intronic
1130240549 15:82184312-82184334 TAAATGTGTGCTACCGGTCATGG - Intronic
1130352151 15:83102198-83102220 TAGATGTGTGCCACCACACCTGG + Intergenic
1130802912 15:87284977-87284999 TAGGTGTGGGCTACCACGCCAGG - Intergenic
1130980099 15:88806490-88806512 TACTTGTGTACCACCACGCCCGG + Intronic
1131044131 15:89298890-89298912 CAGATGTGAGCTACCACGCCCGG - Intronic
1131218315 15:90558892-90558914 CAGACGTGTGCTACCACGCCCGG + Intronic
1131262725 15:90896227-90896249 TAGGTGTGTGCCACCACGCCTGG - Intergenic
1131267813 15:90928182-90928204 CAGATGTGTGCCACCACGCCCGG - Intergenic
1131733898 15:95311878-95311900 TACAGGCGTGCTACCACACCCGG + Intergenic
1131786921 15:95923291-95923313 TACATGCGCGCCACCACGCCCGG - Intergenic
1133072468 16:3255545-3255567 CAGGTGTGTGCTACCACGCCTGG + Intronic
1133161386 16:3914355-3914377 TACATGTGGACCACCACGCCCGG + Intergenic
1133186598 16:4103685-4103707 CAGATGTGTGCCACCACGCCCGG - Intronic
1133585478 16:7190216-7190238 TACAGGTGTGCCACCATGCCTGG - Intronic
1133634570 16:7653357-7653379 TAGAAGTGTGCTACCACACCTGG - Intronic
1133961299 16:10495767-10495789 CAGATGTGTGCCACCACGCCTGG - Intergenic
1134114396 16:11537224-11537246 TAGGTGTGTGCCACCACGCCTGG - Intergenic
1134127718 16:11627872-11627894 CAGATGTGTGGTACCACGCCCGG - Intronic
1134155310 16:11838302-11838324 TAGGTGTGTGCCACCACGCCCGG + Intronic
1134165610 16:11926974-11926996 CAGATGTGTGCCACCACGCCTGG - Intergenic
1134489700 16:14687470-14687492 CAGATGTGTGCCACCACGCCTGG + Intronic
1134495083 16:14726590-14726612 CAGATGTGTGCCACCACGCCTGG + Intronic
1134500467 16:14765710-14765732 CAGATGTGTGCCACCACGCCTGG + Intronic
1134527007 16:14952323-14952345 CAGATGTGTGCCACCACGCCTGG + Intergenic
1134538413 16:15045154-15045176 TACAGGTGTGCCACCATGCCCGG - Intronic
1134545397 16:15104027-15104049 CAGATGTGTGCCACCACGCCTGG - Intronic
1134580114 16:15363340-15363362 CAGATGTGTGCCACCACGCCTGG - Intergenic
1134714594 16:16350856-16350878 CAGATGTGTGCCACCACGCCTGG + Intergenic
1134722469 16:16394220-16394242 CAGATGTGTGCCACCACGCCTGG + Intergenic
1134823275 16:17263849-17263871 CAGGTGTGTGCTACCACGCCCGG + Intronic
1134845272 16:17434723-17434745 CAGATGTGTGCTACCACACCTGG - Intronic
1134914448 16:18058265-18058287 TAGGTGTGTGCCACCACGCCTGG + Intergenic
1134944958 16:18317649-18317671 CAGATGTGTGCCACCACGCCTGG - Intergenic
1134952222 16:18357802-18357824 CAGATGTGTGCCACCACGCCTGG - Intergenic
1135144093 16:19946607-19946629 TAGGTGTGTGCTACTACACAAGG + Intergenic
1135255399 16:20937799-20937821 TACAGATGAGCTACCACGCCTGG + Intronic
1135299011 16:21309291-21309313 CAGATGTGTGCTACCATGCCTGG + Intergenic
1135310564 16:21401865-21401887 CAGATGTGTGCCACCACGCCTGG - Intergenic
1135338797 16:21629034-21629056 TAGATGTGTGCCACCACACCCGG + Intronic
1135856060 16:26011415-26011437 CAGATGTGTGCCACCACGCCTGG - Intronic
1135944347 16:26852748-26852770 CAGGTGTGTGCTACCACGCCTGG + Intergenic
1135946951 16:26873604-26873626 CAGATGTGAGCTACCACACATGG + Intergenic
1136119593 16:28123381-28123403 TACAGGTGAGCCACCACGCCTGG + Intronic
1136150146 16:28342216-28342238 CAGATGTGTGCCACCACGCCTGG - Intergenic
1136166382 16:28456031-28456053 TGTATGTGTGCCACCACGCCTGG - Intergenic
1136196591 16:28659001-28659023 TGTATGTGTGCCACCACGCCTGG + Intergenic
1136212931 16:28773126-28773148 TGTATGTGTGCCACCACGCCTGG + Intergenic
1136257658 16:29053041-29053063 CAGATGTGTGCCACCACGCCTGG + Intergenic
1136307310 16:29381027-29381049 CAGATGTGTGCCACCACGCCTGG - Intergenic
1136320835 16:29483270-29483292 CAGATGTGTGCCACCACGCCTGG - Intergenic
1136358917 16:29765157-29765179 CAGGTGTGTGCTACCACGCCCGG + Intergenic
1136371390 16:29838684-29838706 TACAGGTGTGCCACCATGCCTGG - Intronic
1136435408 16:30222610-30222632 CAGATGTGTGCCACCACGCCTGG - Intergenic
1136637702 16:31536296-31536318 CAGATGTGAGCTACCATGCACGG - Intergenic
1137250993 16:46740827-46740849 CAGATGTGAGCTACCACGCCCGG + Intronic
1137274041 16:46921879-46921901 TAGGTGTGTGCCACCACGCCTGG - Intronic
1137585039 16:49659227-49659249 TACAGGTGTGCCACCACTCCTGG + Intronic
1137662481 16:50220669-50220691 CATATGTGTGCCACCACGCTGGG + Intronic
1137970216 16:52977243-52977265 TAGATGTGAGCTACCACGCCTGG - Intergenic
1138421035 16:56899344-56899366 CAGATGTGTGCCACCACGCATGG - Intronic
1138517914 16:57547888-57547910 TACACGTGTGCCAACACGCCTGG + Intronic
1138631256 16:58295811-58295833 TAGGTGTGTGCCACCACGCCTGG - Intronic
1139328285 16:66168428-66168450 CAGGTGTGTGCCACCACGCATGG - Intergenic
1139400426 16:66677093-66677115 TACAGGTGTGCTACCACGCCTGG - Intronic
1139409525 16:66748133-66748155 TAGATGTGTGCCACCACACCTGG - Intronic
1139533674 16:67558070-67558092 TACAGGTGTGCCACCACGCCTGG + Intergenic
1139586671 16:67908410-67908432 CAGATGTGTGCCACCACGCCTGG + Intronic
1139732989 16:68963262-68963284 CAGATGTGGGCTACCACGCCTGG + Intronic
1139733256 16:68966088-68966110 TAGGTGTGTGCCACCACACATGG - Intronic
1139919160 16:70448209-70448231 TAGGTGTGTGCAACCACACAGGG - Intergenic
1140086985 16:71805876-71805898 CAGGCGTGTGCTACCACGCAGGG - Intronic
1140231478 16:73120795-73120817 CAGGTGTGTGCTACCACGCCCGG + Intergenic
1140367359 16:74392381-74392403 CAGATGTGTGCCACCACGCCTGG + Intergenic
1140503171 16:75452408-75452430 CAGATGTGTGCTACCACGCCTGG + Intronic
1140832726 16:78766317-78766339 TACAAGTGTGCTACCATGCCCGG - Intronic
1140840959 16:78838698-78838720 CAGGTGTGTGCTACCACGCCCGG - Intronic
1141583284 16:85015376-85015398 CAGATGTGAGCCACCACGCACGG + Intergenic
1141596938 16:85103042-85103064 CAGATGTGTGCCACCACGCCTGG + Intronic
1142404157 16:89877410-89877432 TAGATGTGAGCTACCATGCCTGG + Intronic
1142417750 16:89952273-89952295 TAGGTGTGAGCTACCACGCCCGG + Intronic
1142654154 17:1379340-1379362 TAGGTGTGTGCCACCACGCCCGG - Intronic
1142750543 17:1984822-1984844 CAGGTGTGTGCTACCACGCCCGG - Intronic
1142776805 17:2146841-2146863 CACGTGTGAGCCACCACGCATGG + Intronic
1142784902 17:2213523-2213545 AACATGTGTGCTACAGCCCATGG - Intronic
1142992944 17:3743843-3743865 CAGGTGTGTGCTACCACGCCTGG + Intronic
1143080217 17:4376034-4376056 TACAGGTGTGCCACCATGCCAGG - Intergenic
1143134051 17:4700782-4700804 TACAGGTGTGCCACCACCCCTGG - Intronic
1143138940 17:4729605-4729627 TAGATGTGTGCTACCACATCTGG - Intergenic
1143145626 17:4773308-4773330 TAGATGTGAGCCACCACGCCTGG + Intronic
1143534655 17:7530089-7530111 TACAGGTGCGCCACCACGCCTGG - Intergenic
1143588187 17:7862594-7862616 TAGGTGTGTGCCACCACGCCCGG - Intronic
1143683902 17:8498261-8498283 TAGGTGTGAGCTACCACGCCCGG + Intronic
1144199921 17:12931347-12931369 CAGGTGTGTGCTACCACGCCCGG + Intronic
1144222078 17:13108629-13108651 CACGTGTGTGCTACCACATATGG + Intergenic
1145045968 17:19616316-19616338 TAGATGTGAGCCACCACGCCTGG + Intergenic
1145082572 17:19907294-19907316 TAGACGTGAGCTACCACGCCCGG + Intronic
1145188294 17:20815365-20815387 TACATGTGTGCCACCATGCCTGG + Intergenic
1145819767 17:27823248-27823270 TACAGGCGTGCCACCACGCCTGG + Intronic
1146261117 17:31421836-31421858 TAGATGTGAGCCACCACGCCCGG + Intronic
1146531449 17:33610752-33610774 TACAGGTGTACCACCACGCCTGG - Intronic
1146813472 17:35923206-35923228 CACATGTGTGCCACCACACCCGG - Intronic
1146845050 17:36177174-36177196 TTCATCTGTCCTTCCACGCAGGG + Intronic
1146873271 17:36389019-36389041 TTCATCTGTCCTTCCACGCAGGG + Intronic
1146880624 17:36440105-36440127 TTCATCTGTCCTTCCACGCAGGG + Intergenic
1146897941 17:36559020-36559042 TAGGTGTGAGCAACCACGCAAGG - Intronic
1146899404 17:36572544-36572566 CAGGTGTGTGCCACCACGCATGG - Intronic
1147668023 17:42161067-42161089 TAGGTGTGTGCCACCACGCCCGG + Intronic
1147706203 17:42426488-42426510 TACAGGTGTGCCACCACACCGGG + Intergenic
1147846843 17:43410498-43410520 CACATGTGAGCTACCACGCCCGG + Intergenic
1147868496 17:43570442-43570464 TAGTTGTGTGCCACCACGCCTGG + Intronic
1147928805 17:43963363-43963385 CAGGTGTGTGCTACCACGCCTGG - Intronic
1147993160 17:44347429-44347451 CAGGTGTGCGCTACCACGCATGG + Intronic
1148229952 17:45926066-45926088 CAGATGTGTGCCACCACACATGG - Intronic
1148292929 17:46472315-46472337 CAGATGCGTGCTACCACGCCTGG - Intergenic
1148315113 17:46690012-46690034 CAGATGCGTGCTACCACGCCTGG - Intronic
1148381270 17:47200016-47200038 TAGATGTGAGCCACCACGCCTGG + Intergenic
1148761827 17:50007404-50007426 CAGATGTGAGCCACCACGCATGG - Intergenic
1148971368 17:51485478-51485500 TACATGTGAGCCACCACACCTGG + Intergenic
1149148735 17:53532820-53532842 TATATTTGTGCTACCAACCATGG + Intergenic
1149499365 17:57140023-57140045 TATATGTGTGTCACCACGCCCGG + Intergenic
1149710049 17:58733156-58733178 TAGGCGTGTGCTACCACGCCTGG + Intronic
1149848195 17:60019660-60019682 TTCATCTGTCCTTCCACGCAGGG + Intergenic
1149853792 17:60060418-60060440 TACATGTGTGCCACCACACCTGG + Intronic
1149861974 17:60126864-60126886 TTCATCTGTCCTTCCACGCAGGG - Intergenic
1149913300 17:60585770-60585792 CAAGTGTGTGCTACCACGCCCGG + Intronic
1149917020 17:60619741-60619763 CAGATGTGTGCTACCATGCCCGG + Intronic
1150086547 17:62276239-62276261 TTCATCTGTCCTTCCACGCAGGG + Intronic
1150112480 17:62514284-62514306 TAGGTGTGTGCTACCATGCCTGG + Intronic
1150312454 17:64140137-64140159 TATATGTGAGCCACCACGCCTGG + Intergenic
1150635942 17:66913378-66913400 TACAGGCGTGCTACCACGCCTGG - Intergenic
1151286902 17:73118749-73118771 CACGTGTGTGCCACCACGCCCGG - Intergenic
1151324524 17:73370696-73370718 TACATGAGTGCTACCACACCTGG + Intronic
1151704893 17:75762174-75762196 TACAGGTGTGCCACCATGCCCGG - Intronic
1152346923 17:79758398-79758420 CAGATGTGTGCCACCACACATGG - Intergenic
1152998409 18:430191-430213 TACAGGTGCGCCACCACGCCTGG - Intronic
1153165823 18:2261230-2261252 TACAGGTGTGCCACCACACCTGG + Intergenic
1153195655 18:2593195-2593217 CAGATGTGTGCCACCACGCCTGG + Intronic
1153374223 18:4357294-4357316 TAGGTGTGTGCCACCACGCCTGG + Intronic
1153850803 18:9092411-9092433 TAGATGTGTGCCACCACACCTGG + Intergenic
1154116864 18:11618986-11619008 CAGATGTGTGCCACCACGCCTGG - Intergenic
1154130911 18:11736250-11736272 TAGGTGTGTGCCACCATGCATGG - Intronic
1154254812 18:12773276-12773298 CAGATGTGAGCTACCACGCCTGG + Intergenic
1155058894 18:22211101-22211123 TAGGCGTGTGCTACCACGCCTGG + Intergenic
1157014422 18:43693882-43693904 CAGGTGTGAGCTACCACGCATGG - Intergenic
1157263303 18:46194941-46194963 CAGGTGTGTGCTACCACGCCTGG + Intronic
1157633074 18:49119934-49119956 CAGATGTGTGCCACCACGCCTGG - Intronic
1157638906 18:49192069-49192091 TACATATGTGCCACCATGCCTGG + Intronic
1157793674 18:50556597-50556619 TAGATGTGCGCCACCACGCCTGG + Intergenic
1157888332 18:51390096-51390118 CAGATGTGAGCTTCCACGCATGG + Intergenic
1158414300 18:57235854-57235876 TAGATGTGTGCTGCCACACCTGG + Intergenic
1158484237 18:57850693-57850715 CAGGCGTGTGCTACCACGCATGG + Intergenic
1158854059 18:61524776-61524798 CACGTGTGTGCCACCACGCCTGG - Intronic
1158940789 18:62404660-62404682 CAGGTGTGTGCCACCACGCATGG + Intergenic
1160760988 19:784329-784351 TACATGTGCGCCACCACACCTGG - Intergenic
1161239254 19:3212897-3212919 TACAGGTGTGACACCACGCCCGG + Intergenic
1161705904 19:5821443-5821465 TACAGGTGTGCCACCACGCCCGG + Intergenic
1161764911 19:6201891-6201913 TACAGGTGTGCCACCATGCCTGG - Intergenic
1162365524 19:10246635-10246657 CACGTGTGTGCTACCACACCTGG - Intergenic
1162466456 19:10844260-10844282 TACACGTGTGCCACCATGCCTGG - Intronic
1162704279 19:12543531-12543553 TACAGGTGTGCCACCATGCCTGG - Intronic
1162886005 19:13697643-13697665 CAGGTGTGTGCTACCACGCCTGG - Intergenic
1162949649 19:14063062-14063084 TACAGGTGTGCCACCACACCTGG - Intergenic
1163161444 19:15466913-15466935 CAGATGTGTGCCACCACGCTTGG + Intergenic
1163310686 19:16512724-16512746 TACAGGTGCGCCACCACGCCTGG - Intronic
1163379947 19:16959315-16959337 TGCAGGTGTGCCACCACGCCCGG + Intronic
1163576208 19:18112300-18112322 TACAGGCGTGCCACCACGCCCGG + Intronic
1163639797 19:18455566-18455588 CACATGTGAGCCACCATGCAAGG - Intronic
1163645309 19:18485841-18485863 TAGGCGTGTGCTACCACGCCCGG - Intronic
1163731663 19:18953224-18953246 CAGATGTGTGCCACCACGCCCGG - Intergenic
1163751503 19:19080966-19080988 TACATGTGTACCACCATGCCTGG - Intronic
1164293059 19:23884798-23884820 TAGGTGTGTGCTACCACACCTGG + Intergenic
1164321778 19:24154706-24154728 TAGGTGTGTGCCACCACGCCTGG + Intergenic
1164641043 19:29825896-29825918 CAGATGTGTGCCACCACGCCTGG - Intergenic
1164727058 19:30473061-30473083 TAGGTGTGTGCCACCACGCCCGG - Intronic
1164744861 19:30603945-30603967 TAAATGTGTGCCACCACGCCTGG - Intronic
1165024554 19:32950130-32950152 TAGGTGTGAGCCACCACGCAAGG + Intronic
1165036691 19:33038798-33038820 CAGATGTGTGCCACCACGCGTGG + Intronic
1165071593 19:33258788-33258810 CAGGTGTGTGCCACCACGCACGG + Intergenic
1165352181 19:35281738-35281760 CAGATGTGTGCCACCACGCCTGG + Intronic
1165378452 19:35460541-35460563 TAGGTGTGTGCCACCACGCCTGG - Intergenic
1165416596 19:35697921-35697943 CACATGTGAGCTACCACGACCGG + Intergenic
1165446534 19:35859900-35859922 CAAGTGTGTGCTACCACGCCCGG - Intronic
1165482695 19:36074153-36074175 CACGTGTGTGCTACCATGCCTGG - Intronic
1165637150 19:37350250-37350272 TACATGCATGCCACCACGCCCGG + Intronic
1165883977 19:39063985-39064007 CACATGTGAGCCACCACGCCTGG - Intergenic
1165989522 19:39801447-39801469 TACACGTGTGCCACCATGCCTGG + Intergenic
1166243263 19:41508629-41508651 CAGATGTGAGCCACCACGCATGG - Intergenic
1166362115 19:42257054-42257076 TACAGGTGCGCCACCACGCCTGG - Intergenic
1166376238 19:42328791-42328813 CAGATGTGCGCCACCACGCAGGG - Intronic
1166500320 19:43336069-43336091 TAGGTGTGTGCCACCACGCCTGG - Intergenic
1166766612 19:45254921-45254943 TAGGTGTGAGCTACCACGCTGGG - Intronic
1166991465 19:46695340-46695362 TATAGGTGTGCCACCACGCCTGG - Intronic
1167232419 19:48293365-48293387 CAGATGTGTGCCACCACGCCCGG - Intergenic
1167283436 19:48584906-48584928 TAGAAGTGTGCCACCACGCCTGG - Intronic
1167316574 19:48766814-48766836 TAGGTGTGAGCTACCACGCTTGG + Intergenic
1167335011 19:48879703-48879725 TATGCGTGCGCTACCACGCAGGG + Intergenic
1167459733 19:49618528-49618550 TAGATGTGTGCCACCATGCCCGG + Intronic
1167710958 19:51110436-51110458 TACAGGTGCGCTACCACACCTGG + Intergenic
1168001647 19:53451351-53451373 CAGATGTGTGCCACCACGCCTGG + Intronic
1168001973 19:53454112-53454134 TAGATGTGGGCCACCACGCCTGG + Intronic
1168081110 19:54011255-54011277 CACACGTGCGCTACCACGCCTGG - Intronic
1168427239 19:56248708-56248730 TACGTGTGAGCCACCACGCCTGG + Intronic
1168518529 19:57029767-57029789 TAGGTGTGAGCTACCACGCCTGG - Intergenic
1168674136 19:58264547-58264569 CACATGTGTGCCACCACACCCGG - Intronic
1202696471 1_KI270712v1_random:130408-130430 CAGGTGTGTGCTACCACGCCTGG - Intergenic
1202697870 1_KI270712v1_random:138223-138245 CAGGTGTGTGCTACCACGCCTGG + Intergenic
926017299 2:9465299-9465321 TACGTGTGTGCTACCGTGCCTGG - Intronic
926124975 2:10266451-10266473 TACATGTGTACAGCCAGGCACGG + Intergenic
926192712 2:10740827-10740849 TAGATGTGTGCCACCAGGCCCGG + Intronic
926239637 2:11075006-11075028 TACAGGTGTGCTATCACACCTGG - Intergenic
926251704 2:11158678-11158700 TACATGTGTGCCACTACACCTGG - Intronic
926281509 2:11451493-11451515 GCCATGTGTGCCACCACGCCTGG + Intronic
927623766 2:24690507-24690529 TAGGTGTGTGCCACCACGCTGGG - Intronic
927655201 2:24939388-24939410 TACACGTGTGCCACCATGCCTGG + Intergenic
928032131 2:27789539-27789561 TAGATGTGTGCCACCACACCTGG + Intronic
928207417 2:29295981-29296003 CACATGAGTGCTGCCATGCAGGG + Intronic
928418399 2:31116765-31116787 TAGGTGTGAGCTACCACGCCTGG - Intronic
928507805 2:31971825-31971847 TAGGTGTGTGCCACCACGCCTGG - Intronic
928740896 2:34351319-34351341 TAGGTGTGTGCCACCACGCCTGG + Intergenic
928764313 2:34624257-34624279 CAGATGTGTGCCACCACGCCAGG - Intergenic
928993405 2:37260020-37260042 CAGATGTGTGCCACCACGCCTGG - Intronic
929008001 2:37414112-37414134 TACATGTGAGCCACCACACCTGG - Intergenic
929126991 2:38531273-38531295 CAGATGTGAGCTACCACGCCTGG - Intergenic
929169192 2:38914522-38914544 TAGGTGTGTGCCACCACGCCTGG - Intronic
929184189 2:39076255-39076277 CAGATGTGTGCTACCATGCCTGG - Intronic
929513578 2:42585615-42585637 CAGATGTGTGCCACCACGCCTGG + Intronic
929637356 2:43537812-43537834 TAGGTGTGTGCTACCACTCCTGG - Intronic
929927613 2:46228780-46228802 TACAGGTGTGCCACCACACCTGG + Intergenic
930680540 2:54253068-54253090 TAGGTGTGTGCCACCACGCCTGG - Intronic
930684616 2:54294771-54294793 TAAATGTGTGCCACCACACCTGG - Intronic
930794201 2:55370496-55370518 TAGATGTGTGCTACCACACCTGG - Intronic
931273496 2:60723308-60723330 TAGGTGTGTGCCACCACGCCCGG + Intergenic
931362156 2:61586942-61586964 TACAGGTGTGCCACCATGCCCGG - Intergenic
931416459 2:62086022-62086044 TAGGTGTGTGCCACCACGCCTGG - Intronic
931423383 2:62148767-62148789 TAGGTGTGAGCTACCACGCCTGG + Intergenic
931431075 2:62209499-62209521 TACAAGTGTGCCACCACGCCTGG - Intronic
931781696 2:65584234-65584256 TAGGTGTGTGCCACCACGCCCGG + Intergenic
932523857 2:72443180-72443202 TACAGGTGCGCCACCACGCCTGG - Intronic
932671758 2:73743394-73743416 TACAGGTGCGCCACCACGCCAGG + Intergenic
932818554 2:74880542-74880564 TACGTGTGTGCTACCCCGGACGG + Exonic
933002099 2:76937707-76937729 TACAGGTGTGCCACCACACCGGG + Intronic
933309296 2:80639957-80639979 CAGATGTGTGCCACCACGCCTGG - Intronic
933929195 2:87131228-87131250 TAGGTGTGTGCCACCACGCCTGG + Intergenic
934000525 2:87707024-87707046 TAGGTGTGTGCCACCACGCCTGG + Intergenic
934277633 2:91587433-91587455 CAGGTGTGTGCTACCACGCCTGG - Intergenic
934279043 2:91595219-91595241 CAGGTGTGTGCTACCACGCCTGG + Intergenic
934778958 2:96956997-96957019 CACAGGTGTGCTATCACCCATGG + Intronic
934861733 2:97769262-97769284 TAGATGTGAGCTACCACACCTGG + Intronic
935076531 2:99750556-99750578 TACAGGTGTGCCACCATGCCTGG + Intronic
935274215 2:101462287-101462309 TACACGTGTGCCACCACACCTGG - Intronic
935703426 2:105834815-105834837 TAGATGTGTGCTACCATGTCTGG + Intronic
935754618 2:106267301-106267323 GAGATGTGTGCCACCACGCCCGG - Intergenic
935961008 2:108425452-108425474 CAGATGTGTGCCACCACGCCCGG - Intergenic
935986630 2:108679770-108679792 TAGGTGTGTGCTACCACACCTGG - Intronic
935993770 2:108746354-108746376 TAGGTGTGTGCCACCACGCCTGG + Intronic
936037895 2:109127706-109127728 TACAGGTGCGCCACCACGCCTGG - Intergenic
936129161 2:109819338-109819360 TAGGTGTGTGCCACCACGCCTGG + Intronic
936215536 2:110552147-110552169 TAGGTGTGTGCCACCACGCCTGG - Intronic
936424673 2:112406720-112406742 TAGGTGTGTGCCACCACGCCTGG - Intronic
936603044 2:113918660-113918682 TAGATGTGAGTTACCACGCCTGG + Intronic
937402704 2:121599005-121599027 TACGTGCGTGCCACCACGCCCGG + Intronic
937426033 2:121799617-121799639 TAGGTGTGTGCCACCACGCCCGG + Intergenic
937666930 2:124498577-124498599 CAGATGTGAGCTACCACGCTTGG + Intronic
937895665 2:126975120-126975142 TACAGGTGCGCCACCACGCCCGG - Intergenic
938223485 2:129593908-129593930 CAAGTGTGTGCTACCACGCTTGG - Intergenic
938896189 2:135752993-135753015 TACCTGTGAGCTACCACGCCCGG + Intronic
939674683 2:145057768-145057790 CACATGTGTATTACCATGCATGG + Intergenic
940956543 2:159734838-159734860 AAGATGTGTGCTACCATGCCTGG - Intronic
941892602 2:170597228-170597250 TACAGGTGTGCCACCATGCCCGG - Intronic
941937469 2:170996139-170996161 TAGATGTGTGCCACCACGCCTGG + Intronic
942122146 2:172788607-172788629 TACATGTGAGCCACCACGCTTGG - Intronic
942180114 2:173372288-173372310 TACAGGTGTGCCACCAGGCCTGG - Intergenic
942274991 2:174314580-174314602 TACAGGTGTGCCACCACGCCTGG + Intergenic
943599508 2:189898064-189898086 TACATGTGTGCTACCATGGGAGG - Intronic
943737170 2:191368829-191368851 CACGTGTGTGCCACCACGCGTGG - Intronic
944560334 2:200929652-200929674 TAGATGTGTGCCACCATGCCTGG - Intronic
944569802 2:201032797-201032819 TACACGTGTGCCACTACGCCTGG + Intronic
944672058 2:202003179-202003201 TTTATTTGTGCTACCACTCATGG + Intergenic
944789358 2:203108769-203108791 TACAAGTGTGCCACCACACCTGG - Intronic
944950223 2:204740152-204740174 TACAGGTGTGCTATCATGCCTGG + Intronic
945030577 2:205659659-205659681 TACATGTGTGCTAGAGTGCATGG + Intergenic
945228346 2:207556992-207557014 CAGGTGTGTGCTACCACGCCTGG - Intronic
945797844 2:214386719-214386741 TAGATGTGTGCAACCATGCCAGG - Intronic
945851521 2:215014036-215014058 CAAATGTGTGCTACCACACCCGG - Intronic
945907017 2:215605182-215605204 TAGGTGTGAGCTACCACGCCTGG - Intergenic
946493608 2:220173315-220173337 CAGATGTGTGCTACCGCGCCCGG + Intergenic
947177847 2:227385381-227385403 CAGATGTGTGCTACCATGCTTGG - Intergenic
947369261 2:229427930-229427952 TAGGTGTGTGCCACCACGCCTGG - Intronic
947723803 2:232384695-232384717 TACATGAGTGCTCACACCCAAGG + Intergenic
947728091 2:232412492-232412514 TACATGAGTGCTCACACCCACGG + Intergenic
947786626 2:232828130-232828152 CAGATGTGTGCTACCACACCTGG + Intronic
947809664 2:232996183-232996205 CAGATGTGTGCTACCACACCCGG - Intronic
948114556 2:235484817-235484839 TACAGGTGTGCCACCATGCCTGG - Intergenic
948362274 2:237430971-237430993 CAGTTGTGTGCTACCATGCATGG - Intergenic
948956626 2:241297903-241297925 CAGATGTGTGCCACCACGCCCGG - Intronic
1169043863 20:2520353-2520375 TAGATGTGAGGTACCACGCCTGG - Intronic
1169061674 20:2664905-2664927 TACAGGTGTGTCACCACGCCTGG - Intergenic
1169071538 20:2735451-2735473 AACATGTGTGCAACAACTCAAGG - Intronic
1169088682 20:2843287-2843309 TAGGTGTGTGCCACCACGCCCGG - Intronic
1169218897 20:3809450-3809472 TACAAGTGCGCCACCACACACGG - Intergenic
1169261913 20:4145467-4145489 TAGGTGTGTGCCACCACGCCTGG - Intronic
1169324489 20:4664325-4664347 CAGATGTGTGCCACCACGCCCGG - Intergenic
1169460731 20:5792560-5792582 CACGTGTGTGCCACCACGCCTGG + Intronic
1169578086 20:6988456-6988478 GAGGTGTGTGCTACCACTCATGG - Intergenic
1169603019 20:7283883-7283905 CAGATGTGTGCTACCACACCTGG + Intergenic
1169639613 20:7735809-7735831 TACAGGTGTGCCACCATGCCCGG - Intergenic
1170542396 20:17402518-17402540 TACAGGTGTGCCACCATGCCTGG - Intronic
1170815401 20:19709477-19709499 TAGGTGTGTGCCACCACGCTCGG - Intronic
1170849277 20:19989551-19989573 CAGATGTGAGCTACCACGCCTGG + Intronic
1171003444 20:21438751-21438773 CACATGTGTGCCACCACACCTGG - Intergenic
1172462061 20:35126633-35126655 TAGATGTGAGCCACCACGCCTGG - Intronic
1172922586 20:38497924-38497946 TAGGTGTGTGCCACCACGCCTGG - Intronic
1172990336 20:39031477-39031499 TAGATGTGTGCAATCACGCCTGG + Intronic
1173275399 20:41576406-41576428 CACATGTGAGCCACCACGCCTGG - Intronic
1173455293 20:43196744-43196766 TAGGTGTGTGCCACCACGCCTGG + Intergenic
1173653383 20:44682156-44682178 CACATGTGTGCTCACACACAGGG + Intergenic
1173798487 20:45879382-45879404 TACAGGTGCGCCACCACGCCTGG - Intergenic
1173990845 20:47302197-47302219 TACAGGCGTGCCACCACGCCTGG - Intronic
1174030228 20:47618092-47618114 TAGGTGTGTGCCACCACGCCTGG - Intronic
1174228969 20:49028276-49028298 TAGATGTGTGCCACCATGCCTGG - Intronic
1174459167 20:50670723-50670745 CACCTGTCTGCTGCCACGCAGGG - Intronic
1174485551 20:50859076-50859098 TACAGGTGTGCCACCATGCCCGG + Intronic
1174505032 20:51011935-51011957 TACAGGTGTGCCACCACACCTGG + Intronic
1175740421 20:61416142-61416164 CAGATGTGTGCTACCACACCTGG + Intronic
1175839362 20:62016998-62017020 TACAGGTGTGCCACCACGCCTGG - Intronic
1177681144 21:24373092-24373114 TAAGTGTGTGCTACCATGCCTGG + Intergenic
1177973164 21:27815387-27815409 CAGGTGTGTGCTACCACGCCAGG + Intergenic
1178262837 21:31116017-31116039 CAGATGTGTGCCACCACGCCTGG + Intergenic
1178800943 21:35794996-35795018 TACAGATGTGCCACCACGCCTGG + Intronic
1179028323 21:37698837-37698859 TATGTGTGTGCCACCACGCTTGG + Intronic
1179708579 21:43196464-43196486 CAGGTGTGTGCTACCACGCCCGG + Intergenic
1180289445 22:10783772-10783794 TATAGGTGTGCTACCATGCCCGG - Intergenic
1181179664 22:21058026-21058048 CAGATGTGTGCCACCACGCCCGG + Intronic
1181576634 22:23799418-23799440 TAGACGTGTGCCACCACGCCTGG + Intronic
1181645442 22:24228945-24228967 CCCATGTGTGCTACCATGCCCGG - Intronic
1181967151 22:26665096-26665118 CAGATGTGTGCCACCACGCCCGG - Intergenic
1182023867 22:27102167-27102189 TACAGGTGTGCCACCATGCCTGG - Intergenic
1182393506 22:30019062-30019084 TAGGTGTGTGCCACCACGCCCGG - Intronic
1182561711 22:31164859-31164881 TACAGGTGTGCCACCACACCCGG + Intronic
1182720321 22:32393075-32393097 TACAGGTGTGCCACCACACCCGG + Intronic
1183217212 22:36488722-36488744 TAGACATGTGCTACCACGCCTGG + Exonic
1183797924 22:40135640-40135662 TACAGGTGTGCCACCATGCCTGG + Intronic
1184111568 22:42398555-42398577 GGCATGTGTGCCACCACGCCCGG + Intronic
1184494762 22:44832367-44832389 CAGGTGTGTGCTACCACGCCTGG + Intronic
1184557762 22:45242215-45242237 CAAATGTGTGCTACCATGCCCGG - Intergenic
1185396848 22:50596419-50596441 TAGATGTGTGCCACCACACCTGG - Intronic
949387092 3:3514972-3514994 TAGATGTGAGCCACCACGCCTGG + Intergenic
949645750 3:6091791-6091813 CAGGTGTGTGCTACCACGCCTGG - Intergenic
950079539 3:10211282-10211304 TAGGTGTGTGCCACCACGCCTGG + Intronic
950353303 3:12379145-12379167 TACAGGCGTGCTACCACACCCGG + Intronic
951014526 3:17715659-17715681 TACAGGTGTGCTACCAGGCCTGG - Intronic
951472470 3:23071028-23071050 CAGATGTGTGCTACCACACCCGG - Intergenic
951674708 3:25224746-25224768 TACAGGTGTGCCACCACACCTGG + Intronic
951696549 3:25450941-25450963 TAAATGTGCGCCACCACGCCCGG - Intronic
951727887 3:25780759-25780781 TACAGGTGAGCCACCACGCCTGG + Intronic
952785731 3:37153116-37153138 TAGATGTGAGCCACCACGCCTGG - Intronic
952921609 3:38289035-38289057 TAGGTGTGTGCCACCATGCAGGG - Intronic
953183311 3:40616128-40616150 TACATGTGTGCGAGCAGGCCAGG - Intergenic
953527587 3:43706592-43706614 TACAGGTGTGCCACCATGCCTGG + Intronic
953691358 3:45122593-45122615 TACAGGTGTGCCACCACGCCTGG + Intronic
953935298 3:47036623-47036645 TAGATGTGAGCCACCACGCCCGG - Intronic
954049218 3:47959313-47959335 CAGGTGTGTGCTACCACGCTCGG - Intronic
954233570 3:49238045-49238067 TAGGTGTGTGCCACCACACACGG + Intronic
954352875 3:50059997-50060019 GAGATATGTGCTACCACGCCAGG - Intronic
954476734 3:50753480-50753502 TAAGTGTGTGCTACCATGCTTGG + Intronic
954560875 3:51555468-51555490 GACATGTGTGCCACCATGCCTGG - Intronic
954771670 3:52975742-52975764 CAGGTGTGTGCTACCACGCCCGG + Intronic
954866861 3:53737021-53737043 TACAGGTGAGCCACCACGCCTGG - Intronic
955071530 3:55576166-55576188 TACAGGTGTGCCACCATGCCTGG - Intronic
955279313 3:57579143-57579165 TACAGGTGTGCCACCATGCCCGG - Intronic
955351173 3:58194460-58194482 TAGGTGTGTGCCACCACGCCTGG + Intronic
955933633 3:64081613-64081635 TAGATGTGTGCCACCACACCTGG - Intergenic
956242310 3:67143645-67143667 TAGGTGTGTGTTACCACGCCTGG - Intergenic
956276806 3:67511029-67511051 TACAGGTGTGCCACCAAGCCTGG + Intronic
956280046 3:67546590-67546612 TAGGCGTGTGCTACCACGCCCGG - Intronic
957681988 3:83448988-83449010 TAGATGTGTGTCACCACGCTTGG + Intergenic
957770873 3:84691035-84691057 TAGGTGTGTGCCACCACGCCTGG - Intergenic
957935746 3:86939480-86939502 CAGATGCGTGCTACCACACAAGG - Exonic
958900605 3:99881673-99881695 TACATGTGTGCTACCACGCCTGG + Intronic
959928765 3:111955592-111955614 TAGGTGTGTGCTACCACACCTGG + Intronic
960081417 3:113544465-113544487 CAGGTGTGAGCTACCACGCAAGG + Intronic
960626320 3:119685546-119685568 TAGATGTGTGCCACCAGGCCTGG - Intergenic
960666937 3:120118459-120118481 CAGATGTGTGCCACCACGCCTGG - Intergenic
961889745 3:130120823-130120845 TACAGGTGTGCCACCATGCCCGG - Intergenic
961949338 3:130731852-130731874 TAGGTGTGTGCCACCACGCCTGG - Intronic
962541374 3:136385842-136385864 TAGATGTGTGCTACCACACCTGG + Intronic
962545990 3:136436096-136436118 TACAGGTGTGCCACCACACCCGG + Intronic
963146871 3:142003141-142003163 TACATGTGTGTCACCATGCTTGG + Intronic
963239577 3:142990135-142990157 TAGGTGTGTGCCACCACGCCTGG + Intronic
963619784 3:147591832-147591854 TATGTGTGTGCCACCACCCATGG - Intergenic
963881337 3:150532384-150532406 TAGATGTGTGCCACCATGCCGGG - Intergenic
964341675 3:155714814-155714836 TACATGTATGTTCCCAAGCAAGG + Intronic
965129307 3:164674555-164674577 CAGGTGTGTGCTACCACGCCTGG - Intergenic
965731382 3:171775698-171775720 CAGATGTGTGCCACCACGCCCGG - Intronic
965759695 3:172062452-172062474 CAGATGTGTGCTACCACGCCTGG + Intronic
966198295 3:177335466-177335488 TAGATGAGTGCCACCACGCTAGG - Intergenic
966423390 3:179756145-179756167 TACATGTGAGCCACCGCGCCTGG - Intronic
966580728 3:181559599-181559621 TACATCTGTGCCACCATGCCCGG + Intergenic
966659917 3:182402693-182402715 TAGGTGTGTGCCACCACGCCCGG - Intergenic
966717292 3:183026181-183026203 TACAGGCGTGCCACCACGCCCGG + Intronic
966817737 3:183903168-183903190 TACAGGTGTGCCACCATGCCTGG - Intergenic
967064793 3:185905247-185905269 TACCTGTGTGCCACAACGCCTGG + Intergenic
967282600 3:187836662-187836684 TACATGCGTGCCACCACACCTGG + Intergenic
967346125 3:188457764-188457786 TAGGTGTGTGCCACCACGCCTGG - Intronic
968019566 3:195372672-195372694 TACAGGTGTGCCACCATGCCTGG - Intronic
968259893 3:197312388-197312410 TAGATGTGAGCCACCACGCCCGG + Intergenic
968683095 4:1935330-1935352 CTCATGTGTGCTCCCATGCAGGG - Intronic
969033111 4:4228916-4228938 CAGGTGTGTGCTACCACGCCTGG + Intergenic
969541900 4:7796917-7796939 TACAGGTGTGCCACCACACCTGG - Intronic
969860844 4:10034267-10034289 TACATGAGCGCACCCACGCAAGG + Intronic
970245525 4:14058032-14058054 TACATGTGAGCCACCATGCCTGG - Intergenic
971825771 4:31620530-31620552 TAGGTGTGTGCTACCACACCTGG + Intergenic
971920002 4:32926353-32926375 CACATGTGTGCCACCACGCCTGG - Intergenic
972168378 4:36314537-36314559 TAAATGTGGGCCACCACGCCTGG - Intronic
972462913 4:39322804-39322826 TAGATGTGAGCTACCATGCCTGG - Intronic
972529451 4:39948598-39948620 CACGTGTGAGCTACCACGCCTGG + Intronic
972648305 4:40991123-40991145 CAGATGTGTGCCACTACGCATGG + Intronic
973036189 4:45410489-45410511 CAGATGTGTGCTACCATGCCTGG + Intergenic
973266404 4:48215362-48215384 TAGATGCGTGCCACCACGCCTGG - Intronic
973768631 4:54186894-54186916 CAGATGTGTGCTACCACACCTGG - Intronic
973951523 4:56019794-56019816 TAGGTGTGTGCCACCACGCCTGG - Intronic
973955380 4:56058210-56058232 TAGTTGTGTGCCACCACGCCTGG + Intergenic
975112927 4:70647318-70647340 CAAATGTGTGCCACCAGGCATGG + Intronic
975786403 4:77893257-77893279 CAGATGTGTGCCACCACGCCCGG + Intronic
975827369 4:78333944-78333966 TACATATGTGCCACCATGCTTGG + Intronic
976274262 4:83260299-83260321 TAGGTGTGTGCTACCAAGCCTGG + Intergenic
976275368 4:83271533-83271555 TAGATGTGTGCCATCACGCCTGG - Intronic
976573765 4:86644272-86644294 CAGGTGTGTGCTACCACGCTCGG + Intronic
976662437 4:87553729-87553751 TACATTTGTGCCACCACGCCAGG + Intergenic
976742348 4:88369193-88369215 TAGGTGTGTGCCACCACGCCAGG + Intergenic
977211485 4:94223215-94223237 CAGATGTGAGCTACCACGCCCGG - Intronic
977660564 4:99580300-99580322 TAGATGTGAGCTACCACGTCTGG - Intronic
978548817 4:109902197-109902219 TACAGGTGCGCCACCACGCCTGG + Intergenic
978639933 4:110858441-110858463 TACACGTGTGCCACCATGCCTGG + Intergenic
979359088 4:119740710-119740732 TACGTGTGAGCTACCACACTCGG + Intergenic
979536752 4:121830256-121830278 TAGGAGTGTGCTACCACGCCTGG - Intronic
980023618 4:127738363-127738385 TAGATGTGAGCCACCACGCCTGG + Intronic
980485833 4:133456650-133456672 TAGGTGTGTGCCACCACGCCCGG + Intergenic
980944645 4:139307407-139307429 TACAGGCGTGCCACCACGCCTGG + Intronic
981487636 4:145303992-145304014 TACAGGTGTGCCACCACACCTGG - Intergenic
981851569 4:149236829-149236851 CAGGTGTGTGCTACCACGCCTGG + Intergenic
982698616 4:158633025-158633047 CAGGTGTGTGCTACCACGCCTGG - Intronic
982714667 4:158794291-158794313 TACAAGTGTGCCACCATGCCAGG + Intronic
983266661 4:165514513-165514535 TAGGTGTGTGCTACCACACCCGG - Intergenic
983558064 4:169076178-169076200 TAAGTGTGTGCCACCACGCCAGG + Intergenic
983805287 4:171985893-171985915 CAGGTGTGTGCTACCACGCCCGG - Intronic
983919076 4:173325895-173325917 CAGATGTGTGCCACCACACATGG - Intergenic
984808733 4:183775302-183775324 TAGATGTGAGCCACCACGCCTGG + Intergenic
985656508 5:1134325-1134347 TAGATGTGTGCCACCACACCCGG - Intergenic
986379160 5:7165752-7165774 TAGATGTGTGCCACCACGCCTGG - Intergenic
986466901 5:8034879-8034901 TACATGTGGGCTAGCATTCATGG - Intergenic
986562040 5:9070091-9070113 CAGATGTGAGCCACCACGCATGG - Intronic
986826254 5:11526044-11526066 CACGTGTGTGCCACCACACATGG + Intronic
987065925 5:14289409-14289431 TACACGTGTGCCACCACACCTGG - Intronic
987230440 5:15888368-15888390 CAGATGTGTGCCACCACGCCTGG + Intronic
987312364 5:16693123-16693145 TAGGTGTGTGCCACCACGCCAGG - Intronic
988519510 5:31933051-31933073 CAGATGTGTGCCACCACGCCTGG + Intronic
988528182 5:32004446-32004468 CAGGTGTGTGCTACCATGCATGG - Intronic
988535373 5:32063309-32063331 TAGATGTGAGCCACCACGCCCGG + Intronic
988590645 5:32545985-32546007 TACATGTGAGCCACCACACATGG + Intronic
989063413 5:37433201-37433223 CAGGTGTGTGCTACCACGCCTGG + Intronic
990522951 5:56597180-56597202 TACGTGTGAGCCACCACGCCCGG + Intronic
991073073 5:62508272-62508294 TACAGGTGTGCCACCATGCCTGG + Intronic
991205041 5:64040497-64040519 TAAATGTGTGCCACCACACCTGG + Intergenic
991454325 5:66786009-66786031 CAGATGTGTGCTACCACACCTGG + Intronic
991688603 5:69205366-69205388 TACAGGCGTGCCACCACGCCTGG + Intronic
992137181 5:73758696-73758718 CAGGTGTGTGCTACCACGCCTGG + Intronic
992253483 5:74898724-74898746 CATATGTGTGCAACCACGCCCGG + Intergenic
992382213 5:76248894-76248916 CACATGTGAGCCACCACGCCTGG + Intronic
992462029 5:76970086-76970108 TACATGTGCGCCACCATGCCTGG + Intronic
992474960 5:77092775-77092797 CAGATGTGTGCTACCATGCTGGG - Intergenic
992864288 5:80941867-80941889 TACAGGTGTGCCACCACACCTGG - Intergenic
993271856 5:85807103-85807125 TAGGTGTGAGCTACCACGCCTGG + Intergenic
993376842 5:87158475-87158497 TAGGTGTGTGCCACCACGCCCGG + Intergenic
993513684 5:88802587-88802609 CACATGTGTGCCACCATGCCTGG + Intronic
995368956 5:111396781-111396803 TAGGTGTGTGCTACCACGCCTGG + Intronic
995813837 5:116143811-116143833 TACATGTGAGTTACTAGGCAAGG + Intronic
996791183 5:127294654-127294676 CAGGTGTGTGCTACCACTCACGG - Intronic
997290614 5:132730826-132730848 CAGGTGTGTGCTACCACGCCTGG - Intronic
997507043 5:134425810-134425832 TACAGGTGCGCCACCACGCCCGG + Intergenic
997919446 5:137964576-137964598 CAGGTGTGTGCTACCACGCCCGG - Intronic
997927379 5:138043223-138043245 TACAAGTGTGTTACCATGCCTGG - Intronic
997985326 5:138496759-138496781 TAGCTGTGTGCCACCACGCCTGG + Intergenic
998087229 5:139336393-139336415 TACAGGTGTGCAACCACACCTGG + Intergenic
998110679 5:139500167-139500189 CAGATGTGTGCCACCATGCAAGG + Intergenic
998257867 5:140602619-140602641 TAGGTGTGTGCCACCACGCCTGG - Intergenic
998411082 5:141911868-141911890 TAGACGTGTGCCACCACCCACGG + Intergenic
998434923 5:142099983-142100005 CACATGTGTGCCACCACTCCCGG + Intergenic
998794936 5:145808741-145808763 TAGGTGTGTGCTACCATGCCTGG - Intronic
999535285 5:152509917-152509939 TAGATGTGTGCCACCATGCCTGG + Intergenic
999974720 5:156899916-156899938 CAGATGTGTGCCACCACGCCTGG - Intergenic
1000052972 5:157577860-157577882 TACAGGTGTGCCACCACGCCTGG - Intergenic
1000768044 5:165316662-165316684 TAGGTGTGTGCTACCACACTTGG + Intergenic
1000803393 5:165757556-165757578 TACAGGTGAGCAACCACGCCCGG + Intergenic
1001387156 5:171349250-171349272 TACAGGTGTGCCACCACGCCTGG + Intergenic
1001463549 5:171940743-171940765 TAGGCGTGTGCTACCACGCCTGG - Intronic
1001463688 5:171942658-171942680 CAGGTGTGTGCTACCACGCCTGG - Intronic
1001474508 5:172040615-172040637 TACAGGTGTGCCACCACGCCTGG + Intergenic
1002065466 5:176649568-176649590 TAGGTGTGTGCCACCACGCCTGG + Intronic
1002501054 5:179647955-179647977 TAGATGTGTGCCACCACACTCGG - Intergenic
1002544748 5:179932693-179932715 TACAGATGTGCCACCACGCCTGG - Intronic
1002631607 5:180584712-180584734 TAGGTGTGAGCTACCACGCCTGG - Intergenic
1003480220 6:6524431-6524453 TAGATGTGTACTACCACACCCGG - Intergenic
1003597687 6:7488760-7488782 CACATGTGTGCCACCACGTCTGG + Intergenic
1003625414 6:7737043-7737065 TACAGGTGTGCTCCCACGCCTGG - Intronic
1003680566 6:8249653-8249675 TAGATGTGTGCATCCAAGCAGGG + Intergenic
1003998067 6:11563825-11563847 CACATGTGGGCCACCACGCCTGG - Intronic
1004187095 6:13430292-13430314 TAGATGTGTGCCACCATGCCCGG - Intronic
1004440924 6:15652898-15652920 TAGGTGTGTGCTACCACGCCAGG + Intronic
1004677322 6:17855852-17855874 TACAGGTGTGCCACCACGCTGGG + Intronic
1005033543 6:21534475-21534497 TAGATGTGCGCCACCACGCCCGG - Intergenic
1005221548 6:23594051-23594073 TAGGTGTGTGCCACCACGCCCGG + Intergenic
1005334545 6:24781058-24781080 TAGGTGTGTGCCACCACGCCCGG - Intronic
1005492858 6:26362550-26362572 TAGGTGTGTGCCACCACGCTGGG - Intergenic
1005612315 6:27538263-27538285 CAGATGTGTGCCACCACGCCTGG - Intergenic
1006036787 6:31220093-31220115 TACAGGTGAGCCACCACGCCTGG - Intergenic
1006076779 6:31538296-31538318 TAGGTGTGTGCCACCATGCACGG + Intronic
1006329698 6:33381633-33381655 TACAGGTGTGCCACCATGCCCGG + Intergenic
1006400843 6:33816379-33816401 CAGGTGTGTGCTACCACGCCCGG + Intergenic
1006998858 6:38289229-38289251 CAGATGTGTGCTACCACGCCTGG - Intronic
1007493342 6:42241602-42241624 CAGGTGTGTGCTACCACGCCTGG + Intronic
1007573462 6:42909771-42909793 TAGGTGTGTGCCACCACGCCCGG + Intergenic
1007780729 6:44252864-44252886 CAGATGTGTGCTACCACACCCGG + Intronic
1008274280 6:49525421-49525443 TACAGGTGTGCCACCACGCCTGG - Intronic
1008923298 6:56865476-56865498 TACATGTGTGCCACCACACCTGG + Intronic
1008980920 6:57483048-57483070 TACAGGTGTGACACCACGCCTGG + Intronic
1009350025 6:62662689-62662711 CAGGTGTGTGCTACCACGCCCGG + Intergenic
1009443245 6:63708007-63708029 CAGATGTGTGCTACCACACCTGG + Intronic
1010191477 6:73201396-73201418 CAGGTGTGTGCTACCACGCCTGG + Intergenic
1010683959 6:78829993-78830015 TTAATGTGTGCTAACATGCATGG - Intergenic
1011531986 6:88332821-88332843 TACAGGCATGCTACCACGCCTGG - Intergenic
1013066048 6:106685308-106685330 TATAGGTGTGCCACCACGCTTGG - Intergenic
1013105121 6:107020573-107020595 TACAAGTGTGCCACCACACCTGG - Intergenic
1013188250 6:107780562-107780584 CAGATGTGTGCCACCACGCTAGG - Intronic
1013780257 6:113720798-113720820 TACAGGTGAGCTACCTCGCCTGG - Intergenic
1014016668 6:116538870-116538892 TACAGCTGTGCCACCACGCCCGG + Intronic
1014201473 6:118613612-118613634 TAGGTGTGTGCCACCACGCCGGG - Intronic
1014267970 6:119303159-119303181 TACGTGTGTGCCACCATGCCTGG + Intronic
1014423608 6:121274188-121274210 TAGGTGTGTGCCACCACGCCTGG - Intronic
1014534925 6:122603621-122603643 TAGGTATGTGCTACCACGCCCGG + Intronic
1014744646 6:125186034-125186056 TAGATGCGTGCCACCACGCCCGG + Intronic
1015252126 6:131137523-131137545 TAGGTGTGTGCCACCACGCCCGG + Intronic
1015332269 6:131994408-131994430 TACGTGTGTGCCACCATGCCTGG + Intergenic
1015628610 6:135208002-135208024 TAGATGTGAGCCACCACGCCTGG + Intronic
1015744710 6:136497654-136497676 CAGATGTGTGCCACCACGCCTGG - Intronic
1016735107 6:147469557-147469579 TACAGGTGTGCCACCATGCCTGG - Intergenic
1016745537 6:147575431-147575453 TGCATTTGTGCCACCACGAATGG + Intronic
1016772707 6:147869990-147870012 TAGATGTGAGCCACCACGCCCGG + Intergenic
1016954165 6:149610155-149610177 CAGATGTGTGCTACCACACCTGG - Intronic
1017137165 6:151158194-151158216 CAGATGTGTGCCACCACGCCTGG + Intergenic
1017667419 6:156734084-156734106 TACACGTGTGCTGCCATGCCTGG + Intergenic
1017838189 6:158199638-158199660 TACAGGTGTGAGACCACGCCTGG - Intergenic
1018018812 6:159737631-159737653 TACAGGTGTGCCACTACGCCTGG + Intronic
1018249280 6:161851942-161851964 CAGGTGTGTGCTACCACGCCCGG - Intronic
1018277311 6:162146778-162146800 TACAGGTGTGCCACCACACCTGG + Intronic
1019029470 6:168997879-168997901 TAGGTGAGTGCTACCACGCCTGG + Intergenic
1019116187 6:169764404-169764426 TAGATGTGTGCTACTACACCTGG + Intronic
1019377979 7:706046-706068 TAGATGTGAGCCACCACGCCCGG - Intronic
1019495158 7:1334768-1334790 TAGACGTGTGCCACCACGCCTGG + Intergenic
1019688632 7:2396897-2396919 TACAGGTGTGCTACCACATCTGG + Intergenic
1020507247 7:9007202-9007224 TACGTGTGAGCCACCATGCATGG - Intergenic
1020932595 7:14416672-14416694 TTCTTGTGTGCTGCCACGTAAGG + Intronic
1021559907 7:21959217-21959239 AACCTGTCTGCTTCCACGCATGG - Intergenic
1021987810 7:26114083-26114105 CAGGTGTGTGCTACCACGCCTGG - Intergenic
1022087011 7:27078220-27078242 TAGGTGTGTGCCACCACGCCTGG - Intergenic
1022726952 7:32989958-32989980 CATGTGTGTGCTACCATGCACGG + Intronic
1023184809 7:37522077-37522099 TAGGTGTGTGCCACCACTCACGG + Intergenic
1023205799 7:37748500-37748522 CAGATGTGTGCCACCACGCCTGG + Intronic
1023217470 7:37879287-37879309 TACAGGTGTGCCACCATGCCCGG + Intronic
1023432351 7:40107842-40107864 CAGATGTGAGCTACCACGCTTGG + Intergenic
1023869149 7:44253488-44253510 CACGTGTGAGCCACCACGCACGG + Intronic
1023869179 7:44253735-44253757 TGCATGTGTGCCACCATGCCTGG + Intronic
1025046630 7:55697678-55697700 CATGTGTGTGCTACCATGCACGG - Intergenic
1025620778 7:63168617-63168639 CAGATGTGTGCTACCATGCCTGG + Intergenic
1025791701 7:64693929-64693951 CAGATGTGTGCCACCACGCCTGG + Intronic
1026036780 7:66835750-66835772 TAGATGTGAGCCACCACACATGG + Intergenic
1026058908 7:67008803-67008825 TAGGTGTGTGCCACCACGCTTGG + Intronic
1026086966 7:67270632-67270654 CACGTGTGTGCTACCATGCCAGG + Intergenic
1026270120 7:68829356-68829378 CAGATGTGTGCCACCACGCCTGG - Intergenic
1026270331 7:68830945-68830967 TAAGTGTGTGCCACCACGCCTGG + Intergenic
1026690136 7:72544066-72544088 CACGTGTGTGCTACCATGCCAGG - Intergenic
1026719181 7:72816231-72816253 TAGGTGTGTGCCACCACGCTTGG - Intronic
1026740920 7:72977837-72977859 TACAGGTGTGCCACCACGCCAGG - Intergenic
1026798228 7:73379330-73379352 TACAGGTGTGCCACCACGCCAGG - Intergenic
1026922625 7:74167479-74167501 TAGGTGTGTGCCACCACGCCTGG + Intergenic
1026954640 7:74369400-74369422 TACAGGCGTGCTACCATGCCTGG - Intronic
1027102813 7:75387237-75387259 TACAGGTGTGCCACCACGCCAGG + Intergenic
1027237850 7:76308619-76308641 TACAGGCGTGCTACGACGCCTGG - Intergenic
1027524637 7:79252012-79252034 TAGGTGTGGGCTACCACGCCAGG - Intronic
1028411583 7:90536211-90536233 CATGTGTGTGCTACCACACATGG - Intronic
1029175970 7:98664694-98664716 TATATGTGTTCTACCACAGAGGG + Intergenic
1029292233 7:99510884-99510906 TAGATGTATGCTACCAGGCCTGG + Intronic
1029622190 7:101697147-101697169 CAGATGTGTGCCACCACGCCTGG - Intergenic
1029638024 7:101798319-101798341 TACAGGTGCGCCACCACGCCTGG - Intergenic
1029674305 7:102057042-102057064 CAGGTGTGTGCTACCACGCCTGG + Intronic
1029803187 7:102971623-102971645 TACAGGTGTACTACCATGCCTGG - Intronic
1029809976 7:103037661-103037683 TAGATGTGAGCTACCACACCTGG - Intronic
1030042724 7:105466398-105466420 TAAGTGTGTGCTACTACGCCTGG + Intronic
1030080594 7:105774492-105774514 CAGATGTGTGCTACCACACCTGG + Intronic
1030099109 7:105929479-105929501 TACACATGTGCTACCACACCAGG - Intronic
1030182344 7:106723034-106723056 TAGGTGTGTGCCACCACGCCTGG + Intergenic
1030388124 7:108891286-108891308 TACAAGTGTGACACCACGCCAGG + Intergenic
1030454164 7:109751751-109751773 TACAGGTGTGCCACCATGCCTGG - Intergenic
1030491943 7:110247901-110247923 TACAGGTGTGTTAGGACGCAAGG + Intergenic
1030628049 7:111865422-111865444 TCCATGTGGGCTACAACTCAGGG - Intronic
1031377734 7:121048679-121048701 CACATGTGTACCACCACGCCTGG + Intronic
1031953354 7:127915154-127915176 TACATGTGTACCACTACGCCAGG + Intronic
1032131555 7:129233323-129233345 TACAAGTGTGCTACCACGCCTGG + Intronic
1032315341 7:130833128-130833150 TAGGCGTGTGCTACCACGCCTGG + Intergenic
1032447098 7:131993584-131993606 TACAGGTGTGCCACCACGCCCGG - Intergenic
1032819778 7:135513705-135513727 TAGATGTGTGCCACCACGCCCGG - Intergenic
1032844148 7:135738334-135738356 CAGATGTGTGCCACCACGCTCGG + Intronic
1032860324 7:135872179-135872201 TAAATGTGTGCCACCACTCCTGG + Intergenic
1033093831 7:138412227-138412249 TACATGTGTGCCATCATGCCTGG + Intergenic
1033361726 7:140642736-140642758 TAGATGTGAGCCACCACGCCTGG + Intronic
1033895734 7:146066910-146066932 CACAGGTGTGCCACCACGCCCGG - Intergenic
1033969914 7:147026000-147026022 CAGGTGTGTGCTACCACGCCTGG + Intronic
1034157950 7:148971126-148971148 TACATGTGCACCACCACGCCCGG + Intergenic
1034189763 7:149204983-149205005 TAGGTGTGTGCCACCACGCCTGG - Intronic
1034225984 7:149482605-149482627 CAGATGTGTGCCACCACGCCTGG + Intronic
1034310810 7:150086124-150086146 CACGTGTGTGCCACCACACATGG + Intergenic
1034376327 7:150647876-150647898 CAGATGTGTGCCACCACGCCTGG - Intergenic
1034612668 7:152385943-152385965 TAGGTGAGTGCTACCACGCCAGG - Intronic
1034695361 7:153048546-153048568 CAGATGTGTGCCACCACGCCCGG + Intergenic
1035545453 8:478887-478909 TACACGTGTGCCACCATGCCTGG - Intergenic
1036183470 8:6604645-6604667 TACGTGCGTGCCACCACGCCTGG + Intronic
1036395881 8:8370993-8371015 TACAGGTGCGCCACCACGCATGG - Intronic
1036439378 8:8766693-8766715 CAGGTGTGTGCCACCACGCACGG - Intergenic
1036440706 8:8779284-8779306 TACAAGTATGCCACCACGCCTGG + Intergenic
1036525089 8:9527615-9527637 CAGATGTGTGCCACCACGCCTGG - Intergenic
1036554744 8:9848428-9848450 GAGGTGTGTGCTACCACGCCTGG - Intergenic
1036575569 8:10024846-10024868 CACAGGTGTGCCACCACGCCTGG - Intergenic
1037167372 8:15847192-15847214 CACATATGTGCTACAACCCAGGG - Intergenic
1037571307 8:20159908-20159930 GCCATCTGTGCTACCACGCTGGG - Intronic
1037972168 8:23180222-23180244 CACGTGTGTGCCACCACGCCTGG + Intergenic
1038000362 8:23386248-23386270 CAGGTGTGTGCTACCACGCCCGG - Intronic
1038203643 8:25441857-25441879 CAGATGTGTGCTACCATGCCCGG - Intronic
1038245106 8:25848139-25848161 TAGGTGTGTGCCACCACGCCTGG + Intronic
1038732498 8:30139817-30139839 TACAGGTGTGCCACCATGCATGG - Intronic
1039222994 8:35356059-35356081 TAGGAGTGTGCTACCACGCCCGG + Intronic
1039262100 8:35782854-35782876 TAGATGTGAGCTACCATGCCTGG - Intronic
1039331720 8:36544599-36544621 TAGGTGTGTGCCACCACGCCTGG - Intergenic
1039503662 8:38035848-38035870 TACAGGCGCGCTACCACGCCTGG + Intronic
1039798042 8:40932170-40932192 TACAGGTGTGCCACCATGCCTGG - Intergenic
1039883394 8:41641094-41641116 CAGATGTGTGCTACTACGCCTGG + Intergenic
1040408439 8:47132498-47132520 TACAGGTGTGACACCACGCCTGG - Intergenic
1042132418 8:65600751-65600773 CAGATGTGCGCTACCACGCCTGG - Intergenic
1042142397 8:65692478-65692500 CAGGTGTGTGCTACCACGCCTGG + Intronic
1042318254 8:67447925-67447947 TAGACGTGTGCCACCACGCCAGG + Intronic
1042978150 8:74493910-74493932 TACAGGTGCGCCACCACGCCTGG + Intergenic
1043048190 8:75353362-75353384 TAGATGTGTGCTACCACAACTGG - Intergenic
1043405544 8:79928580-79928602 TAGGTGTGTGCTACCACACCTGG + Intronic
1043440106 8:80269449-80269471 CAGATGTGTGCCACCACGCCCGG - Intergenic
1043774822 8:84253330-84253352 TAGGTGTGTGCCACCACGCCAGG + Intronic
1043854702 8:85251978-85252000 TACATGTGAGCCACCACACCCGG - Intronic
1044243023 8:89908868-89908890 TACAGGTGTGCCACCACACTTGG - Intronic
1044672341 8:94695493-94695515 TACACGTGTGCCACCAAGCCTGG + Intronic
1045018733 8:98022943-98022965 TAGATGCGTGCCACCACGCCTGG - Intronic
1045069351 8:98485096-98485118 TAGGTGTGTGCCACCACGCCTGG - Intronic
1045183156 8:99808373-99808395 TACAGGTGTGCCACCACGACTGG - Intronic
1045853496 8:106733662-106733684 CAGGTGTGTGCCACCACGCACGG - Intronic
1046732568 8:117740983-117741005 CAGATGTGCACTACCACGCATGG - Intergenic
1046906326 8:119577315-119577337 TACATGTGTGCTCACATACATGG + Intronic
1046947071 8:119984191-119984213 GCCATGTGTGCTTCCATGCAAGG - Intronic
1046959291 8:120093533-120093555 TACAGGTGTGCCACCACACCCGG + Intronic
1047155611 8:122314251-122314273 CAGGTGTGTGCTACCACGCCTGG - Intergenic
1047205677 8:122801606-122801628 TATGTGTGTGCTACCAAGCCTGG - Intronic
1047265054 8:123299296-123299318 CAAGTGTGTGCCACCACGCATGG + Intergenic
1047281065 8:123446132-123446154 TACAGGTGCGCTACCACACCTGG + Intronic
1047389868 8:124441531-124441553 TGCAGGTATGCTACCATGCAGGG - Intergenic
1047494152 8:125397800-125397822 AGCATGTGTGCCACCACGCCTGG + Intergenic
1047937388 8:129796296-129796318 CACATGTGTGCCACCATGCTTGG + Intergenic
1047959649 8:130001667-130001689 TACACGTGCGCCACCACGCCTGG + Intronic
1047982030 8:130193224-130193246 TAGATGTGTGCCACCATGCCTGG - Intronic
1048500363 8:134969755-134969777 TAGGTGTGTGCTACCATGCTGGG + Intergenic
1049362791 8:142220220-142220242 GACATGCGTGCTACCTTGCAGGG - Intronic
1049534755 8:143173699-143173721 TACAGGTGTGTCACCACGCCTGG - Intergenic
1049926817 9:417150-417172 TACAGGTGCGCCACCACGCCTGG - Intronic
1050358092 9:4802049-4802071 TAGGTGTGTGCCACCACGCCTGG + Intronic
1050457329 9:5846563-5846585 TACATGAGTGAAACCATGCAAGG - Intergenic
1051043221 9:12840732-12840754 CAGATGTGTGCCACCACGCCTGG - Intergenic
1051140492 9:13973852-13973874 TAGGTGTGTGCCACCACGCCCGG + Intergenic
1052655424 9:31352880-31352902 TAGATGTGTGCCACCACACCCGG + Intergenic
1052848718 9:33361978-33362000 TACAAGTGTGCCACCATGCCCGG - Intronic
1053409734 9:37907870-37907892 CAGATGTGTGCCACCACGCCTGG - Intronic
1054916890 9:70502743-70502765 TAGGTGTGAGCTACCACGCCTGG + Intergenic
1055318013 9:75053646-75053668 CAGGTGTGTGCCACCACGCATGG - Intergenic
1055738841 9:79363473-79363495 TGCAGGTGTGCTACCATGCCTGG - Intergenic
1055947587 9:81705318-81705340 TACGTGTGAGCCACCACGCCTGG + Intergenic
1056211492 9:84368929-84368951 CACATGTGAGCCACCACGCCTGG - Intergenic
1056787331 9:89602722-89602744 TACAGGTGCGCCACCACGCCGGG - Intergenic
1057280146 9:93703811-93703833 TAGATGTGAGCCACCACTCATGG + Intergenic
1057408994 9:94799717-94799739 CACGTGTGTGCCACCACGCCTGG - Intronic
1057485795 9:95483123-95483145 TATATGTGTGGCACCACGCCTGG - Intronic
1057668292 9:97064154-97064176 CAGGTGTGTGCTACCACGCTTGG + Intergenic
1058204501 9:102086564-102086586 TACATGTGCGCCACCACACTCGG + Intergenic
1058274349 9:103021671-103021693 CAGGTGTGTGCCACCACGCACGG + Intergenic
1058375617 9:104317649-104317671 TAGCTGTGTGCCACCACGCCTGG + Intergenic
1058439415 9:104993345-104993367 TACATGGCTTCTACCATGCATGG - Intergenic
1058479345 9:105375180-105375202 TACAGGCGTGCCACCACGCCCGG + Intronic
1059009213 9:110438480-110438502 CAGATGTGAGCTACCACGCCTGG + Intronic
1059148691 9:111927011-111927033 TTCAGGTGTGCTACCACACCTGG + Intronic
1059355873 9:113698959-113698981 CAGGTGTGTGCTACCACGCCTGG - Intergenic
1059960844 9:119562967-119562989 TACAGGTGTGCCACCACGCCTGG - Intergenic
1060159953 9:121352948-121352970 TAGATGTGCGCCACCACGCCCGG - Intronic
1060660875 9:125404603-125404625 TAGGTGTGTGCTACCACACCTGG + Intergenic
1060843345 9:126813121-126813143 CAGATGTGTGCCACCACGCCCGG + Intronic
1060928308 9:127471328-127471350 TACAGGTGTGCCACCAAGCTGGG - Intronic
1061154582 9:128850025-128850047 TACGTGTGTGCCACCATGCCTGG + Intronic
1061433461 9:130545674-130545696 TAGGTGTGAGCTACCACGCCTGG - Intergenic
1061436080 9:130563006-130563028 TACAGGTGTGCCACCATGCCTGG + Intergenic
1061568381 9:131459678-131459700 TACCTGTGTGCTGCCACACCTGG + Intronic
1061919533 9:133775119-133775141 TTCATGTGGCCTGCCACGCACGG - Intronic
1061970600 9:134043114-134043136 TAGATGTGAGCCACCACGCCCGG + Intronic
1061999406 9:134208262-134208284 CAGATGTGTGCCACCACGCCTGG + Intergenic
1062115766 9:134807434-134807456 CAGATGTGTGCTACCACACCCGG + Intronic
1062726067 9:138074381-138074403 TAGATGTGTGCCACCACGCCCGG + Intronic
1185467113 X:361729-361751 TACGTGTGTGGTCCCCCGCAGGG - Intronic
1185665037 X:1758930-1758952 TAGCTGTGTACTACCACGCCCGG - Intergenic
1185967185 X:4619892-4619914 TAAGTGTGTGCCACCATGCATGG - Intergenic
1186197898 X:7128317-7128339 CAGATGTGTGCCACCACGCCCGG + Intronic
1186472994 X:9835860-9835882 TAGTTGTGTGCCACCACGCCCGG + Intronic
1187353619 X:18545083-18545105 TATCTGTGTGCCACCACACAAGG - Intronic
1187509409 X:19904018-19904040 TACAGGTGTGCCACCACACCCGG + Intergenic
1187878234 X:23821975-23821997 CAGGTGTGTGCTACCACGCCTGG + Intergenic
1188048434 X:25454800-25454822 TAGGTATGTGCTACCACGCTTGG + Intergenic
1188944378 X:36279845-36279867 CAGATGTGTGCCACCACGCCTGG + Intronic
1189068598 X:37838603-37838625 GAGATGTGTGCCACCACGCCTGG + Intronic
1189158340 X:38783278-38783300 TAGATGTGTGCCACCACACCTGG - Intergenic
1189342119 X:40211963-40211985 TACAGGTGTGCTACCATGTCTGG + Intergenic
1189395105 X:40614269-40614291 TACATGTGTGCCACCATGCCCGG - Intergenic
1189503152 X:41583577-41583599 CAGGTGTGTGCTACCACGCCAGG + Intronic
1189507203 X:41623849-41623871 CAGGTGTGTGCTACCACGCTTGG + Intronic
1189525944 X:41822278-41822300 TAGATGTGAGCCACCACGCCTGG - Intronic
1189911758 X:45817060-45817082 CAGATGTGTGCTACCACGCCTGG + Intergenic
1190089540 X:47425824-47425846 TACAGGTGCGCCACCACGCCTGG + Intergenic
1190158394 X:48012167-48012189 CAGGTGTGTGCCACCACGCATGG - Intronic
1190723248 X:53168711-53168733 TACAGGCGTGCTACCACGCCTGG - Intergenic
1190867257 X:54395263-54395285 TAGGTGTGTGCCACCACGCCCGG + Intergenic
1190884656 X:54520967-54520989 CAGCTGTGTGCTACCACGCACGG - Intergenic
1191041985 X:56091635-56091657 TACAGGTGTGCCACCATGCCTGG + Intergenic
1191599201 X:62984446-62984468 TAGATGTGTGCCACCACACTCGG - Intergenic
1192396685 X:70789055-70789077 TAGATGTGTGCCACCATGCCTGG - Intronic
1192743276 X:73913932-73913954 TAGATGTGAGCCACCACGCCTGG - Intergenic
1193250791 X:79288789-79288811 TACATGTGTGCTGGCAGGGAAGG - Intergenic
1193385516 X:80866860-80866882 TACAGGTGCGCCACCACGCCTGG + Intergenic
1193723528 X:85015709-85015731 TAGGTGTGTGCCACCACGCACGG + Intronic
1193837338 X:86360022-86360044 TACATGTGTGTCACCATGCCTGG + Intronic
1194653319 X:96541821-96541843 TACAGGCGTGCCACCACGCTTGG - Intergenic
1196483141 X:116174410-116174432 TACATGTTTGGTACCAAGAAAGG + Exonic
1196727957 X:118914144-118914166 CAAATGTGTGCTACCACGCTGGG + Intergenic
1196841601 X:119864528-119864550 CAGATGTGAGCTACCACGCCTGG - Intergenic
1197215913 X:123866817-123866839 TACAGGTGTGCTACCACACCTGG + Intronic
1197216011 X:123867514-123867536 TAGACATGTGCTACCACGCCCGG + Intronic
1197741843 X:129900979-129901001 TACAGGCGTGCCACCACGCCTGG + Intergenic
1197770741 X:130087608-130087630 TAGGTGTGTGCCACCACGCCCGG + Intronic
1198048144 X:132922918-132922940 AAGGTGTGTGCTACCACGCCCGG - Intronic
1198471821 X:136953969-136953991 CACAGGTGTGCCACCACGCCTGG - Intergenic
1199599089 X:149530574-149530596 TGCATGCATGCCACCACGCATGG - Intronic
1199752177 X:150830407-150830429 TAGGTGTGTGCTACCACACCTGG - Intronic
1200159941 X:154001607-154001629 CAGATGTGTGCCACCACGCCCGG - Intergenic
1200300749 X:154972854-154972876 TACAGGTGTGCCACCACACCTGG + Intronic
1201282483 Y:12353695-12353717 CACACGTGAGCTACCACGCCTGG + Intergenic
1201851134 Y:18481644-18481666 TACAGGTGTGCCACCACGCCTGG + Intergenic
1201882185 Y:18838734-18838756 TACAGGTGTGCCACCACGCCTGG - Intergenic