ID: 1100853237

View in Genome Browser
Species Human (GRCh38)
Location 12:98735697-98735719
Sequence ATTGAGATGTACCATGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 1, 2: 4, 3: 38, 4: 297}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100853237 Original CRISPR ATTGAGATGTACCATGTGCC TGG Intronic
900280861 1:1867368-1867390 ATTGAGACCTACTATGTACCAGG + Intronic
901175668 1:7297167-7297189 ATAGAGATATACCATGTTCATGG - Intronic
902828775 1:18996102-18996124 ATTGAGGTCTACCATGTGCCAGG + Intergenic
903091586 1:20923923-20923945 ATTTATATCTACCATGTGACAGG - Intronic
904596993 1:31653037-31653059 ATTTAGAACTTCCATGTGCCAGG + Intronic
905127788 1:35727697-35727719 GTTGAGATTTACTCTGTGCCAGG + Intronic
905716768 1:40158997-40159019 ATTGAGATTTAATATGTTCCAGG - Intergenic
906206212 1:43988070-43988092 ATTGAGCACCACCATGTGCCAGG - Intronic
906360356 1:45151948-45151970 ATTGGTATCTACCATGTGTCAGG + Intronic
906406144 1:45543837-45543859 AATGATATCTACCATGTGCCAGG - Intergenic
906523969 1:46483848-46483870 AGGGGGATGTACCATGTGCCAGG - Intergenic
906861042 1:49359881-49359903 ATTGTGAAGTACTATGTCCCAGG - Intronic
907525303 1:55050435-55050457 ATAGGCATCTACCATGTGCCCGG - Intronic
908087849 1:60655509-60655531 ATTCATATCTACCATGAGCCGGG - Intergenic
908120970 1:60985565-60985587 ATCAATATTTACCATGTGCCAGG + Intronic
908121854 1:60993331-60993353 ATTGAGATCTACTATGTGGCTGG + Intronic
908742998 1:67348009-67348031 ATTGGGCTATACCATGAGCCAGG - Intronic
909152061 1:72019441-72019463 ATGCAGCTGTACCATATGCCTGG + Intronic
909351873 1:74663195-74663217 ATTGACATATACTATGTGTCAGG + Intronic
909484180 1:76155341-76155363 ATAGAGAATTACTATGTGCCAGG + Intronic
911448047 1:98024498-98024520 ATTGAGCTCTACTATTTGCCGGG - Intergenic
911970800 1:104434629-104434651 ATTGATGTTTACCATGGGCCAGG + Intergenic
912987949 1:114453736-114453758 ACTGAGGTCTACCATGTGGCTGG + Intronic
913250285 1:116907706-116907728 ATTGGGACCTACCATGTGCTAGG + Intergenic
914829195 1:151158395-151158417 CTTGAGATGTAACTTGTGCTAGG + Intronic
917503640 1:175608630-175608652 ATTGAGATATAGCATGTTCAAGG + Intronic
919494577 1:198248567-198248589 TTTGATATTTACCATGTGCCAGG - Intronic
921220252 1:212968627-212968649 AAGGAGATGAAACATGTGCCTGG + Intronic
921701860 1:218277865-218277887 ATGGAGATATACAATGTTCCTGG - Intergenic
922198373 1:223380125-223380147 ATTGAGTTCTACTATGTGCCAGG + Intergenic
922372217 1:224922875-224922897 TGTGATATTTACCATGTGCCAGG - Intronic
922375400 1:224958855-224958877 ATTGATAAGTACCAATTGCCTGG - Intronic
922655710 1:227381553-227381575 ATTAAGATTTACCATAGGCCAGG - Intergenic
923495792 1:234523101-234523123 ATTGAAAAGTACCATCTGCGAGG - Intergenic
1065360550 10:24885251-24885273 ATTTAAATTTACCAAGTGCCTGG + Intronic
1066286696 10:33974105-33974127 ATTAAGATGTGCTATGTGCCAGG - Intergenic
1068690677 10:59910520-59910542 GTTGAGATGTTGCATGTGCAAGG - Intergenic
1070205526 10:74255600-74255622 ACTCAGATGTACCAAATGCCAGG - Intronic
1071103412 10:82065546-82065568 TTTAACATGTACTATGTGCCAGG - Intronic
1072369068 10:94745227-94745249 TTTGGCTTGTACCATGTGCCTGG + Intronic
1072563748 10:96600322-96600344 ATTGAGACTTACTATGTGGCAGG - Intronic
1072962808 10:99944629-99944651 ATTTATTTTTACCATGTGCCAGG - Intronic
1073947061 10:108763383-108763405 TTTAATATGTACCAAGTGCCAGG - Intergenic
1075332281 10:121582315-121582337 TTTGAGACCTACTATGTGCCAGG - Intronic
1075906444 10:126085810-126085832 ATTGAGCTCTACTATGTGTCAGG + Intronic
1076465068 10:130674259-130674281 AGAGAGATATACCATGTGCATGG + Intergenic
1077884070 11:6372877-6372899 ATAGAGATCTACAGTGTGCCAGG - Intergenic
1078334490 11:10452601-10452623 ATTGAGCACCACCATGTGCCTGG - Intronic
1078859882 11:15237114-15237136 ATTGAGACCTAATATGTGCCTGG + Intronic
1079260576 11:18875418-18875440 ATAGAGATGTACCATGTCTTAGG + Intergenic
1080118509 11:28647530-28647552 ATTGACATATTCCATGTTCCAGG - Intergenic
1080558082 11:33435644-33435666 TTGAAGATTTACCATGTGCCAGG + Intergenic
1080869125 11:36221654-36221676 ACTGAGATGCACCATCAGCCTGG + Intronic
1081252978 11:40858416-40858438 ATAGGCATGAACCATGTGCCTGG - Intronic
1083554039 11:63611841-63611863 ATTGAAATGTATGATGGGCCGGG + Intronic
1084264257 11:67996853-67996875 CTTCAGATGCACCACGTGCCTGG + Intronic
1085729202 11:78982201-78982223 GTTGGCAAGTACCATGTGCCAGG + Intronic
1086369477 11:86142058-86142080 ATGAAGGTGTGCCATGTGCCAGG + Intergenic
1086394615 11:86401604-86401626 ATTGAGCACCACCATGTGCCAGG + Intronic
1086514629 11:87597621-87597643 ATTGGGAAGCACTATGTGCCAGG - Intergenic
1087220107 11:95537608-95537630 ATTGAGACCTACTATATGCCAGG - Intergenic
1089298437 11:117483435-117483457 ATTGAGACCTTCTATGTGCCAGG + Intronic
1089501128 11:118931869-118931891 AGTGAGATGTACTGTTTGCCTGG - Intronic
1090425502 11:126604410-126604432 TTGAACATGTACCATGTGCCAGG + Intronic
1091928804 12:4377893-4377915 AATAGGATCTACCATGTGCCTGG - Intronic
1092533558 12:9365190-9365212 ATTAAGACCTAACATGTGCCAGG - Intergenic
1092635117 12:10437012-10437034 ATTCAGTGGTAACATGTGCCAGG - Intronic
1094263824 12:28531763-28531785 AGTCAGCTGCACCATGTGCCAGG + Intronic
1095583502 12:43826273-43826295 ATTGAGGTTTACTCTGTGCCAGG + Intergenic
1096516489 12:52158593-52158615 ATTGATACTTACGATGTGCCAGG - Intergenic
1097627859 12:62022516-62022538 TTTGAGTGTTACCATGTGCCAGG + Intronic
1097639132 12:62158175-62158197 ATTGAGATCTACTATGTGCCAGG - Intronic
1097969928 12:65622667-65622689 ATTGAGTGCTACTATGTGCCAGG + Intergenic
1098319369 12:69225812-69225834 AGTGAGATGTATTATGTGCCTGG - Intergenic
1098887983 12:75979638-75979660 TTTGATATTTACCATATGCCAGG + Intergenic
1099249388 12:80234606-80234628 ATTGAGTATTACTATGTGCCAGG - Intronic
1099788930 12:87305072-87305094 TTTGATGTGTACTATGTGCCAGG - Intergenic
1100641447 12:96485499-96485521 ATTGAGCTGTACTCTGTGCCAGG + Intergenic
1100679364 12:96901842-96901864 GTTGAAATGCACCATGGGCCAGG - Intergenic
1100853237 12:98735697-98735719 ATTGAGATGTACCATGTGCCTGG + Intronic
1101667783 12:106835445-106835467 GTTGACATTTACTATGTGCCAGG + Intronic
1102869597 12:116403147-116403169 ATTGAGAACTTGCATGTGCCAGG - Intergenic
1104259786 12:127172042-127172064 GTTGAGCTAGACCATGTGCCTGG + Intergenic
1104652393 12:130545211-130545233 CTCGAGATGTACCAAGTACCAGG - Intronic
1104988470 12:132610944-132610966 TTTGTGATCGACCATGTGCCAGG + Intergenic
1105256876 13:18749629-18749651 AATGAGATGTTCCATATGGCAGG + Intergenic
1105258665 13:18762556-18762578 AATGAAATGTTTCATGTGCCAGG + Intergenic
1106405082 13:29466201-29466223 ATGGAAATGTGCCATATGCCTGG + Intronic
1107126463 13:36851568-36851590 ATTGGCATGTCCCACGTGCCTGG + Intronic
1107162691 13:37250440-37250462 AGTGAGATGAACCATGAACCCGG - Intergenic
1107269923 13:38603110-38603132 AATGAGATGTACTATGTCCCAGG - Intergenic
1108890860 13:55257460-55257482 ATGGAAATGTACCATGTGCCAGG + Intergenic
1111128049 13:83937245-83937267 ATTGATGTGAACCATGTGCCAGG - Intergenic
1111388959 13:87565537-87565559 ATGGAGATGTACAATTTACCTGG + Intergenic
1113024072 13:105921340-105921362 TTTGAGATGCACCTTGAGCCAGG + Intergenic
1113057621 13:106286690-106286712 ATTGACACTTACTATGTGCCAGG + Intergenic
1114390485 14:22302848-22302870 ATTGAGCTGTACTGTATGCCAGG - Intergenic
1116846554 14:49869747-49869769 ATTGAGATCTGCTATGTGCTAGG + Intergenic
1117888346 14:60389502-60389524 ATAGAGATATACCATGTTCGAGG + Intergenic
1117977778 14:61315533-61315555 GCTGAAGTGTACCATGTGCCTGG + Intronic
1118243659 14:64086622-64086644 AAAGAGATATACCATGTTCCTGG - Intronic
1119648430 14:76365948-76365970 CTTGAGGTGTACCATGTGCAGGG - Intronic
1120535100 14:85684888-85684910 GGTGAGATATACCATGTGCATGG - Intergenic
1120762790 14:88301068-88301090 ATCGAAAGCTACCATGTGCCAGG + Intronic
1122123336 14:99566243-99566265 GTTGGCATTTACCATGTGCCAGG + Intronic
1123709875 15:22979925-22979947 CTGGAGCTGTGCCATGTGCCGGG + Intronic
1124553000 15:30699249-30699271 ATTCAGATGTATAATGTCCCCGG - Intronic
1124678243 15:31706421-31706443 ATTCAGATGTATAATGTCCCCGG + Intronic
1125154521 15:36570763-36570785 AGTGAGAGCTACCATGTACCAGG - Intergenic
1125180034 15:36871915-36871937 ATTGAGAAATATTATGTGCCTGG - Intergenic
1131781034 15:95859571-95859593 ATTGGCATATACCATGTTCCAGG + Intergenic
1131890627 15:96968334-96968356 ATTGAGAAAGACCATGTACCAGG + Intergenic
1136017794 16:27415841-27415863 TTGGAGATGGACTATGTGCCTGG + Intronic
1137804006 16:51286752-51286774 CTTGAGATGTGACATGTACCTGG - Intergenic
1139753156 16:69121365-69121387 ATAGAGGTGTGCCATGTGTCTGG - Intronic
1142351140 16:89580908-89580930 GGTGAGATGTTCCATGTGACGGG - Intronic
1142351174 16:89581095-89581117 GGTGAGATGTTCCATGTGACGGG - Intronic
1142512452 17:405382-405404 ATCAAGATTTACCATGGGCCGGG + Intergenic
1144148940 17:12424632-12424654 ATTGAGATGTCCCCTGTCCTTGG + Intergenic
1146086620 17:29836611-29836633 CTTGAGCACTACCATGTGCCTGG - Intronic
1146285614 17:31572423-31572445 ACTGAGGTGCATCATGTGCCAGG - Intronic
1146523734 17:33547862-33547884 ATTGAGACCTACTGTGTGCCTGG - Intronic
1147047859 17:37768041-37768063 ATTGAGAGCTACAAAGTGCCAGG - Intergenic
1147111140 17:38262636-38262658 ATTGAGATGTACTTTGTGCAGGG - Intergenic
1147990937 17:44332937-44332959 ATTGAGATTTATATTGTGCCAGG - Intergenic
1148418373 17:47525808-47525830 ATTGAGATGTACTTTGTGCAGGG + Intronic
1149023473 17:51997337-51997359 ATTGAGACTTACTCTGTGCCAGG - Intronic
1149932988 17:60774326-60774348 ACAGAGATCTTCCATGTGCCTGG + Intronic
1150203826 17:63385142-63385164 ATTCAGATCTACAATGTGTCAGG - Intronic
1150378602 17:64702783-64702805 ATGAACATCTACCATGTGCCAGG + Intergenic
1153080254 18:1214929-1214951 ATTGAGGTTTATCATGTGCCAGG - Intergenic
1153445712 18:5170522-5170544 ATGAGGATGTACAATGTGCCAGG - Intronic
1153691020 18:7593819-7593841 GTTGAGATTTACAATGTGCAGGG - Intronic
1154429203 18:14295393-14295415 AATGAGATGTTCCATATGGCAGG - Intergenic
1154431473 18:14311738-14311760 AATGAGATGTTCCATATGGCAGG - Intergenic
1154434158 18:14331042-14331064 AATGAGATGTTCCATATGGCAGG - Intergenic
1155222584 18:23698756-23698778 ATTGGCATCTACTATGTGCCAGG + Intronic
1155486720 18:26351801-26351823 ATTGAGATTTACCATATGCATGG + Intronic
1155560425 18:27070608-27070630 ATTGAGACTTACCATATGTCAGG + Intronic
1159398122 18:67891238-67891260 ATTAAGATTTACCATGGACCGGG - Intergenic
1159493457 18:69168420-69168442 ATTGAGATGCACAGTGAGCCAGG - Intergenic
1162154730 19:8669832-8669854 AGTGAGATGTTCCATGTACCTGG + Intergenic
1164463064 19:28464766-28464788 ACTGAAATTTACCAAGTGCCTGG - Intergenic
1165173994 19:33913930-33913952 ATTGAGCTGAACCCTTTGCCAGG - Intergenic
1165709244 19:37998119-37998141 ACTGATGTCTACCATGTGCCTGG - Intronic
925801109 2:7601241-7601263 ATTGAAATCTACCATGTACAAGG + Intergenic
927414184 2:22859469-22859491 ATTGAGGTTTACCATGTTCAAGG - Intergenic
928285881 2:29989665-29989687 TATGAGATGTACCAGGTGCCGGG - Intergenic
929806610 2:45151860-45151882 ATTGAGATTTACCAAGCACCAGG + Intergenic
931320850 2:61173659-61173681 ATTGAGATCTGCTATGTGCTGGG + Intergenic
933445301 2:82372273-82372295 ATTGAGAGGTACCATTTGCTTGG + Intergenic
934476012 2:94594019-94594041 ATTCACATCTACTATGTGCCTGG + Intronic
934769231 2:96897275-96897297 CTAGACATGTACCATGTGCCAGG - Intronic
938592744 2:132755231-132755253 AGTGAGATATTGCATGTGCCTGG + Intronic
942533940 2:176943330-176943352 ATGGATATTTACAATGTGCCTGG + Intergenic
943176828 2:184486697-184486719 ATTAGGATGTACTGTGTGCCAGG - Intergenic
943723225 2:191227361-191227383 ATTGATGCTTACCATGTGCCAGG + Intergenic
944855662 2:203764570-203764592 ATTGAGTTGTTCCATCTGCAGGG + Intergenic
945172842 2:207014832-207014854 TTGGAGATTTACCATGTGTCAGG + Intergenic
947435604 2:230069376-230069398 ATTGAGATGAAAGTTGTGCCTGG - Intergenic
947665252 2:231901257-231901279 CCTGAGATGTGCCTTGTGCCAGG + Intergenic
948089584 2:235281535-235281557 ATTAACATGTACTATGTACCGGG + Intergenic
1170861009 20:20103632-20103654 ATCAAGATGTTCCATATGCCTGG + Intronic
1171119691 20:22557799-22557821 CTTGGGAGGCACCATGTGCCTGG - Intergenic
1172624919 20:36341467-36341489 ACTGATATGCACCGTGTGCCAGG + Intronic
1172716183 20:36965539-36965561 ATTCAGATTTTCTATGTGCCAGG - Intergenic
1172887302 20:38239830-38239852 ATTGATCTCTCCCATGTGCCAGG + Intronic
1173014221 20:39210221-39210243 ATTGAGGTCTATTATGTGCCAGG + Intergenic
1173440634 20:43072074-43072096 ATTGATGAGTGCCATGTGCCAGG - Intronic
1175589590 20:60177954-60177976 ACTGAGGTGGACCGTGTGCCCGG + Intergenic
1175601986 20:60281718-60281740 ATTGAGACCAACCCTGTGCCAGG + Intergenic
1176842868 21:13854679-13854701 AATGAGATGTTCCATATGGCAGG + Intergenic
1176848303 21:13893580-13893602 AATGAGATGTTCCATATGGCAGG + Intergenic
1177293161 21:19141468-19141490 AATGACAAGTACCATGTGTCAGG + Intergenic
1177439840 21:21108247-21108269 ATTAAAATGTACTGTGTGCCAGG + Intronic
1178072376 21:28982866-28982888 ATTGAGCTTTTGCATGTGCCAGG + Intronic
1178679864 21:34665040-34665062 ATGGAGCTCTACTATGTGCCTGG + Intergenic
1181726834 22:24817223-24817245 CTGGGGATGTACTATGTGCCAGG + Intronic
1182909089 22:33965540-33965562 ATTGATATGTAGCATGGGCTAGG - Intergenic
1183438852 22:37811515-37811537 ATTGAGCAGTACTATGTGCCAGG - Intronic
1184620030 22:45670318-45670340 ATTGCGGTGTACTATGTGCCAGG - Intergenic
1184745929 22:46455919-46455941 TTTGAGATTTGCCATGTCCCTGG - Intronic
1185125697 22:49009557-49009579 ATTGGCATGAACCGTGTGCCAGG + Intergenic
949237966 3:1833717-1833739 ATCAAGATGTTCTATGTGCCAGG + Intergenic
949797287 3:7864727-7864749 AATGTGATGTACCTAGTGCCAGG + Intergenic
951446437 3:22786254-22786276 ATTGAGATAGACCATGTTCCAGG + Intergenic
951826150 3:26871386-26871408 TTAAATATGTACCATGTGCCAGG + Intergenic
953077529 3:39583729-39583751 ATTGAAATGTACCATGTCGCTGG + Intergenic
956803627 3:72786775-72786797 ATTGAGCTCTATTATGTGCCAGG - Intronic
958723509 3:97875652-97875674 TTTTAGATGTACCAGGTGCATGG - Exonic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
960194757 3:114752043-114752065 ATTGAACTCTACTATGTGCCAGG + Intronic
960429053 3:117546490-117546512 ATTGAGAACTACCATGTGCCAGG + Intergenic
961142808 3:124569460-124569482 ATTGAGCTTTACCATGGGTCAGG + Intronic
961938490 3:130611547-130611569 GTTGAGCTCTACTATGTGCCAGG - Intronic
962279653 3:134040207-134040229 ATTCAGAAGTCCCAGGTGCCAGG - Intronic
962377262 3:134868662-134868684 ATTGAGACCTACTATGTGTCAGG + Intronic
962656552 3:137550035-137550057 ACTGAAATGTACCATGTTCTTGG - Intergenic
963652391 3:147996868-147996890 ATTGAGATCTACTATGTGCTAGG - Intergenic
966258544 3:177948147-177948169 ATTGACATCTACCATGTGTAAGG + Intergenic
966671066 3:182526640-182526662 ATTGAGGACTAACATGTGCCAGG + Intergenic
967661777 3:192120126-192120148 ATTGGCATGTACTATGGGCCAGG + Intergenic
967845069 3:194036471-194036493 ATTAGGATCTACCATGTGTCAGG + Intergenic
967989477 3:195120523-195120545 ATTGGGGTGCACCCTGTGCCAGG - Intronic
968237652 3:197045704-197045726 ATTGGATTGTACCATTTGCCTGG + Intronic
969481866 4:7450654-7450676 ATGTACATGTCCCATGTGCCAGG - Intronic
969499729 4:7545390-7545412 ATGGAGACTTACCATGTGCTGGG + Intronic
970607538 4:17694681-17694703 CTTGAGATCTACTATGTGCCAGG + Intronic
971119053 4:23683310-23683332 AGTACTATGTACCATGTGCCAGG - Intergenic
971165882 4:24183151-24183173 ATAGAGACTTACCATGTGCCAGG - Intergenic
971477167 4:27083288-27083310 ATTGAGCTGTACTATGTGCTGGG + Intergenic
972219968 4:36943663-36943685 AGTGATATTTACCATGTGCTAGG - Intergenic
972347583 4:38205764-38205786 ATTGAGATTTTCTATCTGCCAGG - Intergenic
972768989 4:42178674-42178696 ATTGAGCAGTACTATGTGTCAGG + Intergenic
973589172 4:52423171-52423193 ATTGAGACGTAAAATGTGGCAGG - Intergenic
973794130 4:54406392-54406414 ATAAAGATGTATCATGTGCATGG - Intergenic
974310948 4:60209428-60209450 ATTGGCTTGCACCATGTGCCTGG - Intergenic
974408632 4:61509421-61509443 ATTAAGATGTGATATGTGCCAGG - Intronic
975947189 4:79721186-79721208 ATTGACATTTACCATATGCTAGG - Intergenic
976014350 4:80532674-80532696 ATTGAATCTTACCATGTGCCAGG - Intronic
976483582 4:85573415-85573437 ATTAACAGTTACCATGTGCCAGG - Intronic
977027542 4:91838594-91838616 ATTGATTTGTACCATGTGGCAGG - Intergenic
977493696 4:97746868-97746890 ATTGCTATATACCATGTTCCAGG + Intronic
978853786 4:113369927-113369949 ATTGAGGGTTTCCATGTGCCAGG - Intronic
979306997 4:119157755-119157777 ATTGAGACTTACTGTGTGCCAGG - Intronic
980965747 4:139519033-139519055 ACTAAGCGGTACCATGTGCCGGG + Intronic
983408426 4:167363519-167363541 ACTGACATGTGCTATGTGCCTGG - Intergenic
985046438 4:185945786-185945808 TGTGAGATGTGCCATGTGCCCGG + Intronic
985100127 4:186450608-186450630 TTTGAGATGTTCCGTCTGCCTGG + Intronic
989652892 5:43713274-43713296 TTTGTTATGTGCCATGTGCCAGG + Intergenic
990068624 5:51750647-51750669 ATTGAGATTTAATATGTTCCAGG + Intergenic
991187463 5:63826592-63826614 ATTGAAAACTACCATGTGGCAGG - Intergenic
991900060 5:71451883-71451905 ATTGAGTTCTACCATATGCTGGG - Intergenic
992789336 5:80199405-80199427 ATTGAGTGATACCATGTGTCAGG - Intronic
993230855 5:85233973-85233995 ATTGAGATTTACTGTGTGCCAGG + Intergenic
994041400 5:95263711-95263733 ATTGAGCATTGCCATGTGCCAGG + Intronic
994176209 5:96714086-96714108 CTATTGATGTACCATGTGCCAGG + Intronic
994601114 5:101906673-101906695 ATTGATATGTACCATATACTGGG + Intergenic
995038113 5:107558035-107558057 ATTTATATATACCATGTGCCAGG - Intronic
995060780 5:107809833-107809855 ATTGAGTGCTACCATATGCCAGG + Intergenic
995396441 5:111691972-111691994 AGTGAGAAGTACTATGTTCCTGG - Intronic
995601390 5:113800835-113800857 ATTGAGAGTTACTATGTGCCAGG + Intergenic
996343987 5:122470121-122470143 ATTGAAATGTACCATTTCCAGGG + Intergenic
996664250 5:126039683-126039705 AATGAGATATACCATGTTCTTGG + Intergenic
997553415 5:134773211-134773233 ACAGACATGTACCATGTGCCTGG + Intronic
998556549 5:143130479-143130501 ATGGAGCTCTACCATGTGGCTGG - Intronic
998748089 5:145284949-145284971 ATTGAAACTTACTATGTGCCAGG + Intergenic
998781161 5:145658376-145658398 ATTGAGATGCAACATGTGATGGG + Intronic
999077136 5:148807027-148807049 ATTCAGTTTCACCATGTGCCAGG + Intergenic
1001567664 5:172710761-172710783 GTGAAGATTTACCATGTGCCAGG - Intergenic
1002968089 6:1987795-1987817 TTTGAAATTTGCCATGTGCCAGG + Intronic
1005331830 6:24758138-24758160 TTTGAGATGTACCATCTTTCTGG - Intergenic
1005394425 6:25366628-25366650 AATGAGATCTAGTATGTGCCAGG - Intronic
1007067662 6:39008218-39008240 ATAAAGATTTACCATGTACCAGG - Intronic
1007312057 6:40954542-40954564 ACTGAGCTGTACCATGAGCAAGG + Intergenic
1008493689 6:52111563-52111585 ACTGAGAACTACCATGTGCAGGG + Intergenic
1009528887 6:64784569-64784591 ATTGAGGTTTATGATGTGCCAGG - Intronic
1011305352 6:85919742-85919764 ATTGCTATGTGCCATGTGTCAGG - Intergenic
1011416431 6:87124594-87124616 ATTGACATTTATTATGTGCCAGG - Intergenic
1012482123 6:99678979-99679001 ATTGAGCTGTACCACATGGCAGG + Intergenic
1012501724 6:99895789-99895811 ATTTAGGTATAACATGTGCCAGG - Intergenic
1012885868 6:104845264-104845286 ATTGAGAGCTACTATGAGCCTGG - Intronic
1013667279 6:112361713-112361735 ATTGAGCTGTTCCATCTGCAGGG + Intergenic
1014009185 6:116457598-116457620 ATTGAGCTGTTCCATCTGCAGGG + Intergenic
1015193270 6:130495740-130495762 ATTGAGATATATCATGTTCATGG - Intergenic
1017115667 6:150974279-150974301 ATTGAGTCTTACCATGTGTCAGG - Intronic
1020202096 7:6087968-6087990 GTTGAGAGGTACTATGTCCCAGG - Intergenic
1020637665 7:10715896-10715918 ATTTAGATGCTCCATATGCCAGG - Intergenic
1021233859 7:18118597-18118619 ATTGACATTCACCATGTGCTAGG + Intronic
1021261898 7:18468693-18468715 ATTGATTTTTACCAGGTGCCAGG - Intronic
1021442741 7:20696976-20696998 ATTAAGGTTTAACATGTGCCAGG - Intronic
1022660442 7:32361722-32361744 AAAGAGATGTACAAAGTGCCAGG - Intergenic
1022799511 7:33762139-33762161 ATTGAGACTGATCATGTGCCAGG + Intergenic
1023613361 7:41993610-41993632 AATGATATGTTCCAAGTGCCTGG + Intronic
1023669407 7:42560384-42560406 AATAACTTGTACCATGTGCCTGG + Intergenic
1025302221 7:57826920-57826942 ATTATGAGCTACCATGTGCCAGG - Intergenic
1026121870 7:67544783-67544805 TATGAGATTTACCATGTGCCAGG + Intergenic
1027725574 7:81801701-81801723 ACTGAGTCTTACCATGTGCCAGG - Intergenic
1030271459 7:107673153-107673175 ATTGAGATATTCCAGGTGACTGG + Intronic
1031119228 7:117702002-117702024 ATGGAGATGTACCATGTCAATGG - Intronic
1033254490 7:139788537-139788559 ATTCAGAAGGACCATGGGCCTGG - Intronic
1033443876 7:141403694-141403716 ATTGAGGGGGACCATGTACCAGG - Intronic
1035929462 8:3764625-3764647 ATTGTGACTTACCATGTGTCTGG + Intronic
1036502583 8:9327234-9327256 ATTGAGAGCTACAATGTTCCAGG - Intergenic
1039876158 8:41588159-41588181 ATTGAGATCTAACATGTGACAGG + Intronic
1040422803 8:47256041-47256063 ATTGAAGTTTACTATGTGCCAGG - Intergenic
1041561272 8:59221947-59221969 ATTCAGATAGACCATGTTCCAGG + Intergenic
1041806676 8:61857837-61857859 AATGAGATGTACTATGTTCATGG + Intergenic
1043392608 8:79806396-79806418 ACTAACATGTACTATGTGCCAGG + Intergenic
1044933476 8:97271997-97272019 ATTGAGGCATATCATGTGCCAGG - Intergenic
1045375151 8:101565042-101565064 ATTGAGTTCTACTCTGTGCCAGG + Intronic
1046357148 8:113102377-113102399 ATTGAGATCTTCCAAGTGCCAGG + Intronic
1046600355 8:116309643-116309665 ATTGAAAACTACAATGTGCCAGG - Intergenic
1047578360 8:126183677-126183699 AGAGAGATGAACGATGTGCCAGG - Intergenic
1047720839 8:127637849-127637871 AATTGGATGTACCATGTGACAGG - Intergenic
1048164571 8:132051031-132051053 GTTGAGATCTTCCATGAGCCTGG - Intronic
1048407237 8:134136268-134136290 ATTGAGAGGTACACTGGGCCTGG + Intergenic
1048486142 8:134849359-134849381 ATTGAGACTTACCATGGGCCAGG - Intergenic
1048628719 8:136216515-136216537 TTTGAGATGTCCCATGTTCCAGG - Intergenic
1050587654 9:7129768-7129790 ACTGACATTTACCATGTTCCAGG + Intergenic
1052379265 9:27752549-27752571 ATTGACAAATACCATGTCCCAGG + Intergenic
1052774449 9:32719493-32719515 ATTTGCTTGTACCATGTGCCAGG - Intergenic
1052946911 9:34175979-34176001 ATTAAGTCCTACCATGTGCCAGG - Intergenic
1053180410 9:35963138-35963160 ATGGAGCGCTACCATGTGCCGGG + Intergenic
1053665187 9:40312412-40312434 AATGAGATGTCTCATATGCCAGG - Intronic
1053666069 9:40318435-40318457 AATGAGATGTTCCATATGGCAGG - Intronic
1053914771 9:42937459-42937481 AATGAGATGTCTCATATGCCAGG - Intergenic
1053915651 9:42943481-42943503 AATGAGATGTTCCATATGGCAGG - Intergenic
1054377224 9:64458463-64458485 AATGAGATGTTCCATATGGCAGG - Intergenic
1054518541 9:66057848-66057870 AATGAGATGTTCCATATGGCAGG + Intergenic
1054519430 9:66063872-66063894 AATGAGATGTCTCATATGCCAGG + Intergenic
1054863761 9:69978976-69978998 ATTGAGCACTACAATGTGCCAGG - Intergenic
1055077633 9:72232926-72232948 ATTGATTTGTGTCATGTGCCAGG - Intronic
1058369181 9:104245085-104245107 TTTGAGATTTACCATGAGCTAGG - Intergenic
1060146484 9:121257261-121257283 ATTAAGACCTACCATGTGTCAGG + Intronic
1060262183 9:122085518-122085540 TTTGAGATCTACTTTGTGCCAGG - Intronic
1060274445 9:122171793-122171815 ATTGAGCACTTCCATGTGCCAGG + Intronic
1060364895 9:123001296-123001318 ATTGAGAACTACTATGTTCCAGG - Intronic
1060385118 9:123218770-123218792 ATTATGATTAACCATGTGCCAGG + Intronic
1061409884 9:130414532-130414554 ATTGAGATTTTCCTTGTTCCTGG - Intronic
1061828864 9:133277743-133277765 ACTGAGCTCTTCCATGTGCCAGG - Intergenic
1186495919 X:10013198-10013220 TTTGTGATGTCGCATGTGCCAGG - Intergenic
1186992772 X:15087294-15087316 ATTGAGAGTTACAAGGTGCCTGG - Intergenic
1188131395 X:26437858-26437880 TTTCACATTTACCATGTGCCAGG + Intergenic
1188306015 X:28560555-28560577 ATTGAGCTATACCATGTACAAGG + Intergenic
1190818947 X:53954969-53954991 ATAGAGATTTCCCATATGCCTGG - Intronic
1191747850 X:64509564-64509586 ATTGAGATGAATCATGTGGGTGG + Intergenic
1192111102 X:68365731-68365753 GTGGAAATCTACCATGTGCCAGG + Intronic
1192197102 X:69035783-69035805 TTTGAGGCTTACCATGTGCCAGG + Intergenic
1192285200 X:69727903-69727925 TTTTTGATGTACTATGTGCCAGG + Intronic
1194227889 X:91284446-91284468 ACTGAGTTCTACTATGTGCCAGG + Intergenic
1194616931 X:96115870-96115892 ATTGATATCTACTCTGTGCCAGG - Intergenic
1194672221 X:96748246-96748268 ATTCATATGTGCAATGTGCCAGG + Intronic
1195773917 X:108382469-108382491 AGTGAGATGTTCTTTGTGCCTGG - Intronic
1196142026 X:112273898-112273920 GTTGAGATTTGCTATGTGCCAGG - Intergenic
1196722524 X:118868230-118868252 ATTGGGATGGGACATGTGCCAGG + Intergenic
1197916053 X:131536869-131536891 ATTGAGATTTACCATGTGCCAGG + Intergenic
1198395857 X:136218659-136218681 ATTGAGAAGCACCTTGGGCCTGG - Intronic
1198511661 X:137358156-137358178 ATTGAGCTCTACTGTGTGCCAGG - Intergenic
1199151275 X:144489815-144489837 ATAGGGATATACCATGTGCTAGG - Intergenic
1199842441 X:151664000-151664022 GATGAGATGTGCCAGGTGCCAGG - Intronic