ID: 1100853660

View in Genome Browser
Species Human (GRCh38)
Location 12:98739406-98739428
Sequence CCCCCACCTGTCCCATCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 231}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100853660_1100853664 4 Left 1100853660 12:98739406-98739428 CCAATGGATGGGACAGGTGGGGG 0: 1
1: 0
2: 0
3: 11
4: 231
Right 1100853664 12:98739433-98739455 GCGTTGGATTTGCCAGCACCTGG 0: 1
1: 0
2: 2
3: 14
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100853660 Original CRISPR CCCCCACCTGTCCCATCCAT TGG (reversed) Intronic
900124780 1:1064547-1064569 CCCCCACCTTCCCCATCAATGGG - Intergenic
900523012 1:3115267-3115289 GCCCCAGCTGTCCCATCAGTGGG + Intronic
900916985 1:5646075-5646097 CCAGCACCTGTCACAGCCATGGG + Intergenic
901738613 1:11327935-11327957 ACTCCACCTTTCCCATCCAGAGG - Intergenic
901860401 1:12070655-12070677 CTCCCACCAGACCCATCCACAGG - Intronic
902196859 1:14804358-14804380 GCCCCACCCAGCCCATCCATGGG - Intronic
902271517 1:15308452-15308474 CCCTCCCCTGTCCCTTCCACTGG + Intronic
903265694 1:22156691-22156713 CCCACTGCTCTCCCATCCATAGG + Intergenic
903699667 1:25237454-25237476 CCCACACCTGGCCTCTCCATTGG + Intergenic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
909884938 1:80929699-80929721 TTCCCACCAGGCCCATCCATGGG + Intergenic
912516158 1:110217759-110217781 TCCCCTCCTCTCCCCTCCATGGG - Intronic
912576513 1:110676243-110676265 CCACCACCACTCCCAACCATGGG + Intergenic
915075796 1:153307357-153307379 GCCCGACCTGCCCCATGCATGGG + Intronic
915734330 1:158075168-158075190 CCCCCACCACTCCCACCCACTGG - Intronic
918110165 1:181448783-181448805 CCTCCACCTGTCACACCCAGGGG - Intronic
920499059 1:206474843-206474865 CCCCTCTCTGTCCCACCCATAGG + Exonic
922135795 1:222825134-222825156 CCCCCACATTCCCCATCCCTGGG - Intergenic
923447931 1:234089740-234089762 CCCCAACCTATCCCCTCCAGTGG - Intronic
1063972485 10:11390883-11390905 CCCCCACCCTTCCCAGCCTTTGG - Intergenic
1065512379 10:26492227-26492249 CCCCCAAGAGCCCCATCCATGGG - Intronic
1066240267 10:33526891-33526913 CTCCATCCTGTCCCATCCCTGGG + Intergenic
1068030341 10:51698312-51698334 CTACCACCTCTACCATCCATAGG + Exonic
1068367904 10:56076417-56076439 CCCCCACCTACCCTTTCCATGGG - Intergenic
1069851417 10:71407595-71407617 CCCACACCTTTCCCCGCCATTGG + Intronic
1070461845 10:76678127-76678149 CCCCACCCTGTCCATTCCATCGG - Intergenic
1072563147 10:96595584-96595606 CCTCCACCTGTTCCACCCAGAGG - Exonic
1073266607 10:102231488-102231510 ACCCCACCTGCCCCCTCCCTCGG - Intronic
1074536121 10:114329655-114329677 CCCTCTGCTGTCCCATCCATTGG - Intronic
1074784323 10:116825684-116825706 CCCCCACCAATCCCAGCCCTGGG - Intergenic
1075651413 10:124130107-124130129 CACCCACCTCTCCCACCCACAGG - Intergenic
1076370434 10:129949487-129949509 CCCCCACGAGTCCCATCACTTGG - Intronic
1076415394 10:130283657-130283679 ACCACACTTGTCCCATTCATAGG + Intergenic
1076810279 10:132882794-132882816 TCCCCTCCTTCCCCATCCATGGG - Intronic
1079136094 11:17776728-17776750 CCCGCCCCTGCCCCATCCTTTGG - Intronic
1079248884 11:18772992-18773014 CCCCCTCCTGTCTCATCCCACGG - Intronic
1081055581 11:38406596-38406618 CCTCCACCTGACCCATGCAGCGG + Intergenic
1083633733 11:64109096-64109118 CTTTCACCTGTCCCATCCCTGGG - Intronic
1083827424 11:65211473-65211495 CCCCTGCCTGTGCCAGCCATGGG + Exonic
1084417700 11:69042980-69043002 CTCCTGCCTGCCCCATCCATGGG - Intergenic
1084893538 11:72249578-72249600 CCCACAGCTGTCCCTTCCTTTGG + Intergenic
1084941302 11:72614816-72614838 CCCCAGCCTCTCCCCTCCATTGG - Intronic
1085026122 11:73237655-73237677 CCCCCACCTGTGCCTGCCACAGG - Intergenic
1088389155 11:109294668-109294690 CCCACACCTTTCCCAGCCACTGG - Intergenic
1089638935 11:119834178-119834200 GCCCCACCTGGGCCATCCTTAGG - Intergenic
1089805851 11:121088135-121088157 TTCCCACCTGTGTCATCCATTGG + Exonic
1091205601 11:133818702-133818724 CCACCATCTGTCCCATCCAGTGG - Intergenic
1092111411 12:5967542-5967564 CCCCCACCTGCACCATGCAGCGG + Exonic
1092283293 12:7113702-7113724 CCCCCACGTGTCCCAGCCCAGGG - Intergenic
1095431490 12:42139454-42139476 CCCCCACTAATCCCATTCATGGG - Intronic
1095592002 12:43914145-43914167 CCCCCGACTCTCCCATGCATTGG - Intronic
1099584780 12:84503134-84503156 CCCCAGGCTGTACCATCCATTGG + Intergenic
1100853660 12:98739406-98739428 CCCCCACCTGTCCCATCCATTGG - Intronic
1101788780 12:107910172-107910194 CCCCCGCCTGTGCCTTCCCTGGG + Intergenic
1103935571 12:124474804-124474826 CCCCGCCCTGTGCCATCCTTGGG + Intronic
1105299156 13:19117509-19117531 CCACGACCTGACCCAGCCATGGG + Intergenic
1105806313 13:23953550-23953572 CCCCGACCCGTCCCTGCCATGGG + Intergenic
1111019060 13:82422277-82422299 CCCACACCTATCCTATCAATAGG + Intergenic
1113064163 13:106357189-106357211 CCCCCACCTGCCCCAGTCACTGG + Intergenic
1115335925 14:32244383-32244405 TCCCAACCTGTACCATCCACTGG + Intergenic
1118443095 14:65829464-65829486 CCCCACCCTGTCCCCTCCAGAGG - Intergenic
1119555691 14:75550745-75550767 CCCCCACAGGACCCATCCCTTGG + Intergenic
1119558527 14:75571644-75571666 CTCCCAACTTTCCCACCCATGGG + Intergenic
1122885875 14:104710029-104710051 CCCCCACCTGTCCCTGCCAGAGG - Intronic
1124689746 15:31812025-31812047 TCACCACCTGCCCCATCCCTGGG - Intronic
1124833439 15:33172519-33172541 CCCCTTTCTGTCCCATCCCTTGG - Intronic
1127312866 15:57767867-57767889 CCCCTGCCTGTCCCATCCCATGG - Intronic
1127594147 15:60461091-60461113 CCCCCACCCCACCCATCCCTAGG - Intronic
1129034164 15:72639734-72639756 ACACCCCCTGTCCCATGCATGGG + Intergenic
1129152953 15:73700534-73700556 CCCCCAAATGTCCCCTCCAAGGG + Intronic
1129215718 15:74097482-74097504 ACACCCCCTGTCCCATGCATGGG - Intergenic
1129732851 15:77941810-77941832 ACACCCCCTGTCCCATGCATGGG - Intergenic
1130419538 15:83730343-83730365 CCTCCACCTGTAAAATCCATTGG - Intronic
1132355843 15:101170682-101170704 CCCCTGCCTGTCCCATCTCTTGG + Intergenic
1132742170 16:1420317-1420339 CCCACACCTGTCTCAACCACTGG + Exonic
1133671908 16:8031091-8031113 CTCCCACCAGTCCCTCCCATGGG + Intergenic
1137716585 16:50601925-50601947 CCCCAGCCTCTCCCATCCCTGGG + Intronic
1138339282 16:56278273-56278295 CCAGCACCTGGCCCATCCCTAGG + Intronic
1138585793 16:57969878-57969900 CCCACCCCTCTCCCAGCCATGGG + Intronic
1138594648 16:58023323-58023345 CCCCCAGCTCTCCCCTCCAGGGG - Intergenic
1144150036 17:12434440-12434462 TCTCCTCCTGTCCCATCCTTCGG - Intergenic
1144850828 17:18243053-18243075 CCACCACCTGTCACATGCAAGGG - Intronic
1145826755 17:27882819-27882841 GCCCCTCCTGTCCCATCCCATGG + Intronic
1145836379 17:27957042-27957064 CCCCCGCCTTTCCCATCCCCAGG - Intergenic
1146270932 17:31485385-31485407 CCCCTCCCTGTCCCCACCATGGG - Intronic
1148475785 17:47927859-47927881 CCCCCACCTGTGTCCTCCCTGGG + Exonic
1149087030 17:52730500-52730522 CCTCCACCTGTCCTGTCCAGTGG + Intergenic
1150004802 17:61463018-61463040 GCCCCCTCTGTCCCCTCCATTGG - Intronic
1152850339 17:82630144-82630166 CCCACACCTGCCCCATCCTCTGG + Intronic
1156324586 18:36062773-36062795 CCCCCATCTCTCCCAACCCTAGG - Intronic
1157174728 18:45441085-45441107 CTCCCAACTGTCCCTTCCCTCGG + Intronic
1160123589 18:76151200-76151222 CCACCACCTGGCCCACCCCTGGG - Intergenic
1160792014 19:927408-927430 TCCCCACCTGCCCCCTCCACCGG + Intronic
1161244169 19:3239963-3239985 CCCTCATCTGTCCCCTCCAATGG + Intronic
1161338248 19:3726177-3726199 CCTCCACCTGTCCCCTGCCTGGG + Intronic
1161400428 19:4064730-4064752 CACCCACCTGGCTCACCCATGGG - Intronic
1161761146 19:6173531-6173553 CTCCCACCTATCCTTTCCATGGG + Intronic
1161826711 19:6572372-6572394 TCCCCAGCTGACCCATCCATAGG - Intergenic
1161937848 19:7383042-7383064 CCCACCTCTGTCCCATCCAGGGG + Exonic
1162097819 19:8321329-8321351 CCGCCACCCGTCTCATCCAGCGG - Exonic
1162111527 19:8402387-8402409 CACCCACCTGGCCCATCCCAAGG - Intronic
1162155642 19:8676639-8676661 ACTCCACCTGTCCCCTCCATGGG + Intergenic
1162373538 19:10292425-10292447 CCCCCACCTGCCCCGCCCCTCGG - Intronic
1162401786 19:10451008-10451030 CGCCCACTGGTCCCATCCAGCGG - Intronic
1163618076 19:18341220-18341242 CCCCCACCTGCCCCTGCCTTGGG - Intronic
1163686906 19:18716897-18716919 CCCAAACCTGTCCCTTCCTTAGG - Intronic
1164712694 19:30368791-30368813 CCTCCACCAGTCCCCTCCCTTGG - Intronic
1164807590 19:31128873-31128895 CCCCGACATGTCCCACCCATGGG + Intergenic
1165595978 19:37011537-37011559 CCCCCACCTCTCCAATGCCTAGG - Intronic
1166619966 19:44288292-44288314 CCCACAACTGTCACATCTATAGG + Exonic
1167915794 19:52739372-52739394 CCCCAACCTGTCCCAGCCTGAGG + Intergenic
1168392947 19:56025757-56025779 GCCCCTCCTGTTCCATCCCTTGG - Intronic
1168657609 19:58142213-58142235 CCCCCATCTTTCCCAGCCCTAGG - Intronic
925134225 2:1515207-1515229 CCCCCACCTCTAGCAGCCATGGG + Intronic
926216253 2:10907325-10907347 CCCCCACCTGTCCCAGCATCTGG + Intergenic
927217258 2:20674878-20674900 CTCCCTCCTGTTCCATCCACGGG - Intergenic
927272221 2:21223933-21223955 CCCCCACCCATACCACCCATAGG - Intergenic
927890064 2:26742575-26742597 CCCCAACCACTCCCAGCCATGGG - Intergenic
928588227 2:32784812-32784834 TCCCCAGCTCTCCCATCCACAGG - Intronic
930626111 2:53699194-53699216 CACCCACCAGTCCCATCACTGGG + Intronic
935699960 2:105802796-105802818 CCCCCATGTGTCACATACATGGG + Intronic
936271023 2:111049061-111049083 TCCCCAACTGTCCCCTGCATGGG - Intronic
937359072 2:121216760-121216782 CACCCACCTGACCCATCCAAGGG + Exonic
937781936 2:125848569-125848591 CACCCCCCTGCCACATCCATTGG - Intergenic
938301086 2:130213612-130213634 CCCCGACCGGCCCCATCCAGCGG + Intergenic
938312392 2:130301726-130301748 CCACAACCTGACCCAGCCATGGG - Intergenic
938455630 2:131460855-131460877 CCCCGACCGGCCCCATCCAGCGG - Intergenic
941115982 2:161472695-161472717 ACCCCACCACTCCCATCTATGGG - Intronic
946089308 2:217206827-217206849 CTCCCACGTGCCCCATTCATAGG + Intergenic
946692594 2:222320196-222320218 CCCCCGCCTGGCCCAGCCAGCGG - Intergenic
946706255 2:222461425-222461447 CCCCCACCTGCCCAGTCCGTGGG - Intronic
946919693 2:224566066-224566088 CCCCCACCTTCCCCATCTACAGG + Intronic
948436955 2:237960461-237960483 CCCCCATCTGCCCCAGCTATGGG + Intergenic
948759170 2:240179837-240179859 GCCCCACCTGTGCCAGCCCTAGG + Intergenic
1168927504 20:1594983-1595005 CCCCCACCTCCCCCAGACATTGG - Intronic
1169380714 20:5104861-5104883 CCCCTACCTTTCCCAGCCTTTGG - Intronic
1169912194 20:10656001-10656023 CCCCGACTTTTCCCATCAATAGG - Intronic
1171175949 20:23050736-23050758 CCCCCACCCTGCCCATCCACAGG - Intergenic
1171299933 20:24051343-24051365 CCACCACCTGTCTCATCCTCAGG + Intergenic
1171409203 20:24934792-24934814 TCCCCACCTGTCCCATGCAAAGG + Intergenic
1173235303 20:41239692-41239714 CCCTCCCCAGTCCCTTCCATAGG - Intronic
1175138888 20:56845000-56845022 TCCCATCCTGTCACATCCATGGG + Intergenic
1178442611 21:32611519-32611541 CCCCCATCTGTGCTGTCCATTGG - Intronic
1178724070 21:35035776-35035798 CCCCCACCTGTGCCCCACATGGG - Intronic
1178724328 21:35037557-35037579 CACCGACCTGTCCCCTCCACGGG + Intronic
1179603030 21:42493605-42493627 CTCCAACCTGTCCCTTCCATCGG - Intronic
1179709824 21:43206874-43206896 CCCCCACCTACCCCCTCCCTTGG - Intergenic
1180956363 22:19743175-19743197 TCCCCATCTGTCCCCTCCAGAGG + Intergenic
1180993701 22:19953956-19953978 CCCCCTCCCCTCCCTTCCATGGG - Intronic
1181162394 22:20966294-20966316 GCCCCACCTGCCCCTTCCCTGGG - Intronic
1181442357 22:22943237-22943259 CACCCACCTGTCACATACACAGG + Intergenic
1181600999 22:23951862-23951884 CCCCAGCCAGTTCCATCCATAGG - Intergenic
1181607510 22:23989464-23989486 CCCCAGCCAGTTCCATCCATAGG + Intergenic
1182002993 22:26936389-26936411 CCCCTACCTGTCCCATTGACTGG + Intergenic
1183401795 22:37609111-37609133 CGCCCACCTGTCGGATCCCTGGG + Intronic
1184655661 22:45940808-45940830 TCCTCACCTCTCCCATCCTTTGG - Intronic
1184752952 22:46499660-46499682 CCCCCATCTGTCCCTACCACAGG + Intronic
1185238340 22:49727379-49727401 CCCTCACCCGTCCCCTCCGTGGG + Intergenic
949111398 3:265669-265691 TCCCCACATCTCCCACCCATAGG - Intronic
949493396 3:4610140-4610162 CCTCTTCCTGTCCCACCCATTGG + Intronic
949987272 3:9551333-9551355 CCCCCACCCCTCCCATCCCCTGG + Intronic
952036904 3:29213674-29213696 CCATCACCTTTCACATCCATTGG + Intergenic
952783747 3:37131141-37131163 TCCCCACCCCTCCAATCCATGGG - Intronic
953659679 3:44883055-44883077 CACCCACCTGCCCAGTCCATGGG + Intronic
954124509 3:48520689-48520711 CTCCCTTCTGGCCCATCCATTGG - Intronic
954274100 3:49531463-49531485 CCCACACCTGTCACTGCCATTGG + Exonic
954575643 3:51674588-51674610 GGCCCACCAGGCCCATCCATGGG - Intronic
955024296 3:55152643-55152665 TCCCAACCTGGCCCCTCCATCGG - Intergenic
958490081 3:94761511-94761533 TTCTCCCCTGTCCCATCCATAGG - Intergenic
961677785 3:128578018-128578040 CCCCCACCTCTCCCGGCCCTGGG - Intergenic
966874845 3:184315824-184315846 CCCCCACCCGCCCCATCCCCCGG + Exonic
966876196 3:184323203-184323225 TCCCCACCTGGCCCACCCCTTGG - Exonic
967009886 3:185422924-185422946 CCACCTCCTGTCAGATCCATGGG + Intronic
968036213 3:195550197-195550219 CCCCCACCTGCCTCAGCCACGGG - Intergenic
970183991 4:13430414-13430436 CCCCCACCTACCCTTTCCATGGG - Intronic
976670737 4:87649951-87649973 CCTCCGCCTTTCCCATCCTTGGG + Intergenic
976857039 4:89616564-89616586 CCACCTGCTGTCCCATTCATGGG - Intergenic
979146142 4:117251308-117251330 CTCCCAGCTGTTCCAGCCATGGG + Intergenic
981663409 4:147194305-147194327 CACCCAGCTGTCCCATGGATTGG + Intergenic
982273486 4:153615830-153615852 CCTCCACCTGCCACATGCATGGG + Intronic
992168544 5:74078616-74078638 TACCCAACTGTCCCCTCCATTGG + Intergenic
993870565 5:93249019-93249041 CCCCCACCTCTCCCTTCCTCTGG - Intergenic
996377707 5:122831105-122831127 CCACCACATATCCCTTCCATAGG + Intergenic
997384858 5:133464619-133464641 CCTGCACCTCTCCCCTCCATGGG - Intronic
997588907 5:135061129-135061151 CCTCTACCTGTCCCAGCCCTGGG + Intronic
1001397609 5:171428331-171428353 CCAGCACCTATCCCAGCCATTGG + Intronic
1001713405 5:173795483-173795505 CTGCCACCTGCCCCATCCAGGGG - Intergenic
1002668953 5:180849542-180849564 CTCACACCTGTCACATTCATAGG + Exonic
1006850340 6:37093482-37093504 CCCCCACCTGCTCCAGCCAGGGG - Intergenic
1007170230 6:39857511-39857533 CCACCACTTGCCCCATCCAGAGG - Intronic
1008265172 6:49416211-49416233 CCCCCACCTTCTTCATCCATAGG - Intergenic
1011302062 6:85886221-85886243 TCCCCACCTGTATCATCCACTGG - Intergenic
1017754370 6:157517249-157517271 CACCCACCACTCCCATCCCTGGG - Intronic
1017808599 6:157967567-157967589 CCAGCACCTGTCCCACCCAGCGG + Intergenic
1019785980 7:2977764-2977786 CCACAACCTGTCTCATCCCTTGG - Intronic
1022496481 7:30856097-30856119 CCCCCACCTCTGCCTCCCATTGG + Intronic
1023373820 7:39536837-39536859 CCCCCTCCTCTCCCATCCTCAGG - Intergenic
1024389018 7:48786075-48786097 CCCCTACCTGTCCTGTCCACTGG - Intergenic
1026872465 7:73861348-73861370 GCCCTGCCTGTCCCATCCAGTGG + Intronic
1026888648 7:73969402-73969424 CCCTTACCTGGCCCAGCCATGGG - Intergenic
1029664239 7:101984297-101984319 CAGCCACTGGTCCCATCCATAGG - Intronic
1033419313 7:141192356-141192378 CCCCCACCTCTCCCTTCCCCAGG - Intronic
1034592415 7:152152857-152152879 GCTCCAGATGTCCCATCCATGGG - Exonic
1035043570 7:155948720-155948742 CGGACACCTGTCCAATCCATGGG + Intergenic
1035697876 8:1614050-1614072 CCCCCACCTGGCTCTTCCAAAGG - Intronic
1040049642 8:43000568-43000590 CCCCCTCCTGCCCCATGCTTTGG + Intronic
1042180645 8:66083983-66084005 CCCTCACCTGTGCCTTCCAAGGG - Intronic
1044877526 8:96684635-96684657 CACCCACATGTTCCATCCAGGGG - Intronic
1047104758 8:121720258-121720280 CCCCCACACCTCCCATCCAGAGG - Intergenic
1049163411 8:141111926-141111948 TCCCCACCTGCCCCATGCAGCGG - Intergenic
1049487936 8:142876139-142876161 CGCCCACGTGTCCCATCCCCAGG - Intronic
1050473613 9:6018547-6018569 ACCACACCTGGCCCATTCATTGG + Intergenic
1051889551 9:21928145-21928167 TCCCAACATGTACCATCCATTGG - Intronic
1055862663 9:80771775-80771797 CCACCACGTGTCTAATCCATGGG - Intergenic
1056739236 9:89238643-89238665 TCCCCACCTCCCCCATCCCTAGG - Intergenic
1058104680 9:100956592-100956614 ACCACACCTGGCCCATCCTTTGG - Intergenic
1059331384 9:113537788-113537810 CCCCCAACTGCCCCCTGCATAGG - Intronic
1060300353 9:122371334-122371356 CCCCCTCCTTTCCCCTCCAGCGG + Intronic
1060916115 9:127392008-127392030 CCCCCACCTGTGCCTTCAAGGGG + Intronic
1060989979 9:127843063-127843085 CCCCCACCCGACCCTGCCATGGG + Intronic
1061559993 9:131395688-131395710 CCAGCACCTGTGGCATCCATGGG - Intronic
1061999170 9:134207427-134207449 TCCCCACCTGTCCTCCCCATCGG + Intergenic
1062261862 9:135666833-135666855 TCCCCTCCTGTCCCCTCCCTGGG + Intergenic
1062299446 9:135856864-135856886 CACGCTCCTGGCCCATCCATGGG + Intronic
1062440241 9:136566465-136566487 CCCCCACCTTCCCCATCCAGAGG - Intergenic
1062537252 9:137026505-137026527 TCCCCACCTGCTCCAGCCATGGG + Intronic
1185695496 X:2191240-2191262 CCCTCACCTTGCCCATCCACAGG - Intergenic
1185870126 X:3657935-3657957 ACCCCACCCGTCCCATCTTTAGG - Intronic
1186703651 X:12118642-12118664 CCCACACCTGTGCCATCCGGTGG + Intergenic
1188004472 X:25007496-25007518 CCCCTACCCGTCCCTTCCCTTGG + Intronic
1188324796 X:28787980-28788002 CCCCATCCTGTCCCAGCCCTTGG - Intronic
1189261035 X:39678998-39679020 CCCCCACCCGCCCCATACACTGG + Intergenic
1190777541 X:53565030-53565052 CTCCCACCTCTCCAGTCCATTGG + Intronic
1193276976 X:79601280-79601302 CCCCCACCTATCCTTTCCACGGG - Intergenic
1194268296 X:91780557-91780579 CGCCCACCTATCCCATAAATAGG + Intronic
1195777520 X:108424123-108424145 CCCCCATTTGCCCCATCAATCGG - Intronic
1195897202 X:109758686-109758708 CCACCACCTATCCCAGCCTTTGG - Intergenic
1196410130 X:115409929-115409951 TCCTAACCTGTCCCTTCCATTGG + Intergenic
1198398880 X:136251109-136251131 CCCGCCCCTGTCCCATCCCAGGG + Intronic
1198910355 X:141606867-141606889 ACTCCACCTGTCCAATCCCTTGG - Intronic
1199265341 X:145821195-145821217 CCCCCACCCCTGCCCTCCATAGG + Exonic
1199571379 X:149270299-149270321 CCCCCACATGTCCCAGGCACAGG + Intergenic
1201730327 Y:17195245-17195267 CCCCCACCCTTCCCAGCCTTTGG + Intergenic