ID: 1100853804

View in Genome Browser
Species Human (GRCh38)
Location 12:98740417-98740439
Sequence CAAGCTCCTGAGAATGTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100853804_1100853809 22 Left 1100853804 12:98740417-98740439 CCCATAACATTCTCAGGAGCTTG 0: 1
1: 0
2: 2
3: 11
4: 139
Right 1100853809 12:98740462-98740484 GTGCATATTAACCCAGCTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 137
1100853804_1100853810 23 Left 1100853804 12:98740417-98740439 CCCATAACATTCTCAGGAGCTTG 0: 1
1: 0
2: 2
3: 11
4: 139
Right 1100853810 12:98740463-98740485 TGCATATTAACCCAGCTGTGGGG 0: 1
1: 0
2: 0
3: 19
4: 222
1100853804_1100853808 21 Left 1100853804 12:98740417-98740439 CCCATAACATTCTCAGGAGCTTG 0: 1
1: 0
2: 2
3: 11
4: 139
Right 1100853808 12:98740461-98740483 TGTGCATATTAACCCAGCTGTGG 0: 1
1: 0
2: 1
3: 13
4: 167
1100853804_1100853807 -2 Left 1100853804 12:98740417-98740439 CCCATAACATTCTCAGGAGCTTG 0: 1
1: 0
2: 2
3: 11
4: 139
Right 1100853807 12:98740438-98740460 TGCTGGACAGCACAGATGTTTGG 0: 1
1: 0
2: 5
3: 15
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100853804 Original CRISPR CAAGCTCCTGAGAATGTTAT GGG (reversed) Intronic
900854450 1:5169805-5169827 TAAGCTCCTGTGATTGTTGTTGG + Intergenic
901441646 1:9281812-9281834 TCAGCTCCTGGGAATGTCATGGG - Intergenic
905113487 1:35616375-35616397 CAAAATCCTTAAAATGTTATTGG - Intronic
911440973 1:97925329-97925351 TCAGCTCCTGGGAATGTTAGTGG + Intergenic
912166578 1:107048512-107048534 CAAGCTCATGTGATTGTTGTTGG - Intergenic
913347572 1:117823952-117823974 CAAGCTCCAGTGAAGGTTTTGGG - Intergenic
916297489 1:163235902-163235924 AAAGCTCCTGAGAATTTTAAAGG - Intronic
917202926 1:172536243-172536265 CAGGCTCCTGAGTACTTTATAGG + Intronic
918509513 1:185295277-185295299 CAAACTCATGTGAATGTCATGGG - Intergenic
918601365 1:186366428-186366450 CAATCTACTGTGTATGTTATTGG + Intronic
923810855 1:237313939-237313961 AAAACACCTGAAAATGTTATTGG - Intronic
1063761749 10:9086461-9086483 CAAGGAGCTGAGTATGTTATGGG + Intergenic
1065245025 10:23748060-23748082 GAAGCACCTGAGAATGTCAGAGG - Intronic
1067132026 10:43574033-43574055 CAGGCTCCTGAGAATGAGGTCGG - Intronic
1069160818 10:65090503-65090525 CAAACTCCTCAGAATTTCATGGG - Intergenic
1071730136 10:88239696-88239718 CAAGATATTGAGAAAGTTATTGG - Intergenic
1073670518 10:105582553-105582575 CAAGATTCTGATAATGATATTGG + Intergenic
1073739361 10:106388960-106388982 CAAGTTTCTGAGATTGTTAATGG - Intergenic
1074475941 10:113774520-113774542 AAAGGTCCTGAGGATGTCATCGG - Intronic
1074608510 10:114998929-114998951 CAAACTACAGGGAATGTTATGGG - Intergenic
1077361573 11:2143039-2143061 AAAGCTATTGAGAATGTTGTGGG - Intronic
1078353091 11:10611401-10611423 CAAGCTCCTGAGATATCTATAGG + Intronic
1078911007 11:15731830-15731852 CAAGCTCCTGACAAAGGTCTTGG - Intergenic
1079290819 11:19186226-19186248 TATGCTGCTGAGAAGGTTATGGG - Exonic
1079560425 11:21813359-21813381 CAGGCTCATGAGAGTGTAATGGG + Intergenic
1081356318 11:42118671-42118693 ACAGCTCCTGAAAATGTTATTGG - Intergenic
1087415456 11:97850070-97850092 CAAGTACCTGAAAATGTAATTGG - Intergenic
1090514471 11:127411202-127411224 AAAGCTCCTTAAACTGTTATGGG + Intergenic
1091543817 12:1486995-1487017 CAAGCTACAGAAAAGGTTATGGG - Intronic
1092177568 12:6421126-6421148 CAAGCCCCTGAGAAACTAATAGG + Intergenic
1092187515 12:6491974-6491996 AAAGTTGGTGAGAATGTTATTGG - Exonic
1098045907 12:66400386-66400408 CAAGCTCCCAAGAATGATCTTGG - Intronic
1098393363 12:69992605-69992627 CAAACTCCTGACATTGTGATCGG - Intergenic
1098634774 12:72768916-72768938 AAAGCTTCTGAGAATATAATTGG + Intergenic
1100853804 12:98740417-98740439 CAAGCTCCTGAGAATGTTATGGG - Intronic
1103640883 12:122351103-122351125 GAAGATCCTGAGAATGTAAGAGG - Exonic
1105719360 13:23099105-23099127 AGAGCTCCTGAGATTGTTATGGG - Intergenic
1107692131 13:42964239-42964261 CAAGAGCATGAGAATGTTAAGGG - Intronic
1109337863 13:61015635-61015657 AAAGCTCCTCATAATATTATGGG + Intergenic
1110614945 13:77531051-77531073 CCAGCTCCTCAGGGTGTTATGGG - Intergenic
1112610274 13:100948588-100948610 CCACCTCCTGAGAATGATACTGG - Intergenic
1112746653 13:102534426-102534448 CAAGCTACTTTGAATGTTGTAGG + Intergenic
1115088969 14:29551110-29551132 AAAGTTCCTGACAATTTTATGGG - Intergenic
1115512155 14:34148193-34148215 CAAGGTCCTGAGAAAGTAAATGG + Intronic
1115961167 14:38837304-38837326 CATGCTCCTGAGAAGTTTCTGGG - Intergenic
1125029508 15:35062097-35062119 CATCCTCCTTAGAAGGTTATAGG - Intergenic
1127113703 15:55702289-55702311 TAAGCTCCTGGGAATATTAAAGG - Intronic
1130242291 15:82206005-82206027 GAAGCTGCTGAGCAGGTTATGGG - Intronic
1130458089 15:84134817-84134839 GAAGCTGCTGAGCAGGTTATGGG + Intergenic
1133843175 16:9428717-9428739 CCAGCTGCTGAGAATATTATTGG - Intergenic
1136384627 16:29915702-29915724 CACGCTTCTGAGAAGGTTAAAGG - Intronic
1139493686 16:67301123-67301145 GAAGCTACTGTGCATGTTATAGG - Intronic
1141666054 16:85465808-85465830 CAAGCTACTGAGTATGTAGTAGG + Intergenic
1147632088 17:41938743-41938765 CAGGCTCTTGAGGATGTAATGGG - Exonic
1149722190 17:58856573-58856595 CCAGCACCTCAGAATGATATAGG + Intronic
1153872310 18:9332725-9332747 CAACCTCCTGAAAATGTCTTGGG - Intergenic
1167583595 19:50360603-50360625 AAAGCTCCTGAGTATTTTGTTGG + Intronic
925677937 2:6385935-6385957 AAAGCTCCTTAGTATGTTATCGG + Intergenic
926404789 2:12540157-12540179 CATGCTCTTGAGGACGTTATCGG - Intergenic
928044138 2:27910524-27910546 CAAGGTGCTGATAATGTTCTGGG - Intronic
929444682 2:41992584-41992606 CAAGTTCCTAAGCATGATATTGG - Intergenic
929451145 2:42038339-42038361 ACTGCTCCTGAGATTGTTATAGG + Intergenic
930690679 2:54360370-54360392 ACAGCTCCTGAGAATTTTGTTGG - Exonic
931716793 2:65035471-65035493 TAAGCTCCTGAGTATAGTATGGG - Intergenic
934863842 2:97788317-97788339 CACGTTGCTGAGAATGTTGTAGG - Intronic
935612855 2:105043854-105043876 CAAACTCCTGAGCTTGTGATCGG + Intronic
936464801 2:112738029-112738051 CAAGCCCCAGAGACTGTTGTAGG - Exonic
937765893 2:125659995-125660017 CAAGCACCTCAGAAGGTCATGGG - Intergenic
937799658 2:126068045-126068067 CAACCTGCTCACAATGTTATTGG - Intergenic
943688367 2:190843135-190843157 CAAGTTCCTGAGAATATCATTGG + Intergenic
943979738 2:194532998-194533020 TAAGCTCCTGAGGATATTTTAGG + Intergenic
944391943 2:199227145-199227167 CAAGCTTGTGAGAATGTGACAGG - Intergenic
944907440 2:204276558-204276580 TGAGATCCTGAGAATGTTCTTGG - Intergenic
946066172 2:216989099-216989121 CTAGCTCATGGGATTGTTATGGG + Intergenic
948318927 2:237053517-237053539 CAAACTCCTGAGAATCTCCTGGG - Intergenic
948335435 2:237203486-237203508 CAGGCTCCTGAGAATATCAGAGG + Intergenic
948897275 2:240933328-240933350 CAAGCTCCTGGGGAGGTAATGGG + Intronic
1168927484 20:1594763-1594785 CAACCTCATAAGATTGTTATGGG + Intronic
1169559953 20:6788887-6788909 TAGACTCCTGAGAATGTTCTTGG - Intergenic
1173599709 20:44285035-44285057 CCAGGTCCTGAATATGTTATTGG - Intergenic
1178996506 21:37405517-37405539 AAAACTCCTGAGAAAGTAATAGG - Intronic
1183138351 22:35912329-35912351 TGAGCTCCTGAGAATGTTGATGG - Intronic
1183345341 22:37304344-37304366 CAAACTCCTGAGGCTGTCATTGG - Intronic
1184659237 22:45958269-45958291 AAAGCTCCTGAGAATGTTGGAGG - Intronic
950116693 3:10455339-10455361 CAAGAGCCTGAGAATCTTCTGGG - Intronic
960256551 3:115516852-115516874 CAGGCCTCTGAGCATGTTATAGG + Intergenic
961063444 3:123853062-123853084 AAAGCTCCTAAGAATCTTAAGGG + Intronic
965096989 3:164242480-164242502 CATACTACTTAGAATGTTATAGG - Intergenic
969410036 4:7022067-7022089 GAAGCTCCTGATAATGATGTGGG + Intronic
970604729 4:17668325-17668347 CAAGCTACTAAGAATGATATAGG - Intronic
971062609 4:22989564-22989586 AAAACTCCTGAGCATGTCATTGG - Intergenic
971826635 4:31631792-31631814 CAAGGTCCTGAGGATGGTATAGG + Intergenic
972776929 4:42250066-42250088 CCAGCTCCTGCTAAGGTTATGGG - Intergenic
972883757 4:43458733-43458755 CTAGCTTCTAGGAATGTTATTGG - Intergenic
974367191 4:60965454-60965476 CAAGAACCTGAGACTGTTTTTGG + Intergenic
975764372 4:77651725-77651747 CAAGGTCCTTAGAAGGTGATTGG + Intergenic
976366725 4:84240995-84241017 CAAGATCCTAAGGATGGTATGGG - Intergenic
977118923 4:93072062-93072084 CAAGCACTTAAGTATGTTATAGG + Intronic
977482588 4:97597186-97597208 CAACCTCCTGAGAATGCGCTAGG + Intronic
986153252 5:5147293-5147315 CAAGGTCTTGAGGATGTTAAAGG + Intronic
986597739 5:9441159-9441181 ACAGCTCCTGAGAGTGTAATAGG - Intronic
991636897 5:68715425-68715447 CAAGCTACTGAAAATCTTAAGGG - Intergenic
992618157 5:78565633-78565655 CATGCACCTGGGACTGTTATAGG + Intronic
994363451 5:98882945-98882967 CAAGCTCCTCAGTATCCTATCGG + Intronic
995740412 5:115350178-115350200 CAGGCTTCTGACAAAGTTATAGG - Intergenic
998988936 5:147793446-147793468 CACGCTCTGGGGAATGTTATGGG - Intergenic
1000844066 5:166257147-166257169 CAAGCTTCTGACAATTTTCTGGG - Intergenic
1001247075 5:170112835-170112857 CAAGCTGGTGAGAGTGTTGTGGG + Intergenic
1001626491 5:173140149-173140171 CAAGATCTTGAGACTGTTAAAGG + Intergenic
1009296905 6:61962342-61962364 CAAGTTTTTGAGAATATTATTGG - Intronic
1011967930 6:93183091-93183113 TAAGCACATGAGAATTTTATGGG + Intergenic
1017448910 6:154535231-154535253 AAAGCTCCTGAGAAGGTCTTAGG - Intergenic
1017912840 6:158809162-158809184 CAAGCACCTGACAGCGTTATAGG + Intronic
1020451130 7:8321713-8321735 CAAGCTTCTGGGAATGCTGTTGG - Intergenic
1020481092 7:8662066-8662088 CAAGCTCCTGAGCAACTTTTTGG - Intronic
1020962869 7:14827850-14827872 CAGGCTATTGAGAAAGTTATAGG + Intronic
1022823383 7:33983604-33983626 CAAGCTTCTGAGAAGTTTAATGG + Intronic
1022833112 7:34088113-34088135 GCAGCTCATGAGAATGTTCTTGG + Intronic
1025149335 7:56536832-56536854 CATGCTCCTGAAGCTGTTATAGG - Intergenic
1027448431 7:78301723-78301745 AAAGCTGCTGAGATTGGTATTGG - Intronic
1027705188 7:81522966-81522988 CAATCACCTGAGAGTGTTTTAGG + Intergenic
1027953909 7:84855835-84855857 CAAGAATCTAAGAATGTTATGGG + Intergenic
1030158791 7:106485706-106485728 CCAGCTCCTGAGAATGTCATGGG - Intergenic
1030159497 7:106492922-106492944 CCAGCTCCTGAGAATGTCATGGG + Intergenic
1031643028 7:124189216-124189238 CATGCTTCTGTGAATGTCATAGG + Intergenic
1036796676 8:11761014-11761036 CCAGCTCCTTAGAAGGTTGTGGG + Intergenic
1037996961 8:23359740-23359762 CAAGCTCCTGAGCATGGCACCGG + Intronic
1039545306 8:38405898-38405920 TAAGCTCCTAAGCAAGTTATTGG + Intronic
1040551784 8:48443698-48443720 GAAGCACCTGAGAGTGGTATTGG + Intergenic
1044513387 8:93110068-93110090 CAAGCACATGAGAAAGTAATTGG + Intergenic
1046688010 8:117248649-117248671 AAAGCTCATGAAAATGTTAGAGG - Intergenic
1049551141 8:143260544-143260566 CATGCTCCTGAGAAGTTTCTGGG - Intronic
1052136274 9:24914648-24914670 TGAGCTCTTGATAATGTTATTGG + Intergenic
1052946066 9:34169119-34169141 CCAGCTGCTGGGAATGTTAAGGG - Intergenic
1055458681 9:76495901-76495923 CTATATCCTGAGAATGTTAGTGG + Intronic
1055664298 9:78538235-78538257 CCAGTTCCTCAGAATGTTAAGGG + Intergenic
1059590683 9:115657274-115657296 CCAACTCCTGAGAATATTTTTGG + Intergenic
1061426172 9:130499731-130499753 CATGCTTCTGAGGATGCTATGGG - Intronic
1061598939 9:131653108-131653130 CAAGCCCCTGAGGATGCTAAGGG - Intronic
1062467967 9:136689646-136689668 AAAGCTCCAGAGAATCTTATGGG + Intergenic
1186068381 X:5790930-5790952 CAGGCTCCCGAGATTGTGATAGG - Intergenic
1187406357 X:19008086-19008108 CAAGCTCCTGAGAACAGTATTGG - Exonic
1196037316 X:111160052-111160074 AAAGCTCCTGAGGCAGTTATAGG - Intronic
1197396659 X:125936045-125936067 CACACTCCTGAGACTGTTGTGGG - Intergenic
1200801178 Y:7388302-7388324 CAAGGTCCAGAGACTGTTGTGGG - Intergenic
1200987848 Y:9323521-9323543 CAAGCTACTTAAAATGTTCTAGG + Intergenic
1201526048 Y:14935645-14935667 CAGGCTCCTGAGATTATGATAGG + Intergenic
1202120178 Y:21512674-21512696 CAAGCTACTTAAAATGTTCTAGG - Intronic
1202122629 Y:21536215-21536237 CAAGCTACTTAAAATGTTCTAGG - Intronic
1202156376 Y:21893168-21893190 CAAGCTACTTAAAATGTTCTAGG + Intronic
1202158824 Y:21916709-21916731 CAAGCTACTTAAAATGTTCTAGG + Intronic
1202185275 Y:22181624-22181646 CAAGCTACTTAAAATGTTCTAGG + Intronic
1202206085 Y:22404771-22404793 CAAGCTACTTAAAATGTTCTAGG - Intronic