ID: 1100856462

View in Genome Browser
Species Human (GRCh38)
Location 12:98761852-98761874
Sequence CCCTCCTGACCCAGGCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 523
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 470}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100856457_1100856462 -9 Left 1100856457 12:98761838-98761860 CCAGGGAGGAAAGGCCCTCCTGA 0: 1
1: 0
2: 5
3: 17
4: 254
Right 1100856462 12:98761852-98761874 CCCTCCTGACCCAGGCTGGGAGG 0: 1
1: 0
2: 4
3: 48
4: 470
1100856456_1100856462 -5 Left 1100856456 12:98761834-98761856 CCATCCAGGGAGGAAAGGCCCTC 0: 1
1: 0
2: 0
3: 25
4: 207
Right 1100856462 12:98761852-98761874 CCCTCCTGACCCAGGCTGGGAGG 0: 1
1: 0
2: 4
3: 48
4: 470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100856462 Original CRISPR CCCTCCTGACCCAGGCTGGG AGG Intronic
900108806 1:997192-997214 CCCATCTGCCGCAGGCTGGGTGG - Intergenic
900144047 1:1150378-1150400 CCCTCCTGCCCCTCGCCGGGTGG - Intergenic
900327033 1:2113438-2113460 CGCTCCTGACCCAGGGCAGGTGG + Intronic
900389775 1:2428885-2428907 CCCTCCTCACCCAAGCCTGGTGG - Intronic
900801025 1:4737201-4737223 CTCACCAAACCCAGGCTGGGAGG + Intronic
900982052 1:6051450-6051472 CCCACGTGCCCCAGGCTGGATGG - Intronic
901019288 1:6247861-6247883 CCCTCCAGTCCCTGGCTGTGGGG - Exonic
901108149 1:6773712-6773734 GCCACCTCACCCAGCCTGGGAGG - Intergenic
901215418 1:7552203-7552225 GCCTCCAGAGCTAGGCTGGGTGG - Intronic
901667633 1:10835683-10835705 CCCTCCTCACCAAGGCTGAGAGG + Intergenic
901733717 1:11298854-11298876 CCCTCCTGACGGAGGCGAGGAGG + Intergenic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
903330107 1:22592937-22592959 CCCTCCAAACCCAGGCAGTGAGG + Intronic
903868005 1:26412222-26412244 CATTCCTGGGCCAGGCTGGGAGG + Intronic
903954146 1:27013129-27013151 CCCTCCTGACCCTGGCGGGGCGG - Intergenic
904032680 1:27543073-27543095 GCCTGCTGACCCCGGCTGGATGG + Intronic
904271780 1:29354908-29354930 CCCGCCTGACCCAGTCCTGGTGG + Intergenic
904470308 1:30731922-30731944 CCCTCCTACCGCAGACTGGGGGG + Intergenic
904488372 1:30842801-30842823 GCCTCCTGTCACATGCTGGGAGG + Intergenic
905548537 1:38818279-38818301 CCCTCCGGACCCTGGGTGGGCGG + Intergenic
905863764 1:41366147-41366169 CCCTGCTGGAGCAGGCTGGGGGG - Intronic
906083223 1:43107765-43107787 CCCTGCTGGCCCAGGCAGTGAGG - Intergenic
906687493 1:47771979-47772001 CACTCATGCTCCAGGCTGGGAGG - Intronic
907300912 1:53485845-53485867 CCCTCCTCACCCAGGTGGTGTGG + Intergenic
908050102 1:60220244-60220266 CCCTGCTGGATCAGGCTGGGAGG - Intergenic
908111563 1:60903624-60903646 CCCTCCTCTTCCAGGCTGTGAGG + Intronic
909595423 1:77400963-77400985 CCCTGCTGAACCAAGCTTGGCGG - Intronic
909607409 1:77521165-77521187 CGCTCGTCACCCAGGCTGGAGGG + Intronic
909728766 1:78868721-78868743 CCCTGCTGACCCAGCAGGGGCGG - Intergenic
911485630 1:98501477-98501499 CCCACTTGACCCAGGAAGGGTGG + Intergenic
911855370 1:102869340-102869362 CCCTCCTATCACAGGCTTGGAGG - Intergenic
912311347 1:108624267-108624289 CCCTTTTGAATCAGGCTGGGAGG - Intronic
912604271 1:110972366-110972388 TCTTCCTTACACAGGCTGGGTGG + Intergenic
913469002 1:119171655-119171677 CCCACCTGCCCCAGGCAGTGAGG + Intergenic
914883649 1:151567319-151567341 TCCTCCTGCCTCAGCCTGGGAGG + Intronic
915103218 1:153515546-153515568 CTTTCCTGAGCCAGGCTGCGTGG - Intergenic
915557090 1:156666819-156666841 CTCGCCTGACCTGGGCTGGGGGG - Intergenic
916037706 1:160935674-160935696 ACCTCCTGGCTCAGGCTGGCAGG + Intergenic
916553646 1:165874229-165874251 CCCTCAAGAAGCAGGCTGGGTGG - Intronic
917504304 1:175614328-175614350 CCCTCCTGACCTAGGGTGCCTGG - Intronic
917854543 1:179090057-179090079 CCCCAGTGACCCAGCCTGGGTGG + Intronic
918101215 1:181376583-181376605 CTCTCCTGCCCCAAGCTGTGAGG - Intergenic
919741235 1:200982763-200982785 CCCTCCTCACCTGGGCAGGGAGG - Intronic
919904999 1:202072318-202072340 CTCTTCTGGCCAAGGCTGGGTGG - Intergenic
919914489 1:202131048-202131070 CCCAGCTGGCCCAGGCTGCGAGG - Exonic
920177919 1:204114666-204114688 CCCTACAGAGCCAGGCTGCGTGG - Intronic
920282824 1:204857282-204857304 GGCTCCTGGCCCAAGCTGGGTGG - Intronic
921146350 1:212361562-212361584 CCCTCCTGACCCAGGGATGGAGG + Exonic
921219108 1:212960810-212960832 CCGTCCTGGGCCAGGCTCGGTGG + Intronic
921957296 1:220998020-220998042 CTCTCCAGAGGCAGGCTGGGAGG - Intergenic
923139277 1:231147518-231147540 CTCTCCTGACCCAGGGATGGAGG + Intergenic
924599128 1:245472784-245472806 CCCTCCTGACCCAGCCCAAGGGG - Intronic
1062788354 10:284099-284121 CTCTCCTGACCCTTGCTGTGTGG - Intronic
1062958258 10:1554231-1554253 CACCCCTGCCCCTGGCTGGGTGG - Intronic
1063391192 10:5650823-5650845 GCCTCCTGGCCCAGGCTGTTGGG + Intronic
1067066294 10:43105907-43105929 TCCTCCTACCCCAGGCTGGAGGG - Intronic
1067231131 10:44411516-44411538 CCCTCCTGTGCCTGGCTTGGTGG - Intergenic
1067806182 10:49395175-49395197 GCGTCCTGGCCCAGGCGGGGAGG + Intronic
1071730133 10:88239663-88239685 CCTTTCTTTCCCAGGCTGGGTGG + Intergenic
1072280557 10:93861959-93861981 CCCTCCTATCACAGGCTGAGAGG + Intergenic
1072307200 10:94119130-94119152 CTCTCCTGTTCCAGGCTGGTAGG + Intronic
1073207242 10:101775730-101775752 CCCTCCTCACCTGGGCTTGGAGG + Exonic
1073257147 10:102160047-102160069 TCCTCCAGACCCACGCTGAGGGG - Intronic
1075784960 10:125042787-125042809 CCCTTCTGGCTGAGGCTGGGAGG + Intronic
1076082211 10:127592660-127592682 CCCTCTTGACCAACGGTGGGAGG - Intergenic
1076481315 10:130786829-130786851 ACATCCTGTCCCAGACTGGGAGG - Intergenic
1076604168 10:131678440-131678462 CCAGCCTGACACAGGCTTGGAGG + Intergenic
1076631879 10:131856513-131856535 CCCTCCTGCTCCAGCCTGTGAGG - Intergenic
1076658804 10:132041671-132041693 GCCCCGTGGCCCAGGCTGGGTGG + Intergenic
1076704431 10:132293553-132293575 CTCCCCTGGCCCAGTCTGGGTGG - Intronic
1076825367 10:132964597-132964619 CAGGCCTGGCCCAGGCTGGGTGG - Intergenic
1077093257 11:788947-788969 GCCTCCTGCCCCCGGCTGGTGGG - Intronic
1077217869 11:1402571-1402593 CCCTCCTGACTCCTCCTGGGGGG + Intronic
1077376886 11:2209389-2209411 CCTTCCCAGCCCAGGCTGGGCGG + Intergenic
1077380661 11:2235544-2235566 ACCTCCTCACCCACCCTGGGAGG + Intergenic
1077424455 11:2467791-2467813 CCCTGCAGACCCAGGCCAGGTGG + Intronic
1077470999 11:2760522-2760544 TCCTCCTCTCCCAAGCTGGGTGG + Intronic
1077536448 11:3127027-3127049 CCCTCCTTACCCAGCCTGCCAGG - Intronic
1077560656 11:3258280-3258302 CCCTCCTGTGCCAGGCAAGGTGG + Intergenic
1077566552 11:3304108-3304130 CCCTCCTGTGCCAGGCAAGGTGG + Intergenic
1077655688 11:4016867-4016889 CCCTCCTGTGCCTGGCTCGGCGG - Intronic
1080912193 11:36613595-36613617 CCCTCCAAACACAGGCTGGGTGG - Intronic
1081041782 11:38222789-38222811 CCTTACTGCCCCAGGCTGTGGGG + Intergenic
1081632271 11:44697742-44697764 CACTCCTGACCAGGCCTGGGCGG + Intergenic
1081717722 11:45262690-45262712 CCCTCTTTGCCCAGGCTGGAGGG - Intronic
1082028237 11:47587828-47587850 CCCCCATGTCCCAGGCTGGGAGG - Intronic
1083128276 11:60595570-60595592 CTGTCCAGACCCAGGCGGGGAGG + Intergenic
1083304288 11:61754630-61754652 CCCTCCTGACCATGGGTTGGGGG + Intronic
1083622254 11:64055069-64055091 ACCTTCTGGACCAGGCTGGGGGG - Intronic
1083826857 11:65208839-65208861 GCCTCCTGGGCCAGGCTGAGTGG + Intronic
1084093461 11:66894571-66894593 TGCTCCAGACCCAGGCTGTGAGG - Intronic
1084913770 11:72412123-72412145 GTCTGCTGTCCCAGGCTGGGGGG - Intronic
1084949708 11:72657912-72657934 CCCTGCTCACAGAGGCTGGGTGG - Intronic
1085321164 11:75574890-75574912 CCATCCTGACTCAGGTGGGGAGG + Intergenic
1085341460 11:75734225-75734247 CCATCCTAGCCCAGGCTGGGGGG - Intergenic
1085352524 11:75808787-75808809 CCCACTTGAGCCAGGCTCGGTGG + Intergenic
1085475079 11:76784142-76784164 CCCCTCAGACCCCGGCTGGGAGG + Intronic
1086456877 11:86967889-86967911 CCCTCCTGTGCCTGGCTTGGTGG - Intergenic
1086839545 11:91667717-91667739 GGCTGCAGACCCAGGCTGGGAGG - Intergenic
1087482421 11:98718274-98718296 CCCTCCTGTGCCTGGCTCGGCGG - Intergenic
1088920670 11:114258035-114258057 GCCGCCTGCCCCAGGCAGGGAGG - Intronic
1089443338 11:118533324-118533346 CCCTCCTTGCCCAGGGTGGCTGG - Intronic
1089646886 11:119886348-119886370 CCCTCCAGGCCCACGGTGGGGGG + Intergenic
1090566264 11:127995330-127995352 CCCTCTTGAGCCTGGCTGTGTGG + Intergenic
1090831142 11:130421713-130421735 CCCACCTCACCCAGGCTCAGTGG - Intronic
1091667583 12:2430549-2430571 CACCCCTGACTCAGTCTGGGAGG + Intronic
1092955835 12:13548869-13548891 GCCTCCTGAACCAGGCTCCGGGG + Exonic
1094338914 12:29389347-29389369 CCCTCCGGACCCGGGCCGGCGGG + Intergenic
1095792062 12:46178383-46178405 CCCCCCTGAGCCAGACAGGGTGG + Intergenic
1096030548 12:48410233-48410255 CCCTCCTGTGCTTGGCTGGGTGG - Intergenic
1096214210 12:49790829-49790851 CCCACGTGTCCCAGGCTGGGGGG - Intergenic
1097168262 12:57097095-57097117 CTCATCTGGCCCAGGCTGGGGGG + Exonic
1099441569 12:82705921-82705943 GGCACCTGACCCAGACTGGGAGG + Intronic
1100856462 12:98761852-98761874 CCCTCCTGACCCAGGCTGGGAGG + Intronic
1101513348 12:105412057-105412079 CCCTCCTGGCCCATGCTGGAGGG - Intergenic
1101750660 12:107580536-107580558 TCCCCCAGACCCAGGCTGGCTGG - Intronic
1101895611 12:108754248-108754270 ACCCCATGATCCAGGCTGGGTGG - Intergenic
1102233117 12:111277226-111277248 CCCTCCCTGCGCAGGCTGGGAGG - Intronic
1102594650 12:113983114-113983136 CTCTCATGACTCAGGCTGGAGGG - Intergenic
1103477377 12:121228884-121228906 CTCTCCTGACCCAGCCCTGGAGG + Intronic
1103890554 12:124235624-124235646 GCCACATGACCAAGGCTGGGAGG + Intronic
1104224501 12:126818645-126818667 CCCTCCTGGCCCTTGCTGGCTGG + Intergenic
1104828380 12:131731055-131731077 CCCTCCAGATCCAAGATGGGTGG - Intronic
1104844197 12:131838666-131838688 CTGTCCTGACCCAGGCTCGCAGG + Exonic
1104960191 12:132484905-132484927 TGCTCCTGACACAGACTGGGAGG + Intergenic
1105376622 13:19851183-19851205 CTCTTCTCACCCAGGCTGGCTGG - Intronic
1105483562 13:20803425-20803447 CCTGCCTGACTCAGGCTGAGTGG - Intronic
1105700197 13:22929978-22930000 ACCTACTCACCCACGCTGGGGGG - Intergenic
1106376669 13:29195679-29195701 CCTGACTGGCCCAGGCTGGGTGG - Intronic
1106858243 13:33875722-33875744 GGCTCCTAACCCAGGCTTGGTGG - Intronic
1107274956 13:38667658-38667680 CCCTCCTATCACAAGCTGGGAGG + Intergenic
1109319341 13:60790739-60790761 TCCTGCTGACCCAGGCTGCTGGG + Intergenic
1110796797 13:79647782-79647804 CCATCATGAGCCAGGCTGGGAGG + Intergenic
1111323738 13:86664193-86664215 CCCTCCCAACACAGGCTTGGAGG - Intergenic
1111932615 13:94526967-94526989 CCCTCCTGTGCCTGGCTCGGTGG + Intergenic
1112332815 13:98489683-98489705 ACCCCCTGCCCCAGGCTGGCAGG - Intronic
1113513861 13:110875714-110875736 TCCTCCTGACTCAGCCTTGGAGG - Intergenic
1113793562 13:113043445-113043467 CCCTCTTGCCCCAGGCGGCGTGG - Intronic
1113885581 13:113656939-113656961 GCCTCCTGGGCCAGGCGGGGCGG - Intronic
1114524478 14:23359490-23359512 CTCTCCTGCCCCAGGCCGGAAGG - Exonic
1114683433 14:24506247-24506269 CCAGCCTGACCCTGGCTGTGGGG - Exonic
1114798185 14:25740264-25740286 ACCTCCTGGCCCATGATGGGAGG + Intergenic
1116486292 14:45452934-45452956 CCTTCATGACCCAGTCTTGGTGG + Intergenic
1117123695 14:52596620-52596642 CCCTCCTGTGCCTGGCTTGGTGG - Intronic
1117677015 14:58165649-58165671 CCCTGATTACCGAGGCTGGGTGG + Intronic
1118808120 14:69255303-69255325 CCTTCCTGCCCCAGGATGAGGGG - Intergenic
1119682844 14:76605730-76605752 CTCTCCTGACCAGGGCTGGTAGG - Intergenic
1119753945 14:77100601-77100623 CACTCTTCACCCAGGCTGGAGGG + Intronic
1120521745 14:85533367-85533389 GCCTCCAGACCCACGCCGGGCGG + Intronic
1120860731 14:89253128-89253150 CCCTCCTGCCCCAGGTTGTCAGG + Intronic
1120993612 14:90398297-90398319 CCCTCCTGGCCGAGGAGGGGCGG + Intronic
1121219596 14:92275589-92275611 CCCTCCTGGCCCACCCTGTGGGG - Intergenic
1121259448 14:92555541-92555563 CCCACCCGACCCAGGATGTGAGG - Intronic
1121417192 14:93787819-93787841 CCCGTCCGACCCGGGCTGGGAGG - Intronic
1122313682 14:100813201-100813223 ACTTCTTGCCCCAGGCTGGGTGG + Intergenic
1122632081 14:103111757-103111779 CCCTCTGGCCCCTGGCTGGGAGG - Intergenic
1123020275 14:105394693-105394715 ACCTCCTGCCCCATGCTGTGAGG + Exonic
1123072997 14:105651268-105651290 CCGTCCTCCCCCAGCCTGGGAGG - Intergenic
1123092921 14:105750037-105750059 CCGTCCTCCCCCAGCCTGGGAGG - Intergenic
1123098400 14:105777137-105777159 CCGTCCTCCCCCAGGCTGGGAGG - Intergenic
1123107544 14:105849721-105849743 CCATCCTCCCCCAGGCTGGGAGG + Intergenic
1123499253 15:20865795-20865817 CCCTCCTGGCGCAGGGAGGGAGG - Intronic
1123556488 15:21439414-21439436 CCCTCCTGGCGCAGGGAGGGAGG - Intronic
1123592729 15:21876760-21876782 CCCTCCTGGCGCAGGGAGGGAGG - Intergenic
1123997295 15:25727891-25727913 CACTGATGACCCAGGCTGGCTGG + Intronic
1124216729 15:27813320-27813342 CCCTCCTGACCCCAGCAGGAGGG + Intronic
1124512767 15:30340703-30340725 CCCTCCTGATGCAGGCTGAGGGG - Intergenic
1124632174 15:31344239-31344261 CCCTCCTGACACAGGCTGGAGGG - Intronic
1124696289 15:31867429-31867451 CCCTCCTCCACCAGGCTTGGGGG + Intronic
1124730148 15:32190047-32190069 CCCTCCTGATGCAGGCTGAGGGG + Intergenic
1124811522 15:32944078-32944100 CCCTTCTGGCACTGGCTGGGAGG - Intronic
1125510122 15:40288284-40288306 CCCTCCTGCCCCAGGCTTCCAGG - Exonic
1125675933 15:41502641-41502663 CCCTTCTGGGCCACGCTGGGCGG + Intronic
1126100970 15:45117969-45117991 CTCTCCTGGCCCAGGCCTGGCGG - Exonic
1126480564 15:49114743-49114765 CCCTCCTCAGCCAGGCGTGGTGG - Intronic
1126749988 15:51866832-51866854 CCCTCATGACGCAGGCTGGTAGG + Intronic
1127257745 15:57306396-57306418 CCCTCCAGAGACAGCCTGGGGGG - Intergenic
1127482802 15:59392554-59392576 GTCCCCTGACTCAGGCTGGGAGG + Intronic
1128187212 15:65652510-65652532 CCTTCCTCACTCAGGCTGAGGGG + Intronic
1128551454 15:68600562-68600584 ACCCCCGGACCCAGGCTGGGGGG + Intronic
1129150439 15:73684666-73684688 CCCTCCTGCCCTGGGCTGTGGGG + Intronic
1129159200 15:73737808-73737830 CCCTCCGGACAGACGCTGGGGGG + Exonic
1129700556 15:77765670-77765692 CACTCTCCACCCAGGCTGGGTGG - Intronic
1129740357 15:77986891-77986913 CCCGCTTCAGCCAGGCTGGGAGG - Intronic
1130256453 15:82328153-82328175 CCCGCTTCAGCCAGGCTGGGAGG - Intergenic
1130598499 15:85261835-85261857 CCCGCTTCAGCCAGGCTGGGAGG + Intergenic
1131558266 15:93417896-93417918 CCCTCCCGGGGCAGGCTGGGAGG + Intergenic
1131844966 15:96481198-96481220 CCCTCCTGAGCCAGAGTAGGCGG + Intergenic
1131870979 15:96764600-96764622 CCCTCCGGCCTCAGGGTGGGTGG + Intergenic
1132276786 15:100573227-100573249 TCCTCCTGTCCCAACCTGGGAGG - Intronic
1132313017 15:100870855-100870877 CCGCCCTGACTCAGGCTGAGTGG - Intergenic
1132348248 15:101121387-101121409 TCCTCCTGGCCCCTGCTGGGTGG - Intergenic
1202964830 15_KI270727v1_random:166603-166625 CCCTCCTGGCACAGGGAGGGAGG - Intergenic
1132462283 16:61508-61530 CCCTCCCGACCCGCTCTGGGAGG - Intronic
1132622157 16:872916-872938 CCACCCTGACCCAGGCAGGCAGG - Intronic
1132675224 16:1118638-1118660 TCCACCTCCCCCAGGCTGGGTGG + Intergenic
1132980859 16:2738099-2738121 CCCTCCACCCCCAGGCTGGCAGG + Intergenic
1133001527 16:2853827-2853849 CCCTCCTGGCCAGGGGTGGGGGG + Intronic
1133277358 16:4646953-4646975 CCCTCCAGACCAAGGCTGCCCGG + Intronic
1133978330 16:10616419-10616441 CCCTCCTGACTCAGGTAGGGTGG - Intergenic
1134205318 16:12232885-12232907 CCCTCCAAGCCCATGCTGGGTGG - Intronic
1134308736 16:13057128-13057150 CCCTCCAGCCCCAGGCAGGAAGG - Intronic
1135837836 16:25843421-25843443 CCTTCCTGACCTAGTCTTGGAGG + Intronic
1136228394 16:28873504-28873526 CTCTTCTGCCCCAGGCTGTGGGG - Exonic
1136285286 16:29237102-29237124 CCCGCCAGACCCAGGCAGAGGGG - Intergenic
1136352213 16:29718131-29718153 GCCTTCTCACCCAGGCTGGAGGG - Intergenic
1136401909 16:30023913-30023935 TCCTCCAGACCCTGGCGGGGAGG - Intronic
1136731563 16:32418253-32418275 CCCTCCTGTCACAGGGTTGGAGG + Intergenic
1139047214 16:63076344-63076366 CCTTCCTGACCCAGTCTGCTGGG - Intergenic
1140406357 16:74714002-74714024 CCCTCCTGACCCCTGGTAGGAGG - Exonic
1141169384 16:81681453-81681475 GCCTCCGGTCCCAGGCTGGGAGG + Intronic
1141502800 16:84455289-84455311 CCCGCCTGGCTCAGGCTGGTGGG + Intronic
1142090351 16:88206728-88206750 CCCGCCAGACCCAGGCAGAGGGG - Intergenic
1142141207 16:88473603-88473625 CCCATCTGACGCAGGCTGCGCGG + Intronic
1142424258 16:89992612-89992634 ACCCCCTGAGCCAGGCTGTGGGG + Intergenic
1202994827 16_KI270728v1_random:99017-99039 CCCTCCTGTCACAGGGTTGGAGG - Intergenic
1203021514 16_KI270728v1_random:411359-411381 CCCTCCTGTCACAGGGTTGGAGG - Intergenic
1142470947 17:162973-162995 CACACCCGGCCCAGGCTGGGAGG + Intronic
1142808874 17:2386086-2386108 CCATCCAGACCCAGGCTGCAGGG + Exonic
1143112163 17:4558862-4558884 CCCTCCTGAGCCAGCGTGGTGGG + Exonic
1143438766 17:6951579-6951601 CCCTCCAGCCCCAGGCAAGGCGG + Intronic
1145061556 17:19737407-19737429 CCTGCCAGGCCCAGGCTGGGAGG + Intergenic
1145163150 17:20589242-20589264 CCCTCCAGAGCCTGGCCGGGGGG - Intergenic
1145863947 17:28228240-28228262 CTGTCCAGCCCCAGGCTGGGTGG - Intergenic
1146001885 17:29135616-29135638 CCCATCTGGCCCAGGCTGTGAGG + Intronic
1146145503 17:30412676-30412698 CCCTCCTGTGCCTGGCTCGGTGG - Intronic
1146529673 17:33597773-33597795 CCCTCCTGACACCTGCTGTGTGG - Intronic
1146629209 17:34458078-34458100 CCCTCCTACCCCAGGGTAGGTGG + Intergenic
1146891763 17:36510903-36510925 CCGTCCTGACAGAGTCTGGGAGG + Exonic
1146938218 17:36825790-36825812 CCCTGCTGGCCCAGGATGGGGGG - Intergenic
1147388844 17:40097199-40097221 CCGTCATCACTCAGGCTGGGTGG + Exonic
1147996582 17:44363192-44363214 CGCTCCCGACCCTGGCGGGGTGG - Intronic
1148016469 17:44525150-44525172 CCCTCATGTCCCAGACGGGGCGG - Intergenic
1148769787 17:50060165-50060187 CCCTCCTATCCCCGGCCGGGAGG - Intronic
1148970399 17:51475750-51475772 CCATCCTGACTCAGTCTGGAAGG - Intergenic
1150642100 17:66956197-66956219 CCCTGCTGACCCAGGCAAGATGG - Intergenic
1150820473 17:68430570-68430592 GCCTCCTGAGCCAGACTGAGTGG + Intronic
1150861396 17:68804299-68804321 CTCTCATCACCCAGGCTGGAGGG - Intergenic
1151660585 17:75516183-75516205 CCCTCCTTGCCCAGCCCGGGCGG + Intronic
1151707682 17:75779347-75779369 CCCTAATGACTCAGGCTGCGAGG + Intronic
1151896410 17:76983486-76983508 CCCTCCCGCCCCTGGCTGTGGGG + Intergenic
1151948330 17:77331509-77331531 GCCTCCCTGCCCAGGCTGGGCGG - Intronic
1152273789 17:79341964-79341986 CCCTCTTGCCCCAGCCTTGGGGG - Intronic
1152557921 17:81063827-81063849 CCTTGCTGCCCCAGGATGGGAGG + Intronic
1152693793 17:81733972-81733994 CCCTCCTCACCCTGCCTGGCTGG - Intergenic
1152859432 17:82687007-82687029 CCCTCCTGTCCAGTGCTGGGGGG + Intronic
1154457296 18:14542549-14542571 CCCTCCTGGCGCAGGGAGGGAGG - Intronic
1156509642 18:37625764-37625786 CTCACCTGATGCAGGCTGGGGGG - Intergenic
1157316507 18:46594279-46594301 CTCTGCTGACCCTGGCTGAGAGG + Intronic
1158361019 18:56673544-56673566 CCCTCCTGGGCCAGGCATGGTGG + Intronic
1158719146 18:59908409-59908431 GCCTCCAGCCCCACGCTGGGAGG - Intergenic
1158897124 18:61924754-61924776 CCCTCCTCACCCAGGGCTGGGGG - Intergenic
1160392096 18:78541596-78541618 TCATCCTGGCCCTGGCTGGGCGG - Intergenic
1160803040 19:979388-979410 CCATCCTGGCCGAGGCTGGCCGG + Intergenic
1160932680 19:1578078-1578100 CCCACGTGAACCAGGCTCGGCGG - Exonic
1161008925 19:1950752-1950774 CCCACCTGACACTGGCTGGAGGG - Intronic
1161256785 19:3314209-3314231 CCCTCCCGCCCCAGGCTGCCGGG + Intergenic
1161314515 19:3611573-3611595 CGCCCCTCAGCCAGGCTGGGTGG - Exonic
1161384570 19:3984099-3984121 CCCTCTGTACCCAGGCAGGGAGG - Intronic
1161468165 19:4443605-4443627 CCCTCCTGCCCTGGGTTGGGGGG + Intronic
1161566110 19:5003773-5003795 CTCTCGTCACCCAGGCTGGAGGG - Intronic
1161644655 19:5445658-5445680 CCCTCCTGGGCCTGGCTGGGAGG + Intergenic
1161708844 19:5835737-5835759 CTCTCATCACCCAGGCTGGAGGG - Intronic
1161716814 19:5880835-5880857 CCCTCCTGGCCCAGGGGGAGGGG - Intronic
1161939030 19:7391112-7391134 GCCTCCTGACACAGGTGGGGAGG - Intronic
1162439839 19:10686214-10686236 ACCTCCAGGCCCAGGGTGGGTGG - Intronic
1162549310 19:11349792-11349814 CACTCCTGCCCAAGGCTGAGTGG + Intronic
1162636379 19:11970895-11970917 CTCTCCTTGCCCAGGCTGGAGGG - Intronic
1162829254 19:13274406-13274428 CCCTCCTGAGCCAATCTGGAGGG - Intronic
1163314596 19:16533205-16533227 CCCTGCTGAGCCAGGCCGGAGGG - Intronic
1163813680 19:19450593-19450615 CCCTCCTCTCACAGGCTAGGGGG + Intronic
1164962195 19:32443158-32443180 CCCTGCTGACACATGCTGGCTGG - Intronic
1165003768 19:32787739-32787761 CCCTCCTGTGCCTGGCTCGGCGG - Intronic
1165118647 19:33545049-33545071 CCCGCATGACCAAGGCTTGGAGG + Intergenic
1166299697 19:41906734-41906756 CCCTCCTGTCTCAGCTTGGGGGG + Exonic
1166956546 19:46469140-46469162 CTCTCGTCACCCAGGCTGGAGGG + Intronic
1167148206 19:47694916-47694938 TCCTCCAGAACAAGGCTGGGGGG + Exonic
1167757425 19:51421488-51421510 CCTGTCTGACCAAGGCTGGGAGG - Intergenic
1167888768 19:52523135-52523157 CCGTCCTGCCCCAGCCTGAGGGG - Intergenic
925237707 2:2293710-2293732 ACCTCCTGCCCCAGGCCGAGGGG - Intronic
926218210 2:10918577-10918599 CCCTCCAGACCCCAGATGGGGGG - Intergenic
926268939 2:11350419-11350441 CCCTCATGACCCACCCTGGAAGG + Intergenic
927187864 2:20495105-20495127 CCCTCATTCCCCAGGCTGTGAGG - Intergenic
927492497 2:23529798-23529820 CCGTCCTGAGACAGCCTGGGGGG + Intronic
927857333 2:26535815-26535837 TCCCCCTGAGGCAGGCTGGGCGG + Intronic
930088337 2:47514236-47514258 CTCTGCCTACCCAGGCTGGGTGG + Intronic
931799805 2:65747592-65747614 CCCTCCAACCCCAGGCTGAGAGG - Intergenic
932257701 2:70301683-70301705 CGCTCCTGCCCCGGGCTGGAAGG + Intronic
932713570 2:74085475-74085497 ACCTCCAGACCCACTCTGGGGGG + Intronic
934990964 2:98921262-98921284 CCCTCCTGAGTCAGTCTGGCAGG + Intronic
936947250 2:117941804-117941826 CCCTACTGACCGGGTCTGGGAGG + Intronic
937080115 2:119134769-119134791 CCCTCCGGGCTCAGGCTAGGGGG - Intergenic
938248631 2:129797319-129797341 TCATCCTGACCCAGGGCGGGTGG - Intergenic
938936901 2:136135140-136135162 CACTCCTGGCCCAGGCGTGGAGG - Intergenic
941424104 2:165320821-165320843 CCCTCCCGTCACAGGCTCGGAGG - Intronic
942251590 2:174051873-174051895 CCTGCCTGGCCCAAGCTGGGTGG + Intergenic
943743928 2:191441370-191441392 CCCCACAGAACCAGGCTGGGTGG - Intergenic
944442976 2:199761371-199761393 CACCCTTGACCCAGGCTGGTTGG + Intronic
945870206 2:215219165-215219187 CCCTCACTACCCAGGCTGGCAGG - Intergenic
946167792 2:217875962-217875984 CCCTTGTCAGCCAGGCTGGGAGG + Intronic
946333092 2:219021417-219021439 TCCCTCTGACCCAGGCTGGGAGG - Intronic
947389227 2:229622500-229622522 CCGTGCTGACTCAGGCTGAGGGG - Intronic
947440601 2:230117915-230117937 CCCTCCTGTGCCTGGCTCGGTGG - Intergenic
948247179 2:236496482-236496504 CTCTTCTGACTCAGGCTGGCTGG - Intronic
948335600 2:237204730-237204752 CCCTCCTGACCCGGGGTAGCTGG - Intergenic
948732797 2:239977825-239977847 GCCAGCTGACCCATGCTGGGTGG - Intronic
948818980 2:240528844-240528866 CCCTGCTGACTCGAGCTGGGAGG - Intronic
949043361 2:241859279-241859301 CCCACCTTCCCCAGGCAGGGAGG - Intergenic
1171848384 20:30291627-30291649 CCCTCCCGGACCAGGCTGGCCGG + Intergenic
1172119881 20:32592019-32592041 CCAGCCTCACCCAGGCAGGGAGG + Intronic
1173500521 20:43549561-43549583 CCCTTCCCACCCAGGCTGGGAGG - Intronic
1173684773 20:44915449-44915471 CCCTCCTGACTCAGGCCAGCAGG - Intronic
1175368626 20:58471857-58471879 CACTCCAGCCCCAGGCTGGGTGG - Intronic
1175790293 20:61736416-61736438 AGAGCCTGACCCAGGCTGGGTGG - Intronic
1175871736 20:62212537-62212559 CGCTGCGGAGCCAGGCTGGGTGG + Intergenic
1175983483 20:62752951-62752973 CGCTGCTGACCCTGGCTGGGTGG - Intronic
1176197600 20:63844580-63844602 CCCCACTGCCACAGGCTGGGCGG + Intergenic
1176816863 21:13610804-13610826 CCCTCCTGGCGCAGGGAGGGAGG + Intronic
1176962176 21:15171684-15171706 CCCTCCTCGCCCAGGCTGGCAGG + Intergenic
1177278299 21:18945259-18945281 GCATCCTGACCCAGGCTGACAGG - Intergenic
1177638389 21:23815455-23815477 CCCTCCTCAGCCAGTCTGAGTGG + Intergenic
1178441837 21:32604693-32604715 CCTTCCTGCCCCATGCTGAGGGG - Intronic
1179429473 21:41310030-41310052 CCCTGCAGCACCAGGCTGGGAGG - Intronic
1179585233 21:42370319-42370341 CCCCCCTGCCCCAGCCTGGGGGG + Intergenic
1179594793 21:42435529-42435551 CCCACCTGCTCCAGGCAGGGTGG + Intronic
1179723465 21:43329139-43329161 TCCCACTGACCCAGGCTGGGTGG + Intergenic
1179882239 21:44297719-44297741 CCCTCCTGACCCCAGATGGCCGG + Exonic
1180179380 21:46111249-46111271 CCCTCTTGCCCCACCCTGGGTGG - Intronic
1180839921 22:18954514-18954536 CCCTCAGACCCCAGGCTGGGAGG - Intergenic
1180949273 22:19714075-19714097 CCCTGCTGACCTCGGCGGGGTGG + Intergenic
1181103230 22:20555362-20555384 CCCTCCTGCCCAGGGCTAGGAGG - Intronic
1181583076 22:23838531-23838553 CCCTGCGGACACGGGCTGGGTGG - Intronic
1183247980 22:36708703-36708725 CACTCCTCTCCCAGGCTGGTTGG - Intergenic
1183465814 22:37979956-37979978 CCCTCCCTCCCCAGGCTGGGCGG + Intronic
1183672848 22:39283292-39283314 CCCTGCTTCCCCAGGCTGGATGG - Intergenic
1184074833 22:42169695-42169717 CCCTCCTGGCCCTGGGAGGGTGG - Intronic
1184154467 22:42658082-42658104 CCCTTCTTAGCCAGGCTGGCAGG - Intergenic
1184230746 22:43157180-43157202 ACCTCCTGCCCCAGGGAGGGTGG + Intronic
1184479736 22:44739303-44739325 CCCTCCTGCCCCAGGGCAGGAGG - Intronic
1184855990 22:47147080-47147102 CCTTCTGGACTCAGGCTGGGCGG - Intronic
1184876996 22:47282474-47282496 CTTTCCTTACCCAGGCAGGGGGG + Intergenic
1185088438 22:48753067-48753089 GCCTCCTGACCCAGGCAGCAGGG - Intronic
1185385388 22:50529454-50529476 CGTTCCTGACCCCGACTGGGAGG - Intronic
950146031 3:10650637-10650659 CCCTCCTATCACAGGCTTGGAGG + Intronic
950415941 3:12869121-12869143 CTCTCTTTGCCCAGGCTGGGCGG + Intronic
950417389 3:12876236-12876258 CTCTCTTTGCCCAGGCTGGGCGG + Intergenic
950495746 3:13333318-13333340 TGCCCCTGAGCCAGGCTGGGAGG - Intronic
951653725 3:24981582-24981604 CCCTCCTGTGCCTGGCTCGGTGG - Intergenic
952813996 3:37431178-37431200 CCCTCCTGTGCCTGGCTTGGTGG - Intronic
953025727 3:39143845-39143867 GCCTCCTCACCAGGGCTGGGTGG + Exonic
953345933 3:42175484-42175506 CCCTCCTGTCCAAGCGTGGGGGG - Intronic
954111044 3:48433306-48433328 CCCTTCTGACCCAGCCAGGTTGG - Intronic
954410801 3:50370086-50370108 CCCTCCTGCCCCGGCCTGGTGGG + Intronic
954584462 3:51721264-51721286 CCCTCCTCTCCTGGGCTGGGGGG + Intergenic
954900368 3:54014202-54014224 CCCTCCCCAGCCAGGCTTGGAGG - Intergenic
955679684 3:61487536-61487558 CTCTTCTCACCCAGGCTGGAGGG - Intergenic
957304897 3:78444434-78444456 CTCTGCTGCCCCAGGCTGGAAGG - Intergenic
958407172 3:93764467-93764489 CCCTCATCTCCCAGACTGGGTGG + Intergenic
958638885 3:96779622-96779644 CCCTCCTATCCCAGGCCTGGAGG + Intergenic
958942869 3:100334659-100334681 TCCTCCTGGCCCCGGCCGGGAGG - Intergenic
960538486 3:118839365-118839387 CCCTCCCGTCACAGGCTTGGAGG - Intergenic
961404563 3:126668944-126668966 TGCCCCTGAGCCAGGCTGGGAGG + Intergenic
961653614 3:128429543-128429565 CCCAGCTGACCCGGGCTGGCTGG - Intergenic
961817605 3:129559250-129559272 CTCTACTGTCCCAGGCTGTGTGG + Intronic
962732258 3:138294286-138294308 CCCTCTCCACCCAGGCTTGGAGG + Intronic
962806780 3:138933168-138933190 CCCTGGAGACCCAGGCAGGGTGG - Intergenic
965265069 3:166532209-166532231 CACTCCTGTCACAGGCTTGGAGG - Intergenic
966165946 3:177016537-177016559 CTCTCGTTGCCCAGGCTGGGGGG + Intergenic
967412548 3:189181174-189181196 CCCTCCCATCACAGGCTGGGAGG - Intronic
967876512 3:194271473-194271495 CCCTCCAGGCCCAGGCTGGGTGG + Intergenic
968512329 4:1001157-1001179 CCCTGGGGCCCCAGGCTGGGGGG + Intronic
969299995 4:6292105-6292127 CCCTGCAGGCGCAGGCTGGGAGG - Intronic
969464134 4:7344672-7344694 ACCTCCTGGCCCAGTGTGGGAGG - Intronic
969489324 4:7490260-7490282 CCCTTCTGACTCGGCCTGGGGGG + Intronic
969706274 4:8793990-8794012 CCCTGCTGCCCCAGGGTGGCTGG - Intergenic
969867155 4:10083539-10083561 CCCTCCTCTCCCAGCCTGGGGGG + Intronic
972618683 4:40724612-40724634 CCCTTGTCACCCAGGCTGGAGGG - Intergenic
973111705 4:46405002-46405024 ACCTGCTGAGCCAGGCTGGGAGG - Intronic
973341848 4:49013289-49013311 CCATCCTGTGCCTGGCTGGGTGG - Intronic
975807287 4:78126198-78126220 CCCTCCTGTGCCTGGCTCGGTGG - Intronic
976729538 4:88248120-88248142 CTCTCCTGGGCCAGGCTCGGTGG - Intergenic
978524945 4:109655728-109655750 CCCTGCTGCCCCAGGCTTCGTGG - Intronic
979953705 4:126927700-126927722 CGCTCGTCACCCAGGCTGGAAGG + Intergenic
980517042 4:133877380-133877402 GGCTGGTGACCCAGGCTGGGAGG + Intergenic
982818773 4:159920040-159920062 CCCTTCTGTCCCAGGATGGCTGG - Intergenic
983962121 4:173767797-173767819 CCATCCTGACTCAGGGTGGCAGG + Intergenic
985073426 4:186190941-186190963 CCCTCCCTTCCCGGGCTGGGTGG + Intergenic
985565972 5:617561-617583 CCCTCCTGACCCTGTCCCGGTGG + Intronic
985671086 5:1207007-1207029 CGCGCCTGCCCCAGGCTGGACGG - Intronic
985778528 5:1857728-1857750 CCCTCCTGGCTCTGGCTGAGCGG - Intergenic
986007699 5:3681881-3681903 CTCTCCTGGCCATGGCTGGGTGG + Intergenic
986130865 5:4928836-4928858 CTCTCCTGAGCCTGGCTTGGGGG + Intergenic
986425711 5:7629305-7629327 CCCTCTTCACCCAGGATTGGAGG + Intronic
986656382 5:10016842-10016864 CCCTCCTGTGCCTGGCTCGGTGG - Intergenic
987085218 5:14461587-14461609 CCCTCCTGGCCCAGGCCTGGGGG - Intronic
988161068 5:27518873-27518895 ACCTACTCATCCAGGCTGGGAGG - Intergenic
988790259 5:34601281-34601303 CTCTCCTCACCCAGGCTGGAGGG - Intergenic
988984067 5:36599849-36599871 CTCTCGTCACCCAGGCTGGATGG + Intergenic
991364305 5:65852731-65852753 CCCTCCTGTGCCTGGCTTGGCGG - Intronic
992624441 5:78624488-78624510 ACATCCTCAGCCAGGCTGGGAGG + Intronic
994548686 5:101204797-101204819 CCCTCCTATTGCAGGCTGGGAGG + Intergenic
994769796 5:103966578-103966600 CCCTCATGGCCCAGGCTGGCAGG + Intergenic
995011437 5:107260487-107260509 CCCTCCTGTCACAGGCTCAGAGG - Intergenic
996065105 5:119071185-119071207 CGCTCCTGACCCAGCCCGAGTGG - Intronic
996319698 5:122201041-122201063 CCCTCCTGACTCAGCATGTGTGG + Intergenic
998266784 5:140672898-140672920 CCCTCTTCCCACAGGCTGGGTGG - Exonic
998401844 5:141852497-141852519 CCCTAGGGGCCCAGGCTGGGAGG - Intergenic
998438080 5:142130986-142131008 CTCTCATGCCCCAGGCTGGAGGG + Intronic
998463400 5:142325350-142325372 ACCTCCTCTCGCAGGCTGGGAGG - Intronic
998737713 5:145161541-145161563 CCCTCCATAGCCATGCTGGGAGG - Intergenic
999721464 5:154401996-154402018 CCGTCCTGACCCTGGGTGAGGGG - Intronic
1000220147 5:159207900-159207922 CAGTCGTGACCCAGGCTGAGCGG - Intronic
1000542399 5:162556118-162556140 CCCTGGTGACCAAAGCTGGGGGG + Intergenic
1001249422 5:170135192-170135214 CTCTCCTTACCCAGGCAGAGTGG - Intergenic
1001387038 5:171348440-171348462 CCCCCGTCACCCAGGCTGGAGGG + Intergenic
1001493953 5:172174874-172174896 ACCACCTGACCCAGGCTGGCTGG + Intronic
1001792056 5:174466220-174466242 CCCTCCTGTCCCTGGCTCGGCGG + Intergenic
1002043363 5:176529621-176529643 CCCTCCTGAACCTGGCCGAGCGG - Exonic
1002085312 5:176771247-176771269 CCCATGTAACCCAGGCTGGGTGG - Intergenic
1002175862 5:177400709-177400731 CCCACGTGCCCCAGCCTGGGTGG - Intergenic
1002313370 5:178328106-178328128 CCCTCCGCACCCAGGCAGGGAGG - Intronic
1002921714 6:1577554-1577576 CCTACCTGGCCCAGGCTGGAAGG + Intergenic
1003696835 6:8415496-8415518 CCCTTCTGTCCCAGGCAGAGTGG + Intronic
1004220995 6:13746158-13746180 CTCTCGTTACCCAGGCTGGAGGG - Intergenic
1004631471 6:17425689-17425711 CCCTCCGGACCCAGGGAGGTAGG - Intronic
1005928490 6:30464128-30464150 CCATCCCGCCCCAGGCTGGAGGG - Intergenic
1006985402 6:38172521-38172543 ACCTCCTTTCCCAGGCTGGAGGG - Exonic
1007506073 6:42336462-42336484 ACCTCCTGACCAAGGTTGGGAGG - Intronic
1007600098 6:43076191-43076213 CCCTCCTCGCCGAGGCGGGGAGG - Intergenic
1008505480 6:52225767-52225789 CGCTCGTCACCCAGGCTGGAGGG + Intergenic
1012209294 6:96500103-96500125 CCCTCCTGTGCCTGGCTTGGTGG - Intergenic
1013075682 6:106769234-106769256 CACTCATCACCCAGGCTGGAGGG + Intergenic
1013288509 6:108700075-108700097 CTCACCTGAGCCAGGCTGCGAGG - Intergenic
1013589072 6:111605203-111605225 CCGTCCAGCGCCAGGCTGGGAGG + Intronic
1015910180 6:138161863-138161885 CGCACCTGACCCAGGCGGGCGGG + Intergenic
1016501691 6:144727469-144727491 CACTCCTGAGCCAGGCGTGGTGG + Intronic
1017020289 6:150134415-150134437 ACCTTCTGACCGAGGCTGTGTGG - Intergenic
1017159632 6:151352580-151352602 TCCTCTTGACCTAGGCAGGGAGG - Exonic
1017836532 6:158183699-158183721 CCCTCCTGTGCCTGGCTCGGTGG - Intronic
1017947045 6:159104341-159104363 CCCTCCTGCCCATGCCTGGGAGG + Intergenic
1018908493 6:168088695-168088717 CACTCCTGTCCCAGGCAGGAGGG + Intergenic
1019291708 7:253719-253741 CCCTCCTAACCCCGCCCGGGAGG + Intronic
1019314095 7:376650-376672 CCAGCCTGGCCCAGGCTGTGGGG + Intergenic
1020791670 7:12635134-12635156 CACTCATCACCCAGGCTGGAGGG - Intronic
1020834046 7:13126644-13126666 CCCTCCTGTGCCTGGCTCGGTGG - Intergenic
1021076221 7:16307639-16307661 CTCTTCTGGCCCAGGCTGGAGGG - Intronic
1022909187 7:34883424-34883446 CCCTCCTAACACAGGCCTGGAGG - Intergenic
1023954180 7:44871650-44871672 CCCTCACTTCCCAGGCTGGGCGG + Intergenic
1024095030 7:45976383-45976405 CCATCCTCACCAGGGCTGGGAGG + Intergenic
1024700390 7:51899787-51899809 CCTCCCAGACCCAGGCAGGGCGG + Intergenic
1026676935 7:72436020-72436042 CCATTTAGACCCAGGCTGGGGGG - Intronic
1026932141 7:74229146-74229168 CTCTCCCGACCCAGGCTTTGTGG + Exonic
1028140049 7:87263644-87263666 CCCTCCTGTGCCTGGCTTGGGGG - Intergenic
1028405354 7:90468076-90468098 CACTCCTGAGCCAGGCATGGTGG + Intronic
1028814609 7:95130131-95130153 CCCTCCCATCACAGGCTGGGAGG + Intronic
1030784320 7:113641154-113641176 CCCTCCTATCCCAGGCCTGGAGG - Intergenic
1031170854 7:118290690-118290712 CCCTCCTGTCACAGGCCTGGAGG + Intergenic
1033516532 7:142112187-142112209 CCTTCCTGCCCAAAGCTGGGAGG - Intronic
1033588380 7:142791027-142791049 CCCTCCTGCCCCAGGGGAGGAGG + Intergenic
1034489709 7:151386759-151386781 CCCTCCTGCCTCAGGCTCGGAGG + Intronic
1034942003 7:155236732-155236754 CCCTCCTGCCCCAGGCTGCCAGG + Intergenic
1035135475 7:156698738-156698760 CCCTCCCATCACAGGCTGGGAGG - Intronic
1035405809 7:158596459-158596481 GCCTCCTAACCCTAGCTGGGAGG + Intergenic
1035881470 8:3247624-3247646 GCCTGCTGACCCAGGCTCAGAGG - Intronic
1036513156 8:9419365-9419387 CCCTCCTGACCCATGCTTTCTGG + Intergenic
1036749699 8:11436023-11436045 CCGCCCTGAGCCAGGCTGTGAGG - Intronic
1038530452 8:28314359-28314381 CTGTCCAGAGCCAGGCTGGGTGG - Intergenic
1039589513 8:38734828-38734850 GCCTGCTGACGCAGGCTGGCGGG + Intronic
1040038537 8:42895024-42895046 CACTGCTGACCCAGGCTCGGTGG + Intronic
1040456398 8:47602560-47602582 ACCACCTGACCTGGGCTGGGTGG - Intronic
1040579910 8:48689330-48689352 CCCCCTTCCCCCAGGCTGGGAGG - Intergenic
1041673729 8:60517290-60517312 GCCTCCGGACCCGGGCTGAGGGG + Intronic
1042269575 8:66941613-66941635 CTCTCATCACCCAGGCTGGAGGG + Intergenic
1043619786 8:82175742-82175764 ACCTCCTGACCCAAGCTGTGAGG - Intergenic
1044264002 8:90161509-90161531 GCACCCTGACCCAGGCTGTGAGG + Intergenic
1044741595 8:95332794-95332816 CCCTCCAGACACATTCTGGGTGG - Intergenic
1047998651 8:130358801-130358823 CGCTCCCGACCCCGGCTGCGCGG + Intronic
1048274850 8:133058505-133058527 CCCCTCTGCCCCAGGCTGAGAGG + Intronic
1048302588 8:133262457-133262479 CCATCCTGACCCTGGCTGACTGG - Intronic
1049326576 8:142024627-142024649 CCCTGCTGACCCAGGTAAGGAGG + Intergenic
1049591582 8:143465261-143465283 CCCCTCTGCCCCAGGCTGGGTGG + Intronic
1049719971 8:144111256-144111278 CCCTCCTTTCCCACTCTGGGTGG + Intronic
1049998128 9:1050439-1050461 TTCCTCTGACCCAGGCTGGGCGG - Exonic
1051575060 9:18605871-18605893 CACGCTTGACCCAGGCTGGGTGG + Intronic
1051925170 9:22316786-22316808 CCCTCCTGTCACAGGCCTGGAGG + Intergenic
1054868360 9:70025793-70025815 ACCTCTTGTCACAGGCTGGGAGG - Intergenic
1056554285 9:87676163-87676185 CCCACCTGGCCCAGCCAGGGAGG + Intronic
1056850913 9:90082704-90082726 CCCTACTGAGCCAGGCTGGGCGG - Intergenic
1057750561 9:97789361-97789383 CCCTCCTGGCCAAGGCTTGGGGG - Intergenic
1059473002 9:114521257-114521279 CTCTCATCACCCAGGCTGGAGGG - Intergenic
1059567726 9:115399878-115399900 CCCTCCTTGCCCATGGTGGGAGG - Intronic
1060220198 9:121760457-121760479 GGCTCCTGACACAGGCTGGGCGG + Intronic
1060361843 9:122966487-122966509 CTCTTGTCACCCAGGCTGGGGGG - Intronic
1061073458 9:128326357-128326379 CCCTCCAGCCCCAGGCAGGGAGG + Intronic
1061160668 9:128892244-128892266 CGCTCCTGCCCCAGCCTGGCAGG + Intronic
1062189310 9:135239560-135239582 ACCCCCTCACCCAGGCTGGAAGG + Intergenic
1062303095 9:135886894-135886916 CCGTCCTGCTCCAGGCTGGCAGG - Intronic
1062479773 9:136745906-136745928 CCCTTCTTTTCCAGGCTGGGAGG - Exonic
1062501174 9:136852677-136852699 CCCTCTTGTCCCAGACTGGGAGG - Intronic
1062600982 9:137318461-137318483 CGCTCCTCAACCATGCTGGGGGG + Intronic
1062614977 9:137392271-137392293 GCCTCCTGACCCAGCGCGGGAGG + Intronic
1203530498 Un_GL000213v1:138690-138712 CCCTCCTGGCGCAGGGAGGGAGG - Intergenic
1186389454 X:9144145-9144167 CCTTCCTCACCCTGGCTGGCTGG + Intronic
1187663255 X:21573755-21573777 CCCTCATGTCACAAGCTGGGAGG - Intronic
1188034242 X:25298849-25298871 TCTTCCTGACTCAGGCTGGATGG + Intergenic
1188115642 X:26239107-26239129 CCCTCCTGTCACAGGCCTGGAGG - Intergenic
1188358612 X:29224101-29224123 CCCTACTGAATCAGTCTGGGAGG - Intronic
1189224519 X:39401609-39401631 CCATCATGAGCCAGACTGGGGGG - Intergenic
1189239950 X:39517244-39517266 CCCTCCTGAGCCATGCTAGGGGG + Intergenic
1189310664 X:40015070-40015092 CCACCCTGACCCCGGCTGGAAGG + Intergenic
1189757090 X:44282944-44282966 CTGGCCTGACCCAGGCTGGCAGG + Intronic
1192165704 X:68826546-68826568 ACCTCCTGACCCACCCTGGCGGG - Intergenic
1192251839 X:69420271-69420293 CCATCCTGACACAAGATGGGGGG - Intergenic
1192451893 X:71249949-71249971 CCCTGCAGCCCCAGGATGGGAGG + Intronic
1192638660 X:72843909-72843931 CACTCGTTACCCAGGCTGGAGGG - Intronic
1192643052 X:72876899-72876921 CACTCGTTACCCAGGCTGGAGGG + Intronic
1193542443 X:82788590-82788612 CCCTCCTGTGCCTGGCTTGGTGG + Intergenic
1194624617 X:96213574-96213596 CCCTCCTGTCACAGGCTTGGAGG - Intergenic
1194982294 X:100453113-100453135 CCCTCCCATCACAGGCTGGGAGG + Intergenic
1195302530 X:103544672-103544694 CACTCCAGACCCAGGCTCTGTGG + Intergenic
1197301751 X:124789281-124789303 CCCTCCCATCACAGGCTGGGAGG - Intronic
1199793336 X:151175076-151175098 CCCTCTTGCCCCGGGGTGGGTGG - Intergenic
1200133735 X:153864763-153864785 CCCTCCTGGACCCGGCTGGCCGG + Intronic