ID: 1100867040

View in Genome Browser
Species Human (GRCh38)
Location 12:98868146-98868168
Sequence CTGGACACTCAGAGTCTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100867040 Original CRISPR CTGGACACTCAGAGTCTAGA AGG Intronic
900975683 1:6014863-6014885 GGGGACACTCTGAGTCTGGAAGG - Intronic
907113953 1:51952177-51952199 CAGAACACTCACAGTCTAGTGGG + Intronic
907242087 1:53086467-53086489 CAGGTCACTCAGCGTCAAGAGGG - Intergenic
909248540 1:73322279-73322301 ATGGATATTCAGAATCTAGAAGG - Intergenic
912955325 1:114151648-114151670 CCTGACCCTCAGAGCCTAGAGGG - Intronic
914213731 1:145605932-145605954 CTGGGGACTCAGAGCCCAGATGG + Intergenic
914423249 1:147549515-147549537 CTGGACAATCAGAGAATAGAAGG + Intronic
914465674 1:147926337-147926359 CTGGGGACTCAGAGCCCAGATGG + Intergenic
916028384 1:160855286-160855308 CAGGACACTGAGAGTCCAGCTGG + Intronic
916402742 1:164466769-164466791 CTGGAAACTCAAAGACAAGAAGG - Intergenic
916781940 1:168042624-168042646 CTGGAATAACAGAGTCTAGAAGG + Intronic
918602076 1:186375603-186375625 CTGGACACTGAGCCACTAGAGGG + Intronic
920928261 1:210363276-210363298 AGGGACACTCAGAGGCCAGAAGG - Intronic
923102076 1:230824692-230824714 CTGGACACCCAGAAGCTAGCTGG - Intergenic
1063064477 10:2594588-2594610 CTGGAAAGTCAGAGTCCACAGGG - Intergenic
1064225240 10:13477922-13477944 CTGAACCCTCAGAGGGTAGAAGG - Intronic
1065616780 10:27535359-27535381 CTGGACACCCCTAGTCTAGAGGG + Intronic
1069331488 10:67298609-67298631 CTGATCACTCATAATCTAGAGGG - Intronic
1070753564 10:78977781-78977803 CTGGAAACCCAGGGTCTGGAGGG - Intergenic
1070761125 10:79024994-79025016 CTGGAGCCTCAGACTCTAGTAGG - Intergenic
1074538935 10:114349064-114349086 CTGGACAGTAAGAGTGCAGAAGG + Intronic
1075408573 10:122211034-122211056 CTGCACTCTCTGAGTCCAGAGGG - Exonic
1075432612 10:122401160-122401182 CTGAACACTCTGAAGCTAGAGGG + Intronic
1076309537 10:129494719-129494741 ATGGACACTGCCAGTCTAGACGG + Intronic
1078131466 11:8617586-8617608 CTGGACACTAAAAGGTTAGACGG + Exonic
1078358372 11:10649393-10649415 CTGAACAGGCAGAGTCTAGGAGG + Intronic
1078906945 11:15696368-15696390 CTGGAAGCTCATAGTCTATAAGG + Intergenic
1079619428 11:22535170-22535192 CTGGACACTGAGAGAGAAGAAGG - Intergenic
1080414323 11:32055407-32055429 CTGGACTCTCAGTAGCTAGAAGG - Intronic
1082811318 11:57480772-57480794 CTGGACTCTCAGAGTCTGTTGGG - Intergenic
1084147733 11:67273923-67273945 CTGGACACACAAAGTCTCCAAGG - Intronic
1084182049 11:67451707-67451729 TTGGACCCTCAGAATCTAGCTGG + Exonic
1084547301 11:69820801-69820823 CTGGAGCCTCAGACTCTTGATGG + Intergenic
1087400993 11:97667162-97667184 CTGGGCACTCTGAGTGCAGAGGG - Intergenic
1088421510 11:109653319-109653341 CTGGGCACTCAGTGGCTGGAAGG - Intergenic
1090124966 11:124075751-124075773 CTGGATGCTCAAAGTCTGGAGGG + Intergenic
1091206713 11:133826474-133826496 ATGGAGGCTCAGAGACTAGAGGG - Intergenic
1091821155 12:3476101-3476123 CTGGAAACTCAGTGTTTAGAGGG - Intronic
1095747645 12:45677356-45677378 CTGGATTTTCTGAGTCTAGAGGG + Intergenic
1096004906 12:48161637-48161659 CTGGACACCCAGATTCAGGAGGG + Intronic
1100867040 12:98868146-98868168 CTGGACACTCAGAGTCTAGAAGG + Intronic
1101584581 12:106074081-106074103 CAGGAAACTCAGAGTCTGGTAGG - Intronic
1105458382 13:20561876-20561898 CTGGACACTGAAACTCAAGAAGG - Intergenic
1106571768 13:30934096-30934118 CTGAACTCTCAAAGTCTGGAAGG - Intronic
1107805287 13:44148066-44148088 CTGGGAACTCACAGTCTGGAGGG - Intronic
1109615383 13:64828064-64828086 CTGGAAACCCAGGGTCTGGAAGG - Intergenic
1110528637 13:76570784-76570806 ATGAGCACTGAGAGTCTAGAGGG + Intergenic
1110901031 13:80824859-80824881 CTGGAGACTCAGAGTGGAGAGGG - Intergenic
1111343753 13:86922854-86922876 CTGGAGCCTCAGAGCTTAGATGG - Intergenic
1113116954 13:106884707-106884729 CTGGACACCCAGAGTGGAGGAGG - Intergenic
1115518962 14:34213811-34213833 CTGTACTCTCAGGGACTAGAAGG + Intronic
1117023856 14:51599904-51599926 CTGGGTCCTCAGAGTCTGGACGG + Intronic
1120945950 14:89997211-89997233 TTGGCCTCACAGAGTCTAGAGGG - Intronic
1121272696 14:92648701-92648723 CTGGAAACTCTGAGTCTGGTGGG + Intronic
1123828683 15:24109759-24109781 GTGGATACTCTGAGTCTAAAGGG - Intergenic
1127810193 15:62559163-62559185 CTGCACACTGAGAGTCAAGAGGG - Intronic
1128215740 15:65932995-65933017 CTGGACCCTTAGAGTTGAGAAGG - Intronic
1129053575 15:72803287-72803309 CTTGAGGCTCACAGTCTAGAGGG + Intergenic
1129525833 15:76213684-76213706 CTGTACTCTCAGAGTCTGGAAGG + Intronic
1131017221 15:89067803-89067825 TTGGACTCTCAGAGCCCAGAAGG - Intergenic
1131099086 15:89673912-89673934 CTGGTCAAGCAGAGTCTTGAAGG - Intronic
1132248684 15:100317306-100317328 CTGAACACTCAGGGTGTAAAAGG + Intronic
1135971985 16:27078953-27078975 CTGGACACACACAGTCGTGATGG + Intergenic
1140361569 16:74348883-74348905 CTGGAGATTCAGAATCTACAGGG - Intergenic
1143375231 17:6463306-6463328 GAGGACACTCAGAGTCTGGTGGG - Intronic
1146514325 17:33477639-33477661 GTGGACACTCAGTGTCTAGGAGG - Intronic
1147566095 17:41537268-41537290 CTTGAAGCCCAGAGTCTAGAAGG - Intergenic
1148450531 17:47774859-47774881 CTGTACTCTAAGAGTCTAAAGGG - Intergenic
1157643468 18:49242540-49242562 CTTGACACACAGCCTCTAGATGG + Intronic
1159175852 18:64832655-64832677 CTGGAAACTCATAGTACAGAAGG - Intergenic
1160553495 18:79711382-79711404 CTGGATACTCAGAGGCAAAAGGG - Intronic
1160979569 19:1810815-1810837 CTGGACATTCAGAGCCTGGCGGG - Intronic
1161193348 19:2972065-2972087 TTGGAAACTCAAAGTCTAGAAGG - Intergenic
1161693823 19:5753981-5754003 CTGGAAATACAGAGTCTAGTGGG + Intronic
1161902027 19:7126126-7126148 CTGGAGCCTAAGAGGCTAGATGG + Intronic
1164702541 19:30296174-30296196 CTGGACACTGTCAGTCTGGAAGG - Intronic
1165834456 19:38745634-38745656 CACGCCACTCAGAGTCTGGATGG + Intronic
926125628 2:10270116-10270138 CAGGACACTGTGAGTCCAGAGGG - Intergenic
926736739 2:16079174-16079196 CTGGGAACTCAGAGTCGAGCAGG + Intergenic
931119674 2:59202241-59202263 CTGCACACTCAGAGTCAACCTGG - Intergenic
933496669 2:83058448-83058470 CTGGCCTCTCATTGTCTAGATGG + Intergenic
934510388 2:94934860-94934882 CTTGCCACTCAAACTCTAGATGG + Intergenic
935094591 2:99932310-99932332 CTGGACACTCCTGGTATAGATGG + Intronic
936795679 2:116201146-116201168 CTGGACACTCAGTGTGGACAAGG - Intergenic
937868867 2:126773404-126773426 CTGGACCCTCACAGGCAAGAGGG + Intergenic
940791677 2:158035626-158035648 CTGGCCAATCAGAGTCTACCTGG + Intronic
941381300 2:164795964-164795986 CAGGAGACACAGTGTCTAGAGGG - Intronic
941684409 2:168433671-168433693 CTAGACACACAGAGTGGAGAAGG + Intergenic
944166698 2:196729949-196729971 CTGGATACTCAAAGACTGGAAGG - Exonic
944743474 2:202634648-202634670 CTGGGGACTCAGACTCTGGAAGG - Intergenic
945043631 2:205763329-205763351 CTGGCCTCTCAGAATCTAGAGGG + Intronic
945294249 2:208155267-208155289 ATGGACACTCTGAATCTAGAAGG - Intergenic
946668089 2:222072404-222072426 GTGGACACTCAGAGGGCAGATGG - Intergenic
946956107 2:224931462-224931484 CTGGACTCTCTGAATCTACAGGG + Intronic
947933966 2:233987573-233987595 CTGGACACTGGGAGACCAGATGG - Intronic
948183465 2:236001094-236001116 ATGGACCCTCAGAGGCGAGACGG + Intronic
1169875472 20:10292625-10292647 CTGGACACTCAGAATCAAACAGG + Intronic
1170143926 20:13152488-13152510 CAGGACACTGAGAGTCCTGATGG - Intronic
1170161667 20:13319740-13319762 CTGCACACACACACTCTAGAGGG + Intergenic
1173105200 20:40127181-40127203 CTGGACACCCACAGCCTTGAGGG - Intergenic
1173320054 20:41979283-41979305 GGGGAAACTCAAAGTCTAGAGGG + Intergenic
1173320493 20:41983193-41983215 CAGGAAACTCAAAGTCTAAAGGG - Intergenic
1176021333 20:62963787-62963809 CAGGACCCTCAGAGTCCAGGAGG - Intronic
1178363263 21:31967698-31967720 CAGGACACTCAGAGTCTCAAGGG - Intronic
1179578185 21:42320822-42320844 CTGGACACCCTCGGTCTAGATGG + Intergenic
1181295525 22:21835523-21835545 CTGCACACTCAGAGTCAAGTAGG + Intronic
1181317403 22:21979468-21979490 CTGGGGACTCAGAGTCCACATGG - Intronic
1181689090 22:24548530-24548552 CTGGACAGTGAGAGCCAAGAGGG - Intronic
1183147311 22:36005296-36005318 AAGCACACTAAGAGTCTAGAAGG + Intronic
1183741542 22:39671134-39671156 CAGGAAGCTCAGAGTCTGGAAGG + Intronic
1184586636 22:45452495-45452517 CAGGACACTCAGGGTGCAGATGG + Intergenic
1185308728 22:50140449-50140471 TTGGACACCCATGGTCTAGAAGG - Intronic
950456768 3:13097369-13097391 CTGGAGACTCAGTGACTGGAGGG - Intergenic
950698995 3:14727128-14727150 CTGGACATTCAGACTGAAGATGG - Intronic
951072559 3:18349419-18349441 CTGGGCAGACAGAGTCTGGATGG + Exonic
952115606 3:30177230-30177252 CTGCACTTTCAGAGTCTTGAGGG + Intergenic
953150391 3:40319283-40319305 GTGGAGAGTCAGAGGCTAGATGG - Intergenic
954386925 3:50249026-50249048 CTGGCCACTGAGAGTGAAGAGGG - Intronic
956190912 3:66607487-66607509 CTTGGGACTCACAGTCTAGATGG - Intergenic
958161269 3:89818908-89818930 CTTGACACCCAAAGTCTGGAGGG + Intergenic
960369917 3:116822519-116822541 CTGGTCACTCAAATTTTAGAAGG + Intronic
961235072 3:125359185-125359207 CTGGAGACTCAGAGTGTTGAAGG - Intronic
961441282 3:126954759-126954781 CTGGGGTCTCAGACTCTAGAGGG + Intronic
961738138 3:129015139-129015161 CTGGTCACTCACAGTCATGATGG - Intronic
961794725 3:129401430-129401452 CTGGACACTTTGAGTCCAGAGGG + Exonic
962051999 3:131825979-131826001 CAGGTCACTCAGAATTTAGAGGG + Intronic
962888912 3:139653988-139654010 CTGGACACTGAGGGACAAGAGGG - Intronic
963047689 3:141115103-141115125 CTGGACACTCAGACACTAAATGG + Intronic
964413221 3:156421299-156421321 CAAGAAACTCAGATTCTAGAAGG + Intronic
964956633 3:162366733-162366755 CTTTACACTCACAGTATAGAAGG - Intergenic
968143015 3:196274016-196274038 CTGGACACCCAAAATCCAGAGGG + Intronic
970637791 4:18028502-18028524 CTAGACTATCAGAGTTTAGAGGG + Intergenic
971231722 4:24805544-24805566 CTAGACATTCAGACTCTAAAAGG - Intergenic
974819768 4:67051668-67051690 AGGGACACTCACAGTCTTGAGGG + Intergenic
975271388 4:72438084-72438106 CTGCACACACAGAGTAAAGATGG - Intronic
978932145 4:114327728-114327750 CTGGACACTGTGAGTCCAGCAGG - Intergenic
979672962 4:123380722-123380744 CTGGAGCCTTATAGTCTAGAAGG + Intergenic
979869231 4:125796403-125796425 TTGGACACCCACAGGCTAGAAGG + Intergenic
980468757 4:133221536-133221558 ATGGAGACACAGAGGCTAGAAGG - Intergenic
980677018 4:136098800-136098822 CTGAACATTCAGAGTCTGTAAGG + Intergenic
981168262 4:141588778-141588800 CTGGAGCCTCAGGGTTTAGAAGG - Intergenic
982546130 4:156735466-156735488 CTGGCCACTCAAAGTGTACATGG + Intergenic
988846688 5:35134757-35134779 CTGGAGACTCACTGTCTAGGAGG - Intronic
990330392 5:54719784-54719806 CTGGATGCTCACTGTCTAGAGGG + Intergenic
991258227 5:64638470-64638492 CTGGAAAGTCAGAGACTAAAAGG + Intergenic
997354218 5:133252036-133252058 CTGGACACTCAGAAGCCAGCCGG + Intronic
997522791 5:134534034-134534056 CTTGACACGCAGACTCTGGAAGG + Intronic
997864104 5:137445449-137445471 CTGGGCACTCAGAGGCAACAGGG + Intronic
998516430 5:142758678-142758700 CTGGAAACTCTGAGTCTATGTGG + Intergenic
998537926 5:142951684-142951706 CTGGCCACTCAGAGTAGAGGAGG + Intronic
998697607 5:144657923-144657945 CAGAACACTCATATTCTAGATGG - Intergenic
1001267420 5:170284002-170284024 CAGGACACTCACATTCTAAAGGG - Intronic
1003062038 6:2871246-2871268 CTGGAAACTCATATTGTAGATGG - Intergenic
1007193086 6:40036604-40036626 CTGGACACTCAGACTTGAGGTGG - Intergenic
1007232717 6:40359664-40359686 CTGTATACCCAGTGTCTAGAAGG - Intergenic
1007242049 6:40433117-40433139 CTGGTCACTCAGCGCCTGGAAGG + Exonic
1008577565 6:52875749-52875771 AAGGACACTAAGAGTTTAGAGGG - Intronic
1011880786 6:92023101-92023123 CTGGGGACTTAGAGTCTAAAAGG - Intergenic
1012445203 6:99300264-99300286 CTGGACACTCAGAGAATCCATGG + Intronic
1014157084 6:118123787-118123809 CTGGAAACTCTGAGTCAAAATGG + Intronic
1015236459 6:130976908-130976930 CTGGACATTTACAGTCTAGCAGG + Intronic
1015842008 6:137487293-137487315 CTGTGCCCTCAGAGCCTAGAGGG - Intergenic
1017421317 6:154275756-154275778 CTGGACATTCACTGGCTAGAAGG + Intronic
1020345364 7:7156439-7156461 CAGGAAACTCAGAGACGAGATGG - Intergenic
1022527987 7:31050613-31050635 CAGGAGTCTCAGAGTCAAGAGGG - Intergenic
1026458632 7:70594556-70594578 TTGAATACACAGAGTCTAGAAGG - Intronic
1026903084 7:74047728-74047750 CTGGAAGCCCACAGTCTAGAAGG - Intronic
1027683913 7:81257057-81257079 CTGCATACTCACAGGCTAGAAGG + Intergenic
1030541011 7:110830808-110830830 CTGGACACTCAGATACTCCAAGG + Intronic
1035833753 8:2727138-2727160 CTGGACACTCACAGTTTTGGGGG - Intergenic
1038171276 8:25135433-25135455 GGGGACTCTCAGAGTTTAGAAGG + Intergenic
1039678420 8:39699987-39700009 CTGGACACTCAGAGTGCATAGGG + Intronic
1041970349 8:63734113-63734135 CTGGACACGCAGATTCTAAAGGG + Intergenic
1043734770 8:83729574-83729596 TTTGACCCTCAGACTCTAGAAGG - Intergenic
1047536529 8:125725206-125725228 CTGGAGACTTAGAGACTAAAAGG + Intergenic
1048060481 8:130914815-130914837 CTAGACACTCGGATTCTGGAGGG + Intronic
1048247278 8:132820439-132820461 CTGGAAACTTAGAGTCTAGAAGG + Intronic
1050331566 9:4550997-4551019 CTGGAGTGTCAGAGTCTAGCTGG - Intronic
1052254067 9:26432975-26432997 CAAGAAGCTCAGAGTCTAGAGGG + Intergenic
1053644853 9:40114259-40114281 GTGGACACTCAGGATCAAGATGG - Intergenic
1053655003 9:40209489-40209511 CTTGCCACTCAAACTCTAGACGG - Intergenic
1053905389 9:42838694-42838716 CTTGCCACTCAAACTCTAGACGG - Intergenic
1054367118 9:64355705-64355727 CTTGCCACTCAAACTCTAGACGG - Intergenic
1054529596 9:66166826-66166848 CTTGCCACTCAAACTCTAGACGG + Intergenic
1054674747 9:67845446-67845468 CTTGCCACTCAAACTCTAGACGG - Intergenic
1189163698 X:38837921-38837943 CTGGACAATGAGTGTATAGATGG - Intergenic
1189192143 X:39119486-39119508 CTGGACACTCAAAGCCTAGGTGG - Intergenic
1192048474 X:67701285-67701307 CTGGACAGTACAAGTCTAGAAGG + Intronic
1192830786 X:74749057-74749079 CAAGATGCTCAGAGTCTAGAGGG + Intronic
1198516399 X:137412627-137412649 CTGGGCACTCAGAGTATAGCAGG + Intergenic
1200084400 X:153596343-153596365 CTGGGCTCTCAGACTCTAGTGGG + Intronic
1201474833 Y:14369228-14369250 CTGGAGACTCAGAATCTGGGAGG + Intergenic
1202133972 Y:21640863-21640885 CTAAAAACTCAGAGTCCAGAAGG - Intergenic