ID: 1100867102

View in Genome Browser
Species Human (GRCh38)
Location 12:98868720-98868742
Sequence AGCAATAATCAGATGGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100867102_1100867109 -10 Left 1100867102 12:98868720-98868742 CCTGACCCCATCTGATTATTGCT 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1100867109 12:98868733-98868755 GATTATTGCTCAGCAAATGGGGG 0: 1
1: 0
2: 0
3: 13
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100867102 Original CRISPR AGCAATAATCAGATGGGGTC AGG (reversed) Intronic
902055423 1:13596631-13596653 ATCAATATTCAGACGAGGTCAGG + Intronic
904491225 1:30860589-30860611 AGAAAGAATCACATGGGCTCCGG + Intergenic
905119846 1:35673181-35673203 AGAGAAAATAAGATGGGGTCTGG + Intergenic
908078573 1:60548438-60548460 GACAATAATAAGATGAGGTCTGG - Intergenic
908712266 1:67029677-67029699 AGCAAAGTTCAGAGGGGGTCAGG - Intronic
916475567 1:165165413-165165435 AGCAAGAAGCAGATGGGGGTTGG + Intergenic
920060987 1:203226873-203226895 AGTCATTATCAGATGGGGCCGGG - Intronic
922057258 1:222053088-222053110 AGCAAGACTCAGATGCAGTCAGG + Intergenic
1064960491 10:20958565-20958587 ATTAATATTCAGATGGGGTTTGG - Intronic
1065345739 10:24746397-24746419 AGCATTAAGCAGATGAGGTGAGG + Intergenic
1066697279 10:38090673-38090695 AGCAATAACCACAGGGGCTCTGG - Intergenic
1066995254 10:42556792-42556814 AGCAATAACCACAGGGGCTCTGG + Intergenic
1067224148 10:44364458-44364480 AGAAACAAACAGATGTGGTCAGG + Intergenic
1075508529 10:123048602-123048624 ATCAATAGACAGAAGGGGTCAGG + Intronic
1078564737 11:12404610-12404632 GCCAATAATTAGATGGGGACTGG + Intronic
1083375085 11:62213812-62213834 AGCAATCAACAGATGAGTTCTGG - Exonic
1084457883 11:69278824-69278846 TGCAATTATCCCATGGGGTCTGG - Intergenic
1089774277 11:120825517-120825539 AGCAAGAGTCAGCTGAGGTCGGG + Intronic
1093862850 12:24189055-24189077 AGCAAAAATGAGATGGGATATGG - Intergenic
1095120609 12:38414010-38414032 AGCAAAAATTAGATGGGTTTAGG + Intergenic
1095261544 12:40105096-40105118 ACCAACAAACAGATGGGCTCTGG + Intronic
1100697649 12:97113062-97113084 AGCAAGAAAAAGATTGGGTCTGG - Intergenic
1100867102 12:98868720-98868742 AGCAATAATCAGATGGGGTCAGG - Intronic
1107642427 13:42457171-42457193 AGTATTAATCAGATGGGTTAAGG + Intergenic
1107647688 13:42512369-42512391 AGTATTAATCAGATGGGTTAAGG - Intergenic
1108991558 13:56664420-56664442 AGCACTAATCAGAAGAAGTCTGG - Intergenic
1110947211 13:81437210-81437232 AGCCATAGTCTGTTGGGGTCTGG + Intergenic
1111800108 13:92970678-92970700 AGCCATTATTAGATGTGGTCAGG - Intergenic
1112012718 13:95305425-95305447 AACAACAATAAAATGGGGTCAGG + Intergenic
1114446866 14:22795357-22795379 AGCAATACTCAGATTGGGCACGG - Intronic
1115146792 14:30236109-30236131 AGCAAGAAACAGAGGGGGTTTGG + Intergenic
1115247127 14:31307152-31307174 AGCATTAATCAGATTGAGACAGG - Intronic
1115405473 14:33010722-33010744 AGAGATAATCACTTGGGGTCAGG + Intronic
1121090959 14:91182363-91182385 AGCCAGAAGCAGATGGGGTTAGG + Intronic
1122540465 14:102495244-102495266 AGCCAGAATCAGGTGGGGGCAGG + Intronic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1127447478 15:59079854-59079876 AGGAATAATGACATGGGGTAGGG + Intronic
1133928642 16:10214126-10214148 ATCAATAACCACATGGAGTCTGG + Intergenic
1136097376 16:27966885-27966907 AGCAACAATCACATGGGGCCAGG + Intronic
1140300780 16:73755423-73755445 ATCAATAAGTAGATGGGGCCTGG + Intergenic
1141058340 16:80839994-80840016 AACAATAATCAGATTAGGTGTGG - Intergenic
1143789162 17:9279747-9279769 ACCAAAAAACAGATGGGGTCAGG - Intronic
1144404513 17:14939840-14939862 GGCAATAAGCAGAAGGGGGCTGG - Intergenic
1146179528 17:30688445-30688467 TGCAAAAATCACATGAGGTCTGG - Intergenic
1147744418 17:42686539-42686561 AGAACTAATGAGATGGGGTTTGG + Intronic
1151276989 17:73042502-73042524 AGCAATAATCAGAAAGAGGCTGG + Intronic
1153020990 18:628960-628982 AAAAATAGTCAGATAGGGTCAGG - Intronic
1153675774 18:7454766-7454788 AGCAGTGAGCAGATGGCGTCAGG - Intergenic
1157684346 18:49630642-49630664 AGGATTACTCAGATGGAGTCTGG - Intergenic
1160430443 18:78807933-78807955 AGCACTAAACAGATGGGGAAAGG - Intergenic
1161275962 19:3417397-3417419 AGATTTAATCAGATGGGGTCAGG + Intronic
1163494198 19:17635294-17635316 ATTAATAAACAGATGGGGTCAGG - Intronic
1163896887 19:20067155-20067177 AGAACTAATCAGCTGGGGCCTGG + Intergenic
925629290 2:5872814-5872836 AGAAATAAGAAGATGGGGTAGGG - Intergenic
927291909 2:21412950-21412972 AGCAAGAAGCACAAGGGGTCGGG - Intergenic
930444096 2:51449369-51449391 AGCAACAATCAAAAGGGGTCGGG + Intergenic
935572186 2:104673443-104673465 AGTAAAAAGCAGATGGGGTGAGG - Intergenic
937960466 2:127454156-127454178 AGAAACAAGCAGATGGAGTCAGG - Intronic
938625109 2:133100386-133100408 AGCAATAATCATATGTAGTTGGG + Intronic
941677669 2:168361404-168361426 GGCAATCATTATATGGGGTCTGG + Intergenic
941979729 2:171441549-171441571 AGCAATAGGCAGCTGGGGACTGG + Intronic
942087592 2:172457896-172457918 AGCAGAAAGCAGATGGGATCTGG + Intronic
942663410 2:178290134-178290156 AGGAATAATAGGATGGGGTGGGG - Intronic
944524972 2:200609679-200609701 AGCAATAATCAGATCACATCCGG - Intronic
947728541 2:232415810-232415832 AGCAAGAACCAGATGGGTTTGGG - Intergenic
948022930 2:234751754-234751776 AGGGACAATTAGATGGGGTCTGG + Intergenic
1172358020 20:34293109-34293131 AGGAAGAATGAGATGGGGTATGG - Intronic
1173735370 20:45357607-45357629 TGCAACAATAAGATGAGGTCAGG + Intergenic
1174760115 20:53199049-53199071 AGCAACACTCAGATGGGTGCTGG - Intronic
1177463345 21:21441845-21441867 AGAAAAAATCAGATGGCGTAAGG + Intronic
1177511370 21:22091775-22091797 AGGAATAATGAGTCGGGGTCAGG + Intergenic
1177729066 21:25004999-25005021 GGCAATAGTCAGATGGGATTAGG - Intergenic
1182199573 22:28554573-28554595 AGAAATAATCAGCAGAGGTCTGG + Intronic
1184424518 22:44401626-44401648 TACAATAATCAGATGGGCTGAGG - Intergenic
951925521 3:27905350-27905372 GTCAATAATCAGATAGAGTCCGG + Intergenic
955633731 3:61002862-61002884 AGCAACTATCAGAAGGGGTATGG - Intronic
958498841 3:94879422-94879444 AGCATCATTCAGGTGGGGTCAGG - Intergenic
959933544 3:112007532-112007554 AGCAAAAATGAGATAGAGTCTGG - Intronic
961042489 3:123687317-123687339 AGCAATAATCAGAAGTGCCCAGG + Intronic
964572153 3:158119231-158119253 AGCAAAAATCAGAAAGGATCAGG - Intronic
967272908 3:187745398-187745420 AGCAATAATCACCTGGTGTCCGG + Exonic
967798089 3:193620971-193620993 GGCAATAATCAGAGGTGGTAAGG + Intronic
967958696 3:194900978-194901000 AAAAATCATCAGATGGGGGCAGG + Intergenic
968100474 3:195961399-195961421 AGTAATGATCTGATGGGGGCAGG + Intergenic
968296489 3:197580981-197581003 AGAATTAATCAGCTGGGGCCAGG - Intergenic
969113631 4:4858488-4858510 AGAAAAAATGAGTTGGGGTCAGG - Intergenic
969630580 4:8333505-8333527 AACAATAATGAGATGCGGTTTGG - Intergenic
969991051 4:11262666-11262688 AGAAATATTCAGATGAGGCCAGG + Intergenic
973212093 4:47627276-47627298 AATAATAATCAGATGAGGCCAGG - Intronic
973969913 4:56203242-56203264 AGCCATAATCAGCAAGGGTCTGG + Intronic
979906844 4:126304449-126304471 AGCAATAATCTGATGGCCTTTGG + Intergenic
979987276 4:127330698-127330720 AGCAAAAATCAAATGGGGTTGGG - Intergenic
981125298 4:141099042-141099064 AGAAATAATGAGATGGAGACAGG - Intronic
987166689 5:15205459-15205481 AGCAATGCTCAGATGAGGTTAGG + Intergenic
987630272 5:20461090-20461112 AGCAAAACTCAGAGGAGGTCAGG - Intronic
987686752 5:21214364-21214386 AGGGGTAAACAGATGGGGTCGGG - Intergenic
990059700 5:51632186-51632208 AGCAACAATCAGATAGGCTATGG - Intergenic
993332264 5:86615862-86615884 AGCAATATTCAGCTGAGGGCGGG + Intergenic
994063089 5:95503717-95503739 TGTAATAATGAGATGGGGTGGGG - Intronic
996587128 5:125101700-125101722 AGAAACAACCAGTTGGGGTCCGG - Intergenic
998019175 5:138755051-138755073 ATAAATATCCAGATGGGGTCAGG - Intronic
1000373133 5:160556173-160556195 AGCATTAATGGGATGGGGGCGGG + Intergenic
1004115335 6:12761198-12761220 GGCAAGAAACAGATGTGGTCTGG + Intronic
1005237756 6:23785425-23785447 AGCAATAATCAACTTGTGTCAGG - Intergenic
1009541757 6:64968874-64968896 AGCAATGATTGGATGTGGTCTGG - Intronic
1009807913 6:68626330-68626352 AGCGAGAATCAGATGAGGTAGGG + Intergenic
1010092039 6:71994240-71994262 AGCAAAAATCATTTGGGGTTTGG + Intronic
1011160211 6:84381199-84381221 AGCATTATTCAGATGGGCTGGGG - Intergenic
1014866945 6:126544154-126544176 AGCAATAATGAAATTGTGTCAGG - Intergenic
1015730088 6:136338553-136338575 ATCAAAAAAGAGATGGGGTCAGG - Intergenic
1017029699 6:150210369-150210391 AGGAATAAACAGATGGAGTTTGG - Intronic
1021571155 7:22066608-22066630 AGCACTAATTAGAGGGTGTCAGG - Intergenic
1021767157 7:23961543-23961565 ATCATTACTCAAATGGGGTCTGG - Intergenic
1027240663 7:76325971-76325993 AACAAAAAACAGATGGGGTCTGG - Intergenic
1028391505 7:90321936-90321958 AGCGATGATCAGATGGGGCTAGG + Intergenic
1035104997 7:156434850-156434872 AGCAAGAATGAGGTGGGGGCAGG + Intergenic
1041437529 8:57858886-57858908 TGCAATAATAAGATGAGGTATGG + Intergenic
1043480397 8:80646697-80646719 AGCCATTATGAGATGGGGTGAGG - Intronic
1044966549 8:97579342-97579364 AGCCATTATTAGATGGGGTTGGG - Intergenic
1048217719 8:132511850-132511872 AGCCATAATCAGGATGGGTCTGG + Intergenic
1049579050 8:143402706-143402728 AGCAAGAGGCAGCTGGGGTCAGG - Intergenic
1050309751 9:4340667-4340689 AACAAGAATCAGGTGGGATCTGG - Intronic
1051596267 9:18827032-18827054 GGCAATAATCAGATGGTGGATGG - Intronic
1051630119 9:19133112-19133134 AGAAATAATAAGTTGGGGCCAGG - Intronic
1053379504 9:37636767-37636789 ATCAAAAAGCAGATGGGGCCCGG - Intronic
1057217977 9:93239980-93240002 AGCAGGACTCAGATGGGGTGAGG + Intronic
1059810092 9:117846935-117846957 GGCAATTAGCAGATGCGGTCAGG - Intergenic
1060222108 9:121770033-121770055 AGCAAGGTTCAGATGGGTTCAGG + Intronic
1192581485 X:72286405-72286427 ATCAATAAGGAGATGGGGCCAGG - Intronic
1192739171 X:73876460-73876482 AGCAATAACCCCATGGGCTCTGG + Intergenic
1194884856 X:99301438-99301460 AGCACTAATTAAATGAGGTCAGG - Intergenic
1197909790 X:131468983-131469005 AGGAATAAACAGATGGAGTAAGG - Intergenic
1200971989 Y:9162536-9162558 AGCAGTAATCAGCTTGGTTCAGG + Intergenic
1202139040 Y:21701754-21701776 AGCAGTAATCAGCTTGGTTCAGG - Intergenic