ID: 1100867121

View in Genome Browser
Species Human (GRCh38)
Location 12:98868815-98868837
Sequence CTAAAATAAAGGGTAGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 1, 2: 1, 3: 35, 4: 367}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100867111_1100867121 12 Left 1100867111 12:98868780-98868802 CCAGTCTCTCACCAGCTGAGCTC 0: 1
1: 0
2: 0
3: 28
4: 247
Right 1100867121 12:98868815-98868837 CTAAAATAAAGGGTAGGGTGGGG 0: 1
1: 1
2: 1
3: 35
4: 367
1100867112_1100867121 1 Left 1100867112 12:98868791-98868813 CCAGCTGAGCTCTTTCCTCTGTT 0: 1
1: 0
2: 0
3: 49
4: 345
Right 1100867121 12:98868815-98868837 CTAAAATAAAGGGTAGGGTGGGG 0: 1
1: 1
2: 1
3: 35
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100867121 Original CRISPR CTAAAATAAAGGGTAGGGTG GGG Intronic
901701618 1:11047439-11047461 CCAAAAAAAAGGGAGGGGTGAGG - Intergenic
901943212 1:12679707-12679729 AAAAAAAAAAGGGTGGGGTGAGG + Intergenic
902371221 1:16008245-16008267 CTATACAAAAGGGTGGGGTGGGG + Exonic
902417275 1:16247733-16247755 CCAAAGTGTAGGGTAGGGTGAGG + Exonic
903490433 1:23724075-23724097 AAAAAATAAAGGGATGGGTGGGG + Intergenic
903836537 1:26207011-26207033 CTAAAAAAAAAGTGAGGGTGTGG + Intergenic
905433535 1:37941646-37941668 ATAAAATAAAGGGCCGGGCGCGG + Intronic
905760753 1:40555424-40555446 CTAAAATAAACTCTAGGGTTGGG + Intergenic
905830722 1:41064936-41064958 CTAACATAAATGGTATTGTGAGG - Intronic
907422198 1:54355012-54355034 CTAAAAGGAAGGGGAGGGTGAGG + Intronic
908753219 1:67444503-67444525 CAAAAATTAAGGGCCGGGTGAGG + Intergenic
909899938 1:81120678-81120700 ATAAAATAAAGCCTTGGGTGAGG - Intergenic
910348017 1:86263274-86263296 CTAAGAGAAAGTGTAGGATGAGG + Intergenic
910692866 1:89982604-89982626 CTAAAATAAAGTGAAAGGGGAGG + Intergenic
912848985 1:113104774-113104796 CTAAAATAAATGGTAGAGTTAGG - Intronic
914981814 1:152421463-152421485 CTGAAATAAAGGGATGGGTCTGG + Intergenic
914982158 1:152424413-152424435 CCAAAATAAAGGGATGGGTCTGG + Intergenic
918340515 1:183564411-183564433 CAAAAATAAAGAATAAGGTGAGG - Intronic
919089167 1:192957245-192957267 CTACAATAATGGGTATGTTGGGG + Intergenic
920085708 1:203414719-203414741 CCAAAATAAAGGGATGGGTCTGG - Intergenic
920428195 1:205895900-205895922 CTGAAATAAAGGGATGGGTTGGG - Intergenic
920704357 1:208240929-208240951 CTAAGATATAGGGTTTGGTGTGG - Intronic
922088043 1:222369671-222369693 CTGAAAGAAAGGGTGGGGAGTGG + Intergenic
1063567356 10:7182336-7182358 GTAAAATAAAGAGTAGAATGAGG - Intronic
1063703803 10:8411043-8411065 CAAAAATAAGGGGTGGGGGGAGG + Intergenic
1063914647 10:10869271-10869293 CTAAAATAACAGGTGGGGCGCGG + Intergenic
1064788647 10:18929331-18929353 CCAAAATAAAGAGTAAAGTGGGG - Intergenic
1066086879 10:31979769-31979791 CTAACTTAAAAGGTTGGGTGTGG + Intergenic
1066619311 10:37326994-37327016 CCAAAATAAAGGGATGGGTTTGG - Intronic
1066690998 10:38028110-38028132 ATAAAATAAATAGTTGGGTGTGG + Intronic
1067599680 10:47586765-47586787 AGAAAATAAAGGGTGGGGTCAGG - Intergenic
1068337383 10:55652783-55652805 CCAAAATAAAGGGATGGGTTTGG - Intergenic
1068633266 10:59320361-59320383 ATATAATATAGGGAAGGGTGGGG + Intronic
1069449948 10:68509045-68509067 CTAAAATTAAGGGCCGGGCGCGG + Intronic
1070126290 10:73625221-73625243 CTAAAATAAAGCGCAGGGTAGGG - Intronic
1072981646 10:100103169-100103191 CTGAAATAAAGGGATGGGTTTGG + Intergenic
1073276224 10:102313924-102313946 CTAAATTAAAGGGTAGAGGTGGG - Intronic
1073682153 10:105716310-105716332 GTAAAATAAAAGGTAGTGTCAGG - Intergenic
1077519971 11:3027118-3027140 CTAAGCTAATGGGTAGAGTGTGG - Intronic
1079023476 11:16927010-16927032 CTAAAATAAGAGGTTGGGTCAGG + Intronic
1079695201 11:23474073-23474095 CTAAAATAAAGGGTGAGTTGGGG + Intergenic
1080383472 11:31797013-31797035 CGAAAATAAAGCGAGGGGTGGGG - Intronic
1080710792 11:34746037-34746059 CTAAAAATAGGGGTGGGGTGGGG + Intergenic
1082831621 11:57622728-57622750 TGAAAATAAAGGCTAGAGTGGGG - Intergenic
1083064559 11:59911024-59911046 CTACAATAAAGGTTAGTATGTGG - Intergenic
1083451037 11:62745430-62745452 CTAAAATAAGTGGCCGGGTGCGG + Intergenic
1084808941 11:71600663-71600685 CTAAAATCCAGGGTAGGAAGAGG - Intronic
1085337651 11:75708364-75708386 CCAAAATAAAGGGATGGGTTTGG + Intergenic
1085753996 11:79188784-79188806 CTAAAGCCAAGGATAGGGTGTGG + Intronic
1086316292 11:85596641-85596663 GGAAAAAAAAGGGTAGGATGGGG + Intronic
1087268720 11:96089135-96089157 CCAAAGTCATGGGTAGGGTGGGG - Intronic
1087730311 11:101771319-101771341 ATAAAATAAAGGTCAGTGTGTGG - Intronic
1090305464 11:125687535-125687557 CCAAAATAAAGGGATGGGTCTGG - Intergenic
1092076180 12:5675519-5675541 CTATAAGAAAGGCTAGGGTTTGG - Intronic
1092310002 12:7342354-7342376 CCAAAATAAAGGGATGGGTTTGG - Intergenic
1092944074 12:13436860-13436882 CTAAAAGTCAGGGTAGGCTGGGG - Intergenic
1093767271 12:22979304-22979326 CAAAAATAAAGTGGTGGGTGAGG - Intergenic
1094573852 12:31665763-31665785 CTGAAATAAAGGGATGGGTTGGG + Intronic
1094728797 12:33151300-33151322 CTGAAATAAAGGGATGGGTTTGG + Intergenic
1095205049 12:39430273-39430295 ATAAAATTAAGGGTCAGGTGTGG + Intronic
1096740314 12:53688714-53688736 CTAAAATAAAGAGTAGAATTTGG - Intergenic
1100011485 12:89959421-89959443 ATAAAATGGGGGGTAGGGTGGGG + Intergenic
1100867121 12:98868815-98868837 CTAAAATAAAGGGTAGGGTGGGG + Intronic
1102667978 12:114592340-114592362 CTGAAATAAAGGGACGGGTCTGG - Intergenic
1103174173 12:118847558-118847580 AAAAAATAGAGGGTCGGGTGTGG - Intergenic
1103485020 12:121276884-121276906 CAAAAAAAAAGGGCGGGGTGGGG + Intronic
1103833624 12:123800726-123800748 TTAAAATATGGGGTTGGGTGTGG + Intronic
1103927713 12:124433044-124433066 CTGAAATATGGGGTGGGGTGGGG - Intronic
1103991409 12:124801858-124801880 ATAAAATAAAGGGCCGGGCGCGG + Intronic
1104464831 12:128981888-128981910 CTCACGTGAAGGGTAGGGTGTGG + Intronic
1104617243 12:130281137-130281159 AAAAAATAAAGGGGAGGGTGGGG + Intergenic
1107171475 13:37347315-37347337 CTAAAATAAAGGGACAGGTCTGG + Intergenic
1108338496 13:49472059-49472081 TTAAAAAAAATGGTTGGGTGCGG - Intronic
1108872305 13:55002330-55002352 CTCAAATAAAGGGTAGGTCAGGG + Intergenic
1109050440 13:57474047-57474069 GTAAAATAAAGGGTTGTGTAGGG - Intergenic
1109170349 13:59088517-59088539 CTCAAATAATGGGAAAGGTGGGG - Intergenic
1110346821 13:74458338-74458360 CTAAAAGAAAGGATTGGCTGTGG + Intergenic
1110451174 13:75638256-75638278 TAAAAAAAAAGGGAAGGGTGTGG - Intronic
1110576068 13:77056338-77056360 CTAATATAAAGGGTAGAATGTGG - Intronic
1110587799 13:77215190-77215212 CTTAATCAAAGGATAGGGTGAGG + Intronic
1111053747 13:82921071-82921093 TTAAAATAACAGGCAGGGTGTGG + Intergenic
1111300323 13:86341307-86341329 CTAGAAAATAGGGTAGTGTGTGG - Intergenic
1111518796 13:89371669-89371691 CTAAAATAAAGGAAGGGATGGGG + Intergenic
1111626242 13:90791277-90791299 ATAAAATAAAGAGCATGGTGAGG - Intergenic
1111765829 13:92527460-92527482 GTAAAATAGGGGGTAAGGTGTGG + Intronic
1112380223 13:98882105-98882127 CTAAAACAAAGGGAAGGCTGTGG + Intronic
1113084443 13:106553952-106553974 ATAAAACAAAGGCTAGGGTGTGG - Intronic
1115204458 14:30887015-30887037 CTAAAATAAAAGTTAGGGTTGGG - Intronic
1115361362 14:32506821-32506843 CTAAAATGAGGGGCTGGGTGTGG - Intronic
1116207693 14:41889500-41889522 CTACAAAAAAGTGTGGGGTGGGG - Intronic
1116232576 14:42235867-42235889 CTGAAATAAAGGGATGGGTCTGG - Intergenic
1116813017 14:49557280-49557302 CTACAATAAAAGGTAGAGTTGGG - Intergenic
1117048332 14:51835514-51835536 CTCAAATCAAAGGTAGGGGGTGG - Intronic
1117082275 14:52164847-52164869 CTGAAATAAAGGGATGGGTCTGG - Intergenic
1117209163 14:53477554-53477576 ATAAAATAAGGGGCTGGGTGCGG - Intergenic
1117916000 14:60678669-60678691 CTAAAATACTTGGTTGGGTGTGG + Intergenic
1118057836 14:62100364-62100386 AAAAAAAAAAGGGTGGGGTGGGG - Intronic
1118538283 14:66792919-66792941 CCAAAATAAAGGGGTGGGTCTGG + Intronic
1118567642 14:67159853-67159875 CTAAAAGGCAGGGTGGGGTGGGG - Intronic
1118986857 14:70763684-70763706 CTAAAATAATTAGTTGGGTGTGG - Intronic
1119004269 14:70908895-70908917 CTAAAGCACAGGTTAGGGTGGGG + Intronic
1119402608 14:74373912-74373934 CTAAAATAACAGGAAGGCTGAGG - Intergenic
1119876084 14:78060564-78060586 CTAAAATGAAGGTTTGGGAGTGG + Intergenic
1123585980 15:21761011-21761033 CTATAAGAAAGGCTAGGGTTTGG + Intergenic
1123622621 15:22203601-22203623 CTATAAGAAAGGCTAGGGTTTGG + Intergenic
1124213398 15:27783308-27783330 CTAAATCAAAGTGTAAGGTGTGG - Intronic
1126634008 15:50764802-50764824 CTAATTTAAAGGGATGGGTGGGG - Intronic
1128357514 15:66938396-66938418 GAAAAATAAAGGGGAGGGGGTGG + Intergenic
1129072529 15:72963105-72963127 CTGAAATAAAGGGATGGGTTTGG + Intergenic
1130567331 15:85007942-85007964 CAGAATTAAAGGGAAGGGTGAGG + Intronic
1130710323 15:86274346-86274368 CTAATATTAAGGGTAGGGGTAGG + Intronic
1130983250 15:88827327-88827349 CTAAAATAGTTGGTGGGGTGGGG + Intronic
1131337479 15:91563062-91563084 CTAATATAATTGGTAGTGTGAGG + Intergenic
1131350602 15:91696381-91696403 TTAACATAAGGGGTAGGGCGGGG - Intergenic
1131855181 15:96585881-96585903 ATAAAATAAAGGGGGGGGGGCGG + Intergenic
1131992716 15:98106222-98106244 ATAAAATAAATTGTGGGGTGTGG - Intergenic
1132219206 15:100092729-100092751 TTAAAAGAAAGGGTGGGGTGAGG - Intronic
1132876642 16:2142557-2142579 AAAAAAAAAAGGGCAGGGTGCGG + Intronic
1133669152 16:8000515-8000537 CTAAAATAAAGACTAAGATGAGG + Intergenic
1135266810 16:21033800-21033822 AGAAAATAAAGGGTTGGGGGCGG - Intronic
1135279213 16:21139475-21139497 CTCAAAAAAAGGGTAGGGGGAGG - Intronic
1137341972 16:47616886-47616908 CTGAAATAAAGGGATGGGTCTGG + Intronic
1138290581 16:55843111-55843133 TTAAAAAAAAGGGGAGAGTGGGG + Intergenic
1139731701 16:68951318-68951340 CAAAAAAAAAAGGCAGGGTGGGG + Intronic
1141358501 16:83372461-83372483 CTTAGAGAAAGGGTCGGGTGCGG + Intronic
1142416218 16:89944344-89944366 CAAAAATAAGGGGTTGGGTGCGG + Intergenic
1142640638 17:1283821-1283843 ATAAAATAAAGGGCCGGGAGTGG + Intronic
1145108193 17:20137953-20137975 ATAAAATAAAGGGCTGGGTACGG - Intronic
1145201940 17:20953450-20953472 CTAAAATAAAGGCTAATATGTGG + Intergenic
1146150303 17:30462887-30462909 CCAAAATAAAGGGATGGGTTGGG + Intronic
1146767953 17:35540891-35540913 ATAAAATATGGGGTAGGGTGGGG - Intergenic
1147803345 17:43110808-43110830 CTAAAATAAAAGGCTGGGCGTGG + Intronic
1148048374 17:44757808-44757830 CTAAAATAGAGCGGGGGGTGGGG + Intergenic
1148996343 17:51713587-51713609 CTAGAGCAAAGGGTAGAGTGTGG + Intronic
1149203709 17:54218201-54218223 TAAAAATACAGGGGAGGGTGGGG + Intergenic
1149603131 17:57905840-57905862 CTAAAAGGAAGGGTTGTGTGGGG + Intronic
1149775327 17:59352692-59352714 CTAAAGCAAAGGCTGGGGTGTGG + Intronic
1151507275 17:74537941-74537963 ATAAAATAAAATGTAGGATGTGG + Intergenic
1153097750 18:1427607-1427629 CTGAAATGAAGGAAAGGGTGAGG - Intergenic
1153334678 18:3910762-3910784 CAAAAATAAAGGGTTGGGAAGGG + Intronic
1153351650 18:4087463-4087485 CTGAAATAAAGGGATGGGTCTGG - Intronic
1154327670 18:13403797-13403819 CTAAAAGAAAGGGCATGGGGAGG + Intronic
1155447752 18:25929705-25929727 GTGAAATAAAGGCTAGGCTGGGG + Intergenic
1155571256 18:27196641-27196663 CTCCAACAAAGGGCAGGGTGGGG - Intergenic
1155826242 18:30446836-30446858 TTAAAATACGGGGTAGGGGGCGG - Intergenic
1156509115 18:37620769-37620791 CTAAATTGGAGGGTAGGGGGAGG - Intergenic
1156890642 18:42186260-42186282 ATAAAGAAAAGGGGAGGGTGTGG + Intergenic
1157348333 18:46860987-46861009 ATAAAATAAAAGGCCGGGTGTGG + Intronic
1157421112 18:47548300-47548322 CTAACACAAAAAGTAGGGTGGGG - Intergenic
1157852169 18:51065319-51065341 CTAAAAGAAAGGGTAAAGGGAGG - Intronic
1158252946 18:55509793-55509815 CAAAAATAAAGGGAAAGGGGCGG + Intronic
1158968726 18:62646128-62646150 CTACAATAAAGAGTAGAGAGGGG - Intergenic
1161631028 19:5355548-5355570 CTCAAATCAAGGGAAAGGTGAGG + Intergenic
1162037943 19:7952611-7952633 ATAAAATAAATAGCAGGGTGTGG + Intergenic
1162355083 19:10178264-10178286 ATAAAATAAAGGGCCAGGTGAGG + Intronic
1162890476 19:13729173-13729195 ATAAAATTAAGGGCAGGGAGTGG + Intergenic
1163043078 19:14617083-14617105 CTAGAAAAAAAGGTGGGGTGTGG - Intergenic
1163734897 19:18973780-18973802 ATAAAATAAATGGCCGGGTGTGG - Intergenic
1164031635 19:21412251-21412273 CCAAAATAAAGGGATGGGTTGGG + Intronic
1164032329 19:21418767-21418789 CCAAAATAAAGGGATGGGTTGGG + Intronic
1164228788 19:23269765-23269787 CTAATTTAATGGGCAGGGTGGGG - Intergenic
1164262127 19:23577043-23577065 CCAAAATAAAGGGATGGGTTTGG + Intronic
1164825647 19:31283035-31283057 TTAAAATAAAGGGAAGGGCTGGG + Intronic
1165463862 19:35960438-35960460 CAAAAATTGAGGGTCGGGTGGGG - Intergenic
1165866305 19:38941563-38941585 CTGAAATAAAGGGATGGGTCTGG + Exonic
1166823218 19:45593208-45593230 AAAAAAAAAAAGGTAGGGTGTGG + Intronic
1167965940 19:53146629-53146651 CTGAAATAAAAGGTGGGGGGAGG + Intronic
1168093106 19:54098693-54098715 ATAAAAATAAGGGTCGGGTGAGG + Intronic
925310917 2:2881013-2881035 GGAAAATAAAGAGTATGGTGTGG - Intergenic
926779140 2:16451485-16451507 TAAAAATAAAGGGCCGGGTGTGG + Intergenic
927117861 2:19923000-19923022 CTGAAATAAAGGGATGGGTCTGG - Intronic
927118476 2:19928252-19928274 CTGAAATAAAGGGATGGGTCTGG - Intronic
927302201 2:21527731-21527753 CTAAAATAAATGGGAAGTTGAGG - Intergenic
927420635 2:22926865-22926887 CTAAAATCAAGGTCAGGGTAGGG + Intergenic
927695028 2:25233999-25234021 CGAAAAAAAAGGGAAGGGGGAGG + Exonic
927867821 2:26603049-26603071 CTAAAAAACGGGGTGGGGTGGGG + Intronic
927994928 2:27477965-27477987 CCAAAATTGAGGGTAGGGTGGGG - Intronic
928130378 2:28644802-28644824 GAAAAAAAAAGGGTGGGGTGGGG - Intergenic
928671753 2:33610110-33610132 CCAAAATAAAGGGATGGGTTTGG - Intergenic
930716906 2:54601875-54601897 CCAAAATCCAGGGTGGGGTGAGG - Intronic
930954130 2:57183538-57183560 CTACAATAAAAGACAGGGTGGGG + Intergenic
932093741 2:68828862-68828884 CTAACATAAAGGTGAGGGTGTGG - Intergenic
932133410 2:69207727-69207749 CTATAACACAGGGTGGGGTGTGG - Intronic
932306591 2:70707964-70707986 CCAGAATCAAGGGTAGGCTGGGG - Intronic
932437153 2:71708907-71708929 GTTAAATGAAGGGCAGGGTGGGG - Intergenic
933057868 2:77696181-77696203 CTCAAAACTAGGGTAGGGTGAGG - Intergenic
933161185 2:79026666-79026688 GTAAAATGAAGAGTAGGGGGTGG - Intronic
933578913 2:84103063-84103085 CTAACATAGATGGTGGGGTGAGG + Intergenic
933737463 2:85506591-85506613 TAAAAATAAAGAGTAGTGTGAGG + Intergenic
935008928 2:99112854-99112876 CACAAACAAAGGGTGGGGTGGGG - Intronic
935037284 2:99390820-99390842 CTAAAATAAAAGGGAGAGCGAGG - Intronic
935214471 2:100965334-100965356 ATAAATTAAAGGGTGGGGAGGGG - Intronic
935520240 2:104095620-104095642 CTGAAATAAAGGGATGGGTTGGG + Intergenic
935856892 2:107284391-107284413 CTGATATAAAAGGTAGGATGTGG - Intergenic
936799588 2:116251606-116251628 CCAAAATAAAGGGGTGGGTCTGG - Intergenic
936800070 2:116255880-116255902 CCAAAATAAAGGGGTGGGTCTGG - Intergenic
938813455 2:134875154-134875176 ATAAAAAAAAGAGTTGGGTGTGG - Intronic
939174141 2:138730181-138730203 AAAAAAAAAAGGGTGGGGTGGGG - Intronic
939620639 2:144414556-144414578 TTAGAAGAAAGGGCAGGGTGGGG + Intronic
939701829 2:145401724-145401746 CTAGAATAATTGGCAGGGTGTGG - Intergenic
940322909 2:152396132-152396154 CTAAAATAAAGGAGAGGGGGAGG - Intronic
940772362 2:157852941-157852963 CTTTAATAAAAGGTAGGATGTGG + Intronic
941258090 2:163259059-163259081 CCAAAATAAAGGGATGGGTTGGG + Intergenic
941791647 2:169558739-169558761 CAAAAAAAAAGGGCCGGGTGTGG - Intronic
941950333 2:171149204-171149226 CTAAAAAAAAGGGTAGGGGCGGG + Intronic
942441125 2:176038126-176038148 CTAAAAAAATGGGCTGGGTGCGG - Intergenic
943187640 2:184633045-184633067 AAAAAAGAAAGGGTGGGGTGGGG - Intronic
943901756 2:193447682-193447704 CTGAAATAAAGGGATGGGTTTGG + Intergenic
944244535 2:197517847-197517869 CTATAATAGAGGGCTGGGTGCGG + Intronic
945052928 2:205842650-205842672 CTAAATTAAAGGGCTGGGTGTGG - Intergenic
946206476 2:218112509-218112531 CCAAAATAAAGGGATGGGTTTGG - Intergenic
946210687 2:218144818-218144840 CTGAAATAAAGGGGTGGGTCTGG - Intergenic
946533374 2:220599039-220599061 ATAAAATAAACGCTAGGTTGAGG + Intergenic
947312646 2:228821119-228821141 CACAAATCAAGGGTAGGGTCAGG - Intergenic
948586470 2:239023178-239023200 TTAAAATAAAGGACAGGGAGGGG - Intergenic
1168901006 20:1364966-1364988 TTCAAACAGAGGGTAGGGTGGGG + Intronic
1168901298 20:1367389-1367411 CTAAAATTAAGGTATGGGTGGGG + Intronic
1172591181 20:36119300-36119322 CCAAAAGAAAGGGCAAGGTGTGG + Intronic
1174276039 20:49404952-49404974 CTAATGCAGAGGGTAGGGTGGGG + Intronic
1175162803 20:57021468-57021490 CTAAAATACAGAGTAGGGTCGGG + Intergenic
1175551790 20:59822281-59822303 CTAAAATATTGGGGAGGGGGTGG - Intronic
1177278104 21:18942193-18942215 CTAAAATAAAGGTGACAGTGAGG + Intergenic
1177861556 21:26460359-26460381 CAGAAATAGAGGGGAGGGTGTGG + Intergenic
1178291945 21:31376125-31376147 AAAAAACAAAGGGTAGGATGTGG - Intronic
1178684396 21:34699975-34699997 CTTAAAAAAAGATTAGGGTGGGG - Intronic
1179672360 21:42958608-42958630 CAAAAAAAAAGGGGGGGGTGGGG + Intergenic
1181593758 22:23900461-23900483 CTAAAATAAAGGGATGGGTTGGG - Intergenic
1181784286 22:25215345-25215367 CTGAAATAAAGGGATGGGTCTGG - Intergenic
1182779952 22:32859556-32859578 CAAAAAGAAGGGGCAGGGTGGGG - Exonic
1184228746 22:43146280-43146302 ATAAAAAAAAGGGCTGGGTGCGG + Intergenic
951726145 3:25762660-25762682 CTTAAAAAAAGGGCTGGGTGTGG + Intronic
951821903 3:26823258-26823280 CCAAAATAAAGGGATGGGTTGGG + Intergenic
953348108 3:42192949-42192971 CTAAAAGACAGGGTAGAGTGGGG - Intronic
953420952 3:42752718-42752740 CTAAAATGAAAGGAATGGTGAGG + Intronic
953836202 3:46347347-46347369 CTGAAATAAAGGGATGGGTTGGG + Intergenic
954291215 3:49650991-49651013 CTAAAGTAAAGAGTGGGGTGAGG + Exonic
954507027 3:51086179-51086201 CCAAAATAAAGGGATGGGTTTGG + Intronic
954570941 3:51640396-51640418 CTAAAATAAAAGGTTGGGGCGGG - Intronic
956533583 3:70250049-70250071 TTAAAATAAAGGGTGTGGTCAGG + Intergenic
957491159 3:80929114-80929136 CCAAAATAAAGGGGAGGGTCTGG - Intergenic
958130147 3:89408342-89408364 CTAAAATAAAGGGTAATCTGTGG + Intronic
958674970 3:97257316-97257338 TGAAAATAAAGGGTAAGCTGGGG + Intronic
960132649 3:114073714-114073736 CAATAATAAAGGGTATGGAGAGG - Intronic
962089350 3:132227009-132227031 ATAAAATTAAGGGCTGGGTGCGG - Intronic
964775532 3:160272400-160272422 TTAAAATAAATGGTAGGGTAAGG + Intronic
966350298 3:179026810-179026832 CTGAAGTAGAGGGGAGGGTGAGG + Intronic
966967781 3:185013016-185013038 CTGAAATAAAGGGATGGGTCTGG + Intronic
967100113 3:186209501-186209523 TTGAAATAAAGGCTATGGTGGGG + Intronic
967347857 3:188478636-188478658 CTGAAATAAAGGGTAGAGCTGGG + Intronic
968089909 3:195893309-195893331 CCAAGAGCAAGGGTAGGGTGGGG + Intronic
968328593 3:197843990-197844012 ATAAAAGAGATGGTAGGGTGAGG + Intronic
969483013 4:7456858-7456880 CTAAATGCCAGGGTAGGGTGGGG - Intronic
970293287 4:14600603-14600625 TTAAAACACAGGGTAGGTTGGGG - Intergenic
970610060 4:17716795-17716817 ATAAAATAAAGGGTAAGCTCTGG - Intronic
970615927 4:17768276-17768298 CTCAAATAAAAGGGGGGGTGGGG - Intronic
970651254 4:18180583-18180605 CTAAAGAAAATAGTAGGGTGTGG + Intergenic
972080137 4:35139991-35140013 CTGAAATAAAGGGATGGGTTGGG - Intergenic
973008358 4:45042301-45042323 CTGAAATAAAGGGATGGGTTGGG - Intergenic
974095609 4:57360591-57360613 CTGAAATAAAGGGATGGGTTTGG - Intergenic
974417420 4:61627715-61627737 ATAGAATAAATGGTAGGGTTTGG + Intronic
974715379 4:65662810-65662832 CTGGAAGAAAGGGTAGGGAGAGG - Intronic
974807110 4:66894664-66894686 CAAAAAGAAAGGGCGGGGTGGGG + Intergenic
975523337 4:75323608-75323630 CAAAGATAAAGGGTAGGTTTTGG - Intergenic
976245487 4:83002366-83002388 CTAAAAAAAAAGCAAGGGTGAGG + Intronic
978331705 4:107620531-107620553 TTTAAATAAAGGCTAGAGTGTGG + Intronic
979893513 4:126130989-126131011 CTGAAATAAAGGGATGGGTTTGG - Intergenic
979893984 4:126134874-126134896 CTGAAATAAAGGGATGGGTTTGG - Intergenic
981027312 4:140089911-140089933 CTACCACATAGGGTAGGGTGCGG - Intronic
982702666 4:158673011-158673033 CTAAAATTAAGGGCTGGGCGTGG + Intronic
982793640 4:159620780-159620802 GTATAATAAAAGGTTGGGTGGGG - Intergenic
982803359 4:159732149-159732171 CTTACAAAAGGGGTAGGGTGAGG - Intergenic
983972582 4:173893002-173893024 CTGAAATAAAGGGATGGGTTTGG + Intergenic
984059179 4:174971004-174971026 ATAAAATAAAGTGTGGGGTAGGG - Intronic
984170260 4:176350509-176350531 CTGAAATAAAGGGATGGGTCTGG - Intergenic
984196819 4:176667020-176667042 CAAAAATAAAGAGCAGGGCGTGG + Intergenic
984280320 4:177662811-177662833 CCGAAATAAAGGGTTGGGTCTGG + Intergenic
987459272 5:18188052-18188074 CTAAAATAAACGCCAAGGTGAGG - Intergenic
987482843 5:18480351-18480373 CTGAAATAAAGGGGTGGGTCTGG + Intergenic
988387961 5:30591093-30591115 CTACAATAAAGGGTGGGGGGAGG + Intergenic
989065198 5:37453400-37453422 CTGAAATAAAGGGATGGGTTGGG + Intronic
989154654 5:38332700-38332722 CCAAAATAAAGGGATGGGTTGGG + Intronic
989301974 5:39905204-39905226 CTAAAATATAGAGCAGAGTGTGG + Intergenic
989485981 5:41992360-41992382 CTAAAATCAAGGGTCTGGTGTGG + Intergenic
989514273 5:42323478-42323500 CTAAAATAAAGGTTTTGGTAGGG - Intergenic
989758587 5:44986173-44986195 CCAAAATAAAGGGATGGGTTGGG - Intergenic
992447272 5:76845421-76845443 CTGAAATAAAGGGGTGGGTCTGG - Intergenic
993136863 5:83979769-83979791 CTGGAATGAAGGCTAGGGTGAGG + Intronic
995063125 5:107832716-107832738 ATTAAAAAAAGGGAAGGGTGAGG + Intergenic
997242272 5:132316058-132316080 CTAAAATAAACCAAAGGGTGTGG + Intronic
998191835 5:140031880-140031902 CTGAAGTATTGGGTAGGGTGTGG - Intronic
998245838 5:140504051-140504073 CTAAAAAAAAGGGTGGGGGAGGG - Intronic
1001651840 5:173321219-173321241 CTTAAATTAAGGGGAGGGGGTGG + Intronic
1002509779 5:179706850-179706872 ACAAAATATAGGGTAGAGTGGGG - Intronic
1003028509 6:2579833-2579855 AAAAAAAAAAAGGTAGGGTGTGG + Intergenic
1003932871 6:10943456-10943478 ATAAAATTAAGGGGAGGGGGTGG - Intronic
1004002827 6:11611157-11611179 GTAAAATAAAAGGCTGGGTGTGG + Intergenic
1004602054 6:17159743-17159765 CTAAAACACTGGGTAGGCTGGGG - Intergenic
1005185519 6:23159813-23159835 CTGAAATAAAGGGATGGGTTGGG - Intergenic
1006050475 6:31338992-31339014 CCAAAATAAAGGGATGGGTTTGG + Intronic
1008587664 6:52963878-52963900 CCAAAATAAAGGGATGGGTTGGG - Intergenic
1009275857 6:61678502-61678524 CTAAAATAAAGGGAAGGGACAGG - Intergenic
1009368327 6:62873239-62873261 CTAATATAAAGAGTGGGGAGAGG + Intergenic
1009889938 6:69668454-69668476 CAAAAAAAAAGGGTGGGGGGTGG + Intergenic
1010969883 6:82252085-82252107 CCAAATTAAAGGGTGGGATGGGG + Intergenic
1011092112 6:83615247-83615269 CAAAAAACAAGGGAAGGGTGTGG + Intronic
1011572552 6:88754814-88754836 CCAAAATAAAGGGATGGGTCTGG - Intronic
1011972292 6:93241625-93241647 CAAAAAAAAAGGGTGGGGAGGGG + Exonic
1012038545 6:94174266-94174288 CTAAAATCCAGGGTTGGGCGTGG + Intergenic
1012592231 6:100996345-100996367 GTTAAAGAAAGGGTAGGATGGGG - Intergenic
1013597770 6:111675435-111675457 CTAAACCAAAAGGAAGGGTGTGG + Intronic
1014467688 6:121776640-121776662 CTGAAAGAAAGGGTAGAGTTTGG - Intergenic
1015557126 6:134474680-134474702 CTAAAACAATGGGTAATGTGGGG - Intergenic
1015560051 6:134504458-134504480 CTAAAGAAAAGGGCTGGGTGCGG + Intergenic
1015825363 6:137305347-137305369 CCAAAATAAAGGGTTGGGTTTGG + Intergenic
1016060322 6:139623120-139623142 CAAAAATAAAGGGCCGGGGGCGG - Intergenic
1016476881 6:144437242-144437264 ATAAAATAAAAGGCTGGGTGTGG - Intronic
1016849444 6:148601938-148601960 CTGAAATAAAGGGATGGGTTGGG - Intergenic
1017168778 6:151435812-151435834 CTAAAATAACGGGCTGGGTGTGG + Intronic
1017659826 6:156663154-156663176 CATAAATAAAGGGCTGGGTGTGG + Intergenic
1017835809 6:158176859-158176881 CCAAAATAAAGGGATGGGTTGGG + Intronic
1020337124 7:7070755-7070777 CTGAAATAAAGGGATGGGTTTGG + Intergenic
1021508805 7:21413314-21413336 AGAAAATAAATGGTAGGGAGTGG - Intergenic
1024065154 7:45726496-45726518 CTGAAATAAAGGGGTGGGTCTGG + Intergenic
1026835039 7:73633069-73633091 AAAAAAAAAAAGGTAGGGTGGGG - Intergenic
1027147066 7:75703057-75703079 TTAACATAAAGGGCCGGGTGAGG + Intronic
1030074046 7:105721340-105721362 AAAAAATAAAGGGTTGGGTGGGG + Intronic
1030277568 7:107736898-107736920 CCAAAATAAAGGGGTGGGTTTGG + Intergenic
1030783284 7:113627731-113627753 CCAAAATAAAGGGATGGGTTTGG + Intergenic
1030940101 7:115635940-115635962 CAAAAAGAAAGGGTCGGGGGGGG + Intergenic
1032269650 7:130392841-130392863 CTACAACAAGGGGTAGGATGGGG - Intergenic
1032579844 7:133094078-133094100 AAAAAAAAAAGGGTTGGGTGTGG - Intergenic
1033123027 7:138683201-138683223 TTAAAATAAATAATAGGGTGAGG + Intronic
1034651507 7:152694525-152694547 CAAAAATGAAGGGTACAGTGTGG + Intergenic
1034851664 7:154499589-154499611 CTAAAATAAATGAAAAGGTGTGG - Intronic
1034918354 7:155059331-155059353 CTGAAAGAAAAGGTAGGCTGAGG + Intergenic
1035349882 7:158238350-158238372 ATAAAATAAAGCGGGGGGTGTGG + Intronic
1038185102 8:25266095-25266117 TTAAAATAAAGGGAATCGTGAGG - Intronic
1038891654 8:31732411-31732433 CAAAAATAGATGGTGGGGTGTGG - Intronic
1039395495 8:37222166-37222188 CCTAACTAAAGGGTAGGCTGAGG - Intergenic
1040525498 8:48220107-48220129 CTAAAATAAAGAATAAGGTAAGG + Intergenic
1040782430 8:51125683-51125705 CCAAAATAAAGGGATGGGTTGGG + Intergenic
1041493491 8:58460961-58460983 CTGAAATAAAGGGATGGGTCTGG - Intergenic
1042276401 8:67009275-67009297 ATAAAATAAAGGGCCGGGTCCGG + Intronic
1042435235 8:68756487-68756509 CTGAAGTAACGGGTAGGGGGTGG + Intronic
1044693110 8:94897428-94897450 AGAAAATAAAGGGTAGGGGGCGG + Intronic
1046446714 8:114330232-114330254 GTAAAATAAAAGGTAGTGGGTGG - Intergenic
1047523142 8:125611044-125611066 CTGGAATAAAGGGGCGGGTGAGG + Intergenic
1047615549 8:126559372-126559394 TTAAAATAATGGGTCCGGTGAGG + Intergenic
1048101542 8:131357696-131357718 CCAAAATAAAGGGATGGGTTCGG - Intergenic
1049460590 8:142725956-142725978 CCAAAATAAAGGGGTGGGTTTGG - Intergenic
1049947823 9:614951-614973 CTCAAAAAAAGGGCAGGGGGGGG - Intronic
1049975731 9:860004-860026 CTAAAATATGGGGTAGGGCACGG + Intronic
1050957465 9:11682819-11682841 CTAAAAAAAAGGTTAGAGTGAGG - Intergenic
1050970423 9:11864412-11864434 CTAAAACAAAGAGAAGGTTGGGG - Intergenic
1052232548 9:26171832-26171854 AAAAAACAAAGGGTAGGGAGGGG - Intergenic
1053661754 9:40288647-40288669 CTAGAGCAAAGGGTAGAGTGCGG - Intronic
1053912127 9:42917991-42918013 CTAGAGCAAAGGGTAGAGTGCGG - Intergenic
1054373879 9:64434883-64434905 CTAGAGCAAAGGGTAGAGTGCGG - Intergenic
1054479828 9:65651399-65651421 GTAAAACAAAGAGTAGGGTTAGG + Intergenic
1054522855 9:66087637-66087659 CTAGAGCAAAGGGTAGAGTGCGG + Intergenic
1055048024 9:71950816-71950838 ATAAAATACAGGGCATGGTGGGG + Intronic
1055076184 9:72217646-72217668 CTATAATAAAGGGTAGGGAGAGG - Intronic
1055226144 9:73998918-73998940 ATAAAATAAAGCTTAGGGTAGGG + Intergenic
1055542044 9:77319899-77319921 TTAAAATAAAGTGTCGAGTGTGG - Intronic
1056915182 9:90739980-90740002 CCAAAATAAAGGGATGGGTCTGG + Intergenic
1057506342 9:95636424-95636446 CTCAAATGAAAGGAAGGGTGGGG - Intergenic
1058057632 9:100465036-100465058 CTAGAATAAAGGGTAGGGTGCGG - Intronic
1058309180 9:103480327-103480349 ATAATATAAAGGGTAGAGTAAGG + Intergenic
1059511282 9:114850447-114850469 AAAAAAAAAAGGGTTGGGTGGGG + Intergenic
1059696079 9:116731718-116731740 CTAAAATATAGGGTATGGGCCGG - Intronic
1059859494 9:118443060-118443082 CTAAAATAAAGGGTAAGTGAGGG - Intergenic
1059875878 9:118634179-118634201 CTGAAATAAAGGGGTGGGTCTGG + Intergenic
1060327754 9:122633926-122633948 CTCAAAAAAAGGGTGGGGTGGGG + Intergenic
1060479037 9:124007242-124007264 CTCCAAGAAAGGGTGGGGTGAGG - Intronic
1060525507 9:124318643-124318665 ATAAAATAAAGAGTAGGAAGAGG - Intronic
1060606140 9:124915811-124915833 ATAAAATAAATGGCAGGGCGTGG + Intronic
1061516726 9:131094420-131094442 GTAAAATCAAGGCTACGGTGGGG + Intronic
1202783590 9_KI270718v1_random:24740-24762 GTAAAACAAAGAGTAGGGTTAGG - Intergenic
1203654907 Un_KI270752v1:14319-14341 TCAAAATAAAAGGTAGGGTTGGG + Intergenic
1187378754 X:18781061-18781083 CAAAAAAAAAGGGTGGGGGGAGG + Intronic
1188116028 X:26243824-26243846 CCAAAATAAAGGGATGGGTTTGG + Intergenic
1188201208 X:27294293-27294315 CTGAAATTAAGGGAAGGGAGAGG + Intergenic
1188230391 X:27655956-27655978 CTGTAACAAAGGGTAGGGTCAGG - Intronic
1188250351 X:27885858-27885880 CAAACTTAAAGGGTAGGGTAAGG - Intergenic
1189735016 X:44061151-44061173 CTAAAAAAAATGTGAGGGTGAGG - Intergenic
1190216050 X:48480144-48480166 CAAAAAAAAAAGGTGGGGTGGGG + Intronic
1190343449 X:49315841-49315863 GTAAAATAAAAGGGAGGATGAGG - Intronic
1191907697 X:66111422-66111444 CTATAATAAAGTGTGGAGTGGGG + Intergenic
1191919421 X:66238888-66238910 CCAAAATAAAGGGATGGGTTGGG + Intronic
1191949109 X:66569371-66569393 CGGAAATAAAGGGTTGGGTTTGG + Intergenic
1192767622 X:74158551-74158573 CCAAAATAAAGGGATGGGTCTGG + Intergenic
1194913242 X:99673271-99673293 CTGAAATAAAGGGATGGGTTGGG + Intergenic
1195034670 X:100961561-100961583 CTAAAGTAAAGGGTGGGGCCGGG + Intergenic
1195353724 X:104018696-104018718 CTGAAATAAAGTTTAGTGTGTGG + Intergenic
1195758160 X:108219743-108219765 CTAAAAAAAGGAGTAGGGAGAGG + Intronic
1196390924 X:115206543-115206565 CTGAAATAAAGGGGTGGGTCTGG - Intronic
1198087852 X:133297233-133297255 TTAAAAGAAAGGTGAGGGTGGGG + Intergenic
1198377352 X:136052976-136052998 CTAAAATCAAGGGGACGGTGGGG - Intergenic
1199897126 X:152136573-152136595 CTGACAGAAGGGGTAGGGTGGGG + Intronic
1200354492 X:155534181-155534203 CTCAAAAAAAGGGAAGAGTGAGG + Intronic
1200394801 X:155977912-155977934 CAAAAAAAAAAGGTTGGGTGTGG - Intergenic
1202164184 Y:21969231-21969253 CCAAAATAAAGGGATGGGTTTGG + Intergenic
1202227172 Y:22617141-22617163 CCAAAATAAAGGGATGGGTTTGG - Intergenic
1202315950 Y:23578513-23578535 CCAAAATAAAGGGATGGGTTTGG + Intergenic
1202554815 Y:26091554-26091576 CCAAAATAAAGGGATGGGTTTGG - Intergenic