ID: 1100867958

View in Genome Browser
Species Human (GRCh38)
Location 12:98877518-98877540
Sequence TGCCATGTATACATCCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100867958 Original CRISPR TGCCATGTATACATCCTTGA AGG (reversed) Intronic
908974230 1:69878963-69878985 TGACATGTATCCATCATGGATGG - Intronic
909549787 1:76884955-76884977 TGCGATGTATAACTCCTTGGAGG - Intronic
911346560 1:96703512-96703534 TTCCTCTTATACATCCTTGAGGG - Intergenic
911924266 1:103808358-103808380 TGTCATCTGTACATCCTTTATGG - Intergenic
912707466 1:111925620-111925642 TTCCATCTTTACCTCCTTGAAGG - Intronic
913339109 1:117739634-117739656 AGCCATGTATAAATCTTTGAAGG - Intergenic
916043873 1:160983393-160983415 TGCATTGTATACATCCTTCCAGG + Intergenic
918983871 1:191597476-191597498 AGCCATTTTTGCATCCTTGAAGG + Intergenic
920328142 1:205183182-205183204 TGTCAGATATACATGCTTGAAGG + Intronic
921380263 1:214517356-214517378 TGCCAAGGAGACATACTTGAAGG - Intronic
921456300 1:215376152-215376174 TGACATTTATCCATTCTTGAGGG + Intergenic
922181401 1:223236139-223236161 TGCCATCTGTATATCTTTGATGG + Intronic
922962581 1:229661482-229661504 TGCCAGGTAGTCAGCCTTGAAGG + Intergenic
1063086215 10:2820350-2820372 TGCCATTTATACCTCATTTAAGG + Intergenic
1071362029 10:84857713-84857735 TGTCATGATTTCATCCTTGAAGG + Intergenic
1072052444 10:91719098-91719120 TGCAATGGATAAATGCTTGAGGG + Intergenic
1074901665 10:117821720-117821742 TCCAATGTATAAAACCTTGATGG - Intergenic
1078963298 11:16305270-16305292 TGCCATATATGTATCCTTGTAGG - Intronic
1079562182 11:21835303-21835325 TGGCATTAATACATTCTTGAGGG - Intergenic
1080938598 11:36888219-36888241 TGTCATGTATCCATCATTAAAGG - Intergenic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1089666556 11:120024143-120024165 TGTCATGTGTCCATCCTTGAAGG + Intergenic
1090234526 11:125137651-125137673 TGCCACAGATACATCATTGAAGG + Intergenic
1090943102 11:131405896-131405918 TGCCATGTCTTCTTCCTGGAAGG + Intronic
1095201413 12:39388483-39388505 TGCCATGTGTACAGCCTAGCAGG - Intronic
1098701201 12:73629397-73629419 GGCCATGCAGACCTCCTTGATGG - Intergenic
1100867958 12:98877518-98877540 TGCCATGTATACATCCTTGAAGG - Intronic
1104377850 12:128280742-128280764 TTCCAAGTTTACATGCTTGAGGG + Intronic
1105716631 13:23072107-23072129 TGGTATGTATACATCATGGATGG - Intergenic
1109077366 13:57853380-57853402 TGCCTTTTAGACATCCTTAAAGG - Intergenic
1109714446 13:66203263-66203285 TGCCATGTATAATGGCTTGAAGG - Intergenic
1110232896 13:73185087-73185109 TTCCATTTATATATCCTTCATGG - Intergenic
1111385964 13:87527868-87527890 TGGCATTTATTCATTCTTGACGG + Intergenic
1114176125 14:20321917-20321939 TGCTGTGTTTACATCCATGATGG - Intronic
1114719322 14:24863259-24863281 AGGCATGTATAAATCCATGAGGG + Intronic
1115393791 14:32883448-32883470 TGCCATTTCTACATCTTTGGGGG + Intergenic
1118497052 14:66317038-66317060 TTCCAGGTATAGATGCTTGATGG - Intergenic
1122375607 14:101255051-101255073 TGCCCTTAATACATCCTTAAGGG + Intergenic
1123391501 15:19878621-19878643 TGCCAGCTTGACATCCTTGATGG + Intergenic
1128050869 15:64663349-64663371 TGGCATGTGTACATCCTTCTAGG - Intronic
1132857099 16:2050947-2050969 TGCCCCGAATACAACCTTGAGGG + Intronic
1134389828 16:13809017-13809039 TTCCCTGTATGCATCCTTGAGGG - Intergenic
1137223720 16:46481910-46481932 TGCTATGTGTACACCCTTGAGGG - Intergenic
1138221246 16:55252509-55252531 TGCCATTTTTACTTTCTTGATGG - Intergenic
1145302710 17:21652431-21652453 TGCTATGGAAACATCCCTGATGG - Intergenic
1145347592 17:22050757-22050779 TGCTATGGAAACATCCCTGATGG + Intergenic
1148434253 17:47669781-47669803 AGCCAAGTAGACATCATTGATGG - Exonic
1153870692 18:9316811-9316833 TGCCATGTATACATCTTTTTAGG - Intergenic
1154503169 18:15006421-15006443 TGCTATGGAAACATCCCTGATGG - Intergenic
1154937489 18:21076145-21076167 TGCCATTTAAACATCACTGATGG + Intronic
1155311766 18:24531275-24531297 GGCCTTGGATACATCCTTCATGG - Intergenic
1155387895 18:25300848-25300870 TAATATGTATACATCTTTGAGGG - Intronic
1156844637 18:41650457-41650479 TGCCATCTATTCTTCCTTTAGGG - Intergenic
1165180825 19:33966549-33966571 TACAATGTTGACATCCTTGAGGG + Intergenic
925524769 2:4787629-4787651 AGCCATGAAGACATCCTGGAAGG - Intergenic
927133819 2:20082250-20082272 TGGCATTAATCCATCCTTGAGGG - Intergenic
928768735 2:34679489-34679511 TTCAATGGATACATGCTTGAGGG - Intergenic
929332369 2:40698353-40698375 TGCCTTGAATAAACCCTTGATGG + Intergenic
934149864 2:89135910-89135932 ATCCATGTATACAACTTTGAAGG - Intergenic
934217433 2:90046121-90046143 ATCCATGTATACAACTTTGAAGG + Intergenic
935311075 2:101784073-101784095 TGCCATCCAGGCATCCTTGAAGG + Intronic
935816924 2:106854601-106854623 TGCCATGTGTATAAACTTGATGG + Intronic
938184824 2:129221366-129221388 AGCCATGTGTACATCTTTGTTGG - Intergenic
938502347 2:131836591-131836613 TGCTATGGAAACATCCCTGATGG - Intergenic
941459712 2:165754646-165754668 TGACATGTATACATAATTAATGG + Exonic
941728484 2:168890006-168890028 TGACTTGTATACATCCTCGACGG - Intronic
942724285 2:178989705-178989727 TGCCATTTATATATCTTTGTTGG - Intronic
944418848 2:199506926-199506948 TGACCTGTATAAATCCTTGCTGG - Intergenic
945464133 2:210147138-210147160 TGGCATGTGGACATCTTTGAGGG - Intronic
945974553 2:216259994-216260016 TGCCATGGATACATAATAGAGGG - Intronic
946443204 2:219714317-219714339 TGCCATGTACTCATCCTCTAGGG - Intergenic
946962771 2:225002092-225002114 TGTCATTTATTCATCCTTCACGG - Intronic
947447745 2:230177490-230177512 TGACAGGTTTAAATCCTTGAAGG - Intronic
1169207803 20:3749828-3749850 TGCCTTGTAGAGCTCCTTGAGGG - Exonic
1169955285 20:11096191-11096213 TTCAATGTTTACATCCTAGAGGG + Intergenic
1170431404 20:16280015-16280037 TTCCATTTAGACATTCTTGAAGG + Intronic
1171557623 20:26092529-26092551 TGCTATGGAAACATCCCTGATGG + Intergenic
1173120369 20:40283676-40283698 TGGCATATAAACATCCTTGGAGG - Intergenic
1176653445 21:9570243-9570265 TGCTATGGAAACATCCCTGATGG - Intergenic
1180515383 22:16136796-16136818 TGCCAGCTTGACATCCTTGATGG + Intergenic
1182075056 22:27489965-27489987 TCCCATCTATACAACCTTGGGGG - Intergenic
949316553 3:2762721-2762743 TTCCATCTTTACATCTTTGAGGG + Intronic
949370681 3:3331676-3331698 TGCTATGTATGCATGTTTGAGGG + Intergenic
951080002 3:18443282-18443304 TTCCATGTTTGCATCCTTGGAGG - Intronic
952374390 3:32753783-32753805 TGCCATGAACAGATCCTTTATGG + Intronic
955616859 3:60818493-60818515 TGTCATGTGTATATTCTTGATGG - Intronic
955823373 3:62920125-62920147 TGCTATTTCTACATCTTTGAGGG + Intergenic
959223363 3:103550824-103550846 TGCCAAGTGTAGATACTTGAAGG - Intergenic
963503722 3:146160522-146160544 TGGCATGGATTTATCCTTGATGG - Intronic
963719822 3:148849548-148849570 TGTCATGTAGACATCTTTGCAGG - Intronic
966693729 3:182767871-182767893 GGCCATGTACTCATCCTTGATGG - Intergenic
970782513 4:19755469-19755491 TGGCATGTAGACATCTTGGAGGG - Intergenic
976864609 4:89709003-89709025 TAACTTGTTTACATCCTTGAGGG + Intergenic
977355206 4:95937644-95937666 TGCCATGTATACACCATTACAGG - Intergenic
979154537 4:117367011-117367033 TGCCAACTATACTTCATTGATGG + Intergenic
984013527 4:174400342-174400364 TGCCAAGTGTTCATCCTGGAGGG + Intergenic
991968393 5:72114355-72114377 AGTCATGTATACAGACTTGAAGG - Intronic
993942058 5:94070779-94070801 TGCCATATATACATCTTTCTTGG - Intronic
994852485 5:105073724-105073746 TGCCATATACACCTACTTGAAGG - Intergenic
995636061 5:114192208-114192230 TTCCGTGTCTACCTCCTTGAGGG + Intergenic
1000420111 5:161029051-161029073 TGCCATGTAATCATCACTGAGGG - Intergenic
1004244640 6:13961898-13961920 TGCCAAGTACTCATTCTTGAAGG - Intronic
1004565860 6:16796899-16796921 TGCCATCTATATATCCTGGTTGG - Intergenic
1005660436 6:27993415-27993437 TGCCATGTATATATCTTGTATGG + Intergenic
1007039456 6:38708293-38708315 TGCTAAGTATATATCCTAGAGGG + Intergenic
1007853290 6:44826513-44826535 TGAGATGTATACATGGTTGATGG + Intronic
1009355442 6:62739325-62739347 TGCCATGTTTATATCCTGAATGG + Intergenic
1009515295 6:64608742-64608764 TGCCATGAAAAAATCCTGGAAGG + Intronic
1009805662 6:68598781-68598803 TTACATTTATTCATCCTTGATGG - Intergenic
1010754417 6:79650681-79650703 TGGCATCAAGACATCCTTGAGGG + Intronic
1012160800 6:95883246-95883268 TGCTCTGTTTACATCCTGGAAGG - Intergenic
1014555070 6:122836069-122836091 TGCCAAGGATACAACCTTGAAGG + Intergenic
1023133441 7:37026861-37026883 TGTCATGTCTGCATCCTTCACGG + Intronic
1026540987 7:71279860-71279882 TGGCATGTAAACTTTCTTGATGG + Intronic
1027863897 7:83621911-83621933 TGCCATGCATATATCCTGAATGG - Intronic
1028747573 7:94345177-94345199 TGAGGTGAATACATCCTTGAGGG + Intergenic
1033734716 7:144210311-144210333 AGCCTTGTATACATCCTTTACGG + Intergenic
1033748339 7:144340658-144340680 AGCCTTGTATACATCCTTTACGG - Intergenic
1035725275 8:1820900-1820922 TGGCATTTATCCATCCATGAGGG - Intergenic
1040536397 8:48314877-48314899 TGCCGTGTAAACCTCCTAGAAGG + Intergenic
1040877774 8:52170717-52170739 TGCCATGCAAACATCCTGCAAGG - Intronic
1045128109 8:99116860-99116882 TGAAATGTATACTTCATTGAAGG + Intronic
1045339353 8:101238605-101238627 TGTCATCTATAAACCCTTGAAGG + Intergenic
1062551990 9:137092374-137092396 ACACATGTATACATCATTGAGGG + Intronic
1203631165 Un_KI270750v1:73690-73712 TGCTATGGAAACATCCCTGATGG - Intergenic
1185650983 X:1647963-1647985 TGCAATGTAGACATCTTTGGGGG + Intergenic
1186083739 X:5963116-5963138 TGCCATGAATAGACCTTTGAAGG + Intronic
1187837214 X:23444909-23444931 TGCGTTGTATCCATCCTTGTAGG - Intergenic
1191104563 X:56764458-56764480 TGCCAGGTACACTTCCTTCAAGG + Intergenic
1191760395 X:64641734-64641756 TGATATCTATACATCCCTGAGGG - Intergenic
1191917119 X:66214402-66214424 TGCCATGTTTAAAACCTAGAAGG - Intronic
1194776997 X:97977415-97977437 AGCCAAGTAGACACCCTTGATGG + Intergenic
1195703799 X:107724184-107724206 TGCCTTCTATCCATCCTGGAAGG - Intronic
1199179016 X:144830638-144830660 TACCATTTATAAATCCTTTAAGG + Intergenic