ID: 1100869947

View in Genome Browser
Species Human (GRCh38)
Location 12:98899840-98899862
Sequence CTCTCACATTTATAGCACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100869946_1100869947 -10 Left 1100869946 12:98899827-98899849 CCTTATTGAACATCTCTCACATT 0: 1
1: 0
2: 0
3: 17
4: 195
Right 1100869947 12:98899840-98899862 CTCTCACATTTATAGCACTGAGG 0: 1
1: 0
2: 1
3: 11
4: 159
1100869944_1100869947 20 Left 1100869944 12:98899797-98899819 CCAAAATATTAGTTAATTTTTTA 0: 1
1: 0
2: 11
3: 142
4: 1320
Right 1100869947 12:98899840-98899862 CTCTCACATTTATAGCACTGAGG 0: 1
1: 0
2: 1
3: 11
4: 159
1100869945_1100869947 -9 Left 1100869945 12:98899826-98899848 CCCTTATTGAACATCTCTCACAT 0: 1
1: 0
2: 0
3: 17
4: 199
Right 1100869947 12:98899840-98899862 CTCTCACATTTATAGCACTGAGG 0: 1
1: 0
2: 1
3: 11
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100869947 Original CRISPR CTCTCACATTTATAGCACTG AGG Intronic
900872327 1:5312907-5312929 CTCTCCCACTTACAGCAGTGTGG - Intergenic
907074686 1:51567494-51567516 CTCTCCCATGTCTAGCAGTGGGG + Intergenic
908537455 1:65091405-65091427 CTCTCACCTTTATAACCCTGAGG - Intergenic
912084683 1:105984261-105984283 CTTTCATTTTTATTGCACTGTGG + Intergenic
914094808 1:144535863-144535885 CACTCAGATTTTCAGCACTGAGG - Intergenic
914303714 1:146398035-146398057 CACTCAGATTTTCAGCACTGAGG + Intergenic
915535346 1:156532026-156532048 CCCTCACTTTTGTAGAACTGGGG + Intronic
915881679 1:159679230-159679252 CTCTGACATTTGTAGTACAGAGG - Intergenic
915976840 1:160396826-160396848 TTCTCACATTAAAATCACTGAGG + Intergenic
916186067 1:162134512-162134534 CTCCCCCATTTACAGCACTACGG - Intronic
918129836 1:181617619-181617641 CACTCACAATTATAGCAGTGAGG + Intronic
919788393 1:201274818-201274840 TTCTCATATTCAGAGCACTGTGG + Intergenic
920287587 1:204891648-204891670 CACACACCTCTATAGCACTGTGG + Intronic
920318080 1:205094147-205094169 TTCTCACTTTTATATTACTGAGG - Intronic
920754549 1:208716618-208716640 CTCACACATTTTTTTCACTGAGG - Intergenic
922017423 1:221664849-221664871 TTCACACATTTAAAGCACTTAGG - Intergenic
922168181 1:223133248-223133270 ATCTCACATTTATTACACTGTGG + Intronic
923391851 1:233520202-233520224 CTCTCAAATTCATATCACTGAGG + Intergenic
924855335 1:247869825-247869847 GTCTAACATTCATAGCACAGTGG + Intronic
1066331316 10:34426684-34426706 CTCCTACATTTTTAACACTGAGG - Intronic
1066618251 10:37318088-37318110 TTCTTGCATTTATAGAACTGAGG + Intronic
1068606679 10:59012832-59012854 CCCTCTCATTTCTACCACTGTGG + Intergenic
1071188235 10:83069048-83069070 CTCTGACATGTATATCACTAAGG + Intergenic
1073784047 10:106868506-106868528 CTTCTACATTTATTGCACTGTGG - Intronic
1074504838 10:114060323-114060345 CTCTCACATTGTTACCATTGAGG + Intergenic
1078031179 11:7752918-7752940 CTTTCATATTCCTAGCACTGGGG + Intergenic
1079797942 11:24830220-24830242 ATTTCACATTTAAAGCACTTTGG + Intronic
1081361448 11:42185323-42185345 CTCTTAAATTTATTTCACTGTGG - Intergenic
1081396255 11:42589840-42589862 CTCCCACCTGTACAGCACTGAGG + Intergenic
1082792007 11:57352679-57352701 ATCTCCAATTTATTGCACTGTGG + Intronic
1084207962 11:67606954-67606976 CTGTCACCTTCATAGCACTGAGG - Exonic
1085405247 11:76257650-76257672 CTCTGACTTATTTAGCACTGAGG - Intergenic
1085582163 11:77662283-77662305 CTTTCATATTTATACCACTTTGG - Exonic
1087282153 11:96223498-96223520 CTCTAACATTTTTAGGACTCAGG - Intronic
1087434318 11:98094194-98094216 CACACACATTTATAGGACTGAGG - Intergenic
1089021406 11:115219070-115219092 CTCTCACATTTATTACTCTTGGG - Intronic
1089777806 11:120850981-120851003 CCCTCACATTCATAGCCCAGTGG + Intronic
1090154327 11:124421571-124421593 CTCTCACATTTCTAACCATGTGG - Intergenic
1090803042 11:130186163-130186185 CTCACACATTTATGGAACTTTGG - Intronic
1092881948 12:12893513-12893535 TTCTCATTTTTATTGCACTGTGG + Intronic
1092893553 12:12991941-12991963 TTCTCACATGTAAAGCTCTGTGG - Intronic
1096174206 12:49501467-49501489 CTCTCACCACTGTAGCACTGAGG + Intronic
1098596621 12:72279778-72279800 ACCTGACATTTATAGAACTGTGG + Intronic
1098793052 12:74851144-74851166 CTTTCACATTTACATTACTGTGG + Intergenic
1100295090 12:93253817-93253839 CCCTCACAGTTATGGCACAGTGG - Intergenic
1100869947 12:98899840-98899862 CTCTCACATTTATAGCACTGAGG + Intronic
1101025091 12:100595207-100595229 CTGTCTTATTTATACCACTGTGG + Intronic
1101427234 12:104598284-104598306 CTCTCAGGTTTAGACCACTGGGG - Intronic
1105787816 13:23767091-23767113 GTCCTACAGTTATAGCACTGAGG - Intronic
1107088780 13:36453413-36453435 CTCTTACATTTCCAGCACTGAGG - Intergenic
1111122051 13:83865901-83865923 CTCTGCTATTTATAGAACTGTGG - Intergenic
1111678324 13:91414207-91414229 CTATCACAAGAATAGCACTGGGG - Intronic
1111947300 13:94679277-94679299 CTCCCACATTGAAAGGACTGTGG - Intergenic
1113227161 13:108171578-108171600 CTTTCATTTTTATTGCACTGTGG - Intergenic
1114992445 14:28303352-28303374 CTCTAATATTTAAAGCACAGTGG - Intergenic
1121110328 14:91308267-91308289 CCCTCACCTGTATAGCAGTGGGG - Intronic
1123915813 15:25025636-25025658 CTCTCATATATATAGCTTTGTGG - Intergenic
1124183944 15:27504734-27504756 CTCTAACATTTATTGTAGTGTGG + Intronic
1125383608 15:39113701-39113723 CTCTGACATTTAGAGAACAGAGG + Intergenic
1127888324 15:63223951-63223973 CACTGTCACTTATAGCACTGTGG + Intronic
1128125683 15:65191339-65191361 CTCTTCCATTTCTAGCAGTGTGG + Intergenic
1128462265 15:67879714-67879736 GTCTCCCATTTATATCTCTGTGG + Intergenic
1128676393 15:69612190-69612212 CTCTGCCATTTATAGCTCTTGGG - Intergenic
1129037903 15:72662052-72662074 CTTTCACATAGAGAGCACTGTGG - Intronic
1129211986 15:74075175-74075197 CTTTCACATAGAGAGCACTGTGG + Intronic
1129398417 15:75265910-75265932 CTTTCACATAGAGAGCACTGTGG - Intronic
1129402025 15:75290185-75290207 CTTTCACATAGAGAGCACTGTGG - Intronic
1129729112 15:77919496-77919518 CTTTCACATAGAGAGCACTGTGG + Intergenic
1129839390 15:78734452-78734474 CTTTCACATAGAGAGCACTGTGG - Intergenic
1132069200 15:98760857-98760879 CTTTCCCATTTTTATCACTGTGG - Intronic
1134148662 16:11788264-11788286 CTCTCACCTTGAGAGCCCTGAGG + Intronic
1138893794 16:61178351-61178373 TTGTCACATTTGTAGAACTGAGG + Intergenic
1139583872 16:67888652-67888674 TTCTCACATTTGCAGCACCGTGG + Intronic
1139774142 16:69303519-69303541 AACTGACATGTATAGCACTGAGG + Exonic
1141343768 16:83227240-83227262 CTCTGACACCTGTAGCACTGTGG + Intronic
1143148788 17:4794205-4794227 CTCTTACATTTTTAGGTCTGTGG - Intergenic
1144323068 17:14149899-14149921 CCCTCACATTTATTGCTCTCTGG - Intronic
1145351795 17:22090178-22090200 CCATCACATTTCTACCACTGTGG + Intergenic
1145403983 17:22569915-22569937 CCATCACATTTCTACCACTGTGG + Intergenic
1145722921 17:27089857-27089879 CCATCACATTTCTACCACTGTGG - Intergenic
1146691420 17:34878805-34878827 CTCTCATATTTTAAGCCCTGAGG + Intergenic
1152517819 17:80836574-80836596 CTCTGACATCTCTAGCCCTGTGG - Intronic
1153747637 18:8196357-8196379 CTCTAACAGTAATAGCACTAAGG - Intronic
1153947487 18:10030530-10030552 CTGTCTCATACATAGCACTGTGG - Intergenic
1154061472 18:11064743-11064765 CTATCACTTTTATATCAGTGTGG - Intronic
1157849829 18:51038026-51038048 CACCCATATTTCTAGCACTGTGG + Intronic
1159021170 18:63144540-63144562 CTCTCATATTTATTGCTCCGGGG - Intronic
1167737901 19:51308262-51308284 ATCACACATTTATAGCTCTTGGG + Intergenic
927011215 2:18906538-18906560 GGCTCACATTTAAAGCCCTGAGG + Intergenic
928381435 2:30821875-30821897 CCCTCACATTAACGGCACTGAGG - Intergenic
931736041 2:65195580-65195602 CTTTGATATTTTTAGCACTGAGG + Intergenic
935524707 2:104151543-104151565 ATCTCACTTGTATAGCAATGGGG - Intergenic
939422748 2:141994942-141994964 TTAGCACATATATAGCACTGAGG + Intronic
941390666 2:164909962-164909984 CTCTCACAATTATATCATAGAGG - Intronic
944022167 2:195118641-195118663 CTCTAACATTTTTGGCACTTTGG + Intergenic
944650904 2:201829344-201829366 ATCTCACATCTGTACCACTGTGG - Intronic
944715194 2:202370848-202370870 CTCTCTCATTTTAATCACTGAGG - Intergenic
946595686 2:221303422-221303444 CTCTCCTATTTAGAGCACTTGGG - Intergenic
946665382 2:222044398-222044420 CACTCATTTTTAGAGCACTGTGG + Intergenic
947627205 2:231627376-231627398 CTCACACATGTACAGCACTTTGG - Intergenic
1169645160 20:7802546-7802568 CTATGAAATATATAGCACTGTGG - Intergenic
1171562128 20:26135398-26135420 CCATCACATTTCTACCACTGTGG + Intergenic
1172462528 20:35130866-35130888 CTACCACATGTAAAGCACTGTGG + Intronic
1173453636 20:43187548-43187570 CTCACACATTTGTAGAAATGGGG - Intronic
1175321981 20:58094644-58094666 TGCTCTCATTTATAGCACAGGGG - Intergenic
1176649196 21:9530236-9530258 CCATCACATTTCTACCACTGTGG - Intergenic
1178173469 21:30069608-30069630 CTCTCACAATTTAAGCAGTGTGG - Intergenic
1179426336 21:41281838-41281860 CTCTCACATTTATATCAGTGAGG + Intronic
1179813799 21:43890170-43890192 CTATCACAGTTACAGCACTAGGG - Intronic
950399583 3:12759899-12759921 CTCTCACTTATCCAGCACTGTGG + Intronic
952384447 3:32829822-32829844 CTGTCACATAAATAGCAATGTGG - Intronic
953107329 3:39896522-39896544 CTCTCACATTTAAGGCATGGGGG - Intronic
956651166 3:71505911-71505933 ATCAAACATTTATTGCACTGTGG + Intronic
960510780 3:118546529-118546551 CTCTCACAATTATAGAAGTGTGG + Intergenic
961572327 3:127808621-127808643 CTCTTAAATTTAAGGCACTGTGG + Intronic
962438709 3:135392021-135392043 CTCTCACCTTTATGTCACTTAGG + Intergenic
963062278 3:141234567-141234589 CTTGCACATTTCTGGCACTGTGG + Intronic
966210417 3:177447513-177447535 TTCTCAAGTTTATAGCACTAGGG + Intergenic
969877548 4:10147033-10147055 CGTTCACATTTTTAGGACTGGGG + Intergenic
974753426 4:66171410-66171432 CTATCACAAGAATAGCACTGGGG + Intergenic
976782649 4:88778131-88778153 CTCTCACATTTGTATCTCTAAGG + Intronic
978264453 4:106805542-106805564 CTCTCAATTTTGTTGCACTGGGG - Intergenic
979069594 4:116185224-116185246 CTCCCCCATTTATGGCAATGTGG - Intergenic
980724300 4:136738562-136738584 CTGTCTCATTCATAGCACGGTGG + Intergenic
981444038 4:144814232-144814254 CTCTTAGTTTTATTGCACTGTGG - Intergenic
984116934 4:175693906-175693928 CTTTCACAAGAATAGCACTGAGG - Intronic
984541930 4:181049778-181049800 CTCTGATACTTATAGCTCTGTGG + Intergenic
987861910 5:23500116-23500138 ATCTCACCCTTATATCACTGTGG - Intergenic
991192798 5:63895617-63895639 CACACACAGATATAGCACTGGGG - Intergenic
991606567 5:68408092-68408114 CTCTCACAAGAACAGCACTGGGG + Intergenic
993032229 5:82717914-82717936 CTATCACAAGAATAGCACTGAGG - Intergenic
995085328 5:108102352-108102374 CTATCATATTTTTAGAACTGAGG + Intronic
997799274 5:136843570-136843592 ATCTCACATTTATAGGAAAGTGG - Intergenic
1000416497 5:160989717-160989739 TCCTCTCATTTATAGCAATGTGG - Intergenic
1001871134 5:175156973-175156995 CTCTTACACTCATACCACTGGGG - Intergenic
1006526954 6:34614529-34614551 CACTTATATGTATAGCACTGTGG - Intronic
1006681383 6:35798959-35798981 CTCTCACCTTTACATCCCTGGGG + Intergenic
1007995818 6:46306608-46306630 CTCTCACATGTATCACACTCTGG + Intronic
1008881779 6:56387573-56387595 CTTCCACATGTATAGCACTGAGG - Intronic
1011744890 6:90399973-90399995 CTTTCAGATTTATTCCACTGAGG + Intergenic
1014022988 6:116612227-116612249 ATCTAACATTTATGTCACTGGGG + Intergenic
1014791194 6:125674337-125674359 CTCTCACACTGAAAGCACAGGGG + Intergenic
1018086869 6:160308975-160308997 TTGTCACCTTTATTGCACTGAGG - Intergenic
1022540352 7:31129086-31129108 CCCCCACATTTACAGCTCTGAGG + Intergenic
1022828351 7:34039635-34039657 CACACACACTTATACCACTGTGG + Intronic
1023373435 7:39533809-39533831 CCCTAACATTTACAGCCCTGGGG + Intergenic
1023695622 7:42843337-42843359 CTCTCATATTAATGGCGCTGCGG - Intergenic
1024873734 7:53996091-53996113 CTTCCATATTCATAGCACTGGGG + Intergenic
1030326733 7:108227670-108227692 CTCTCACAGTTAAGGCTCTGTGG - Intronic
1037113302 8:15192746-15192768 CTCTCAGATTAATGGCAATGGGG - Intronic
1040057559 8:43073512-43073534 CTTTCACATTCATTGCACTCTGG + Intronic
1042106021 8:65327007-65327029 CTCTGACATATATGTCACTGTGG + Intergenic
1042319233 8:67457576-67457598 CTCTCACCTGGATAGCACCGTGG + Intronic
1045544243 8:103113928-103113950 CTCTGGGATTTATAGCTCTGTGG - Intergenic
1055309430 9:74963428-74963450 CTCTCAGATCTCTGGCACTGGGG - Intergenic
1055335293 9:75227507-75227529 CTATCACAATGACAGCACTGGGG + Intergenic
1056101634 9:83305466-83305488 CTCTGTCATTTATAGCAGTGTGG - Intronic
1056875867 9:90329893-90329915 CCCCCACATTTATAGCCCTTTGG - Intergenic
1057379394 9:94554564-94554586 CTACCACATTTCTACCACTGTGG + Intergenic
1058942983 9:109831353-109831375 CTCTCACAGTTCTGGCACAGGGG + Intronic
1203626932 Un_KI270750v1:33784-33806 CCATCACATTTCTACCACTGTGG - Intergenic
1186763775 X:12750052-12750074 CTCTGATATATATAGCACTATGG + Intergenic
1186921304 X:14283791-14283813 CTCTCTAATTTATAGCAAAGGGG + Intergenic
1186944563 X:14551196-14551218 CTATCCCACTAATAGCACTGAGG - Intronic
1188495348 X:30777736-30777758 CTCTCACAAGAATACCACTGAGG - Intergenic
1189069794 X:37851161-37851183 CTCTCACAAGAACAGCACTGAGG - Intronic
1196200790 X:112883644-112883666 GTATCACATTTGTAGCCCTGCGG + Intergenic
1196409368 X:115399842-115399864 CTCTCACATTTCTAGAACTTTGG + Intergenic
1197707144 X:129642169-129642191 CTGCCCAATTTATAGCACTGTGG - Intergenic
1198607288 X:138355913-138355935 CTATCACAAGAATAGCACTGAGG + Intergenic
1202366918 Y:24171918-24171940 CTTTCACATAGAGAGCACTGTGG - Intergenic
1202503864 Y:25498205-25498227 CTTTCACATAGAGAGCACTGTGG + Intergenic