ID: 1100872984

View in Genome Browser
Species Human (GRCh38)
Location 12:98931753-98931775
Sequence GGGGGTAAACACAGGGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 233}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100872984_1100872991 7 Left 1100872984 12:98931753-98931775 CCTTCATCCCTGTGTTTACCCCC 0: 1
1: 0
2: 3
3: 25
4: 233
Right 1100872991 12:98931783-98931805 TATCCTCCCTGTTATCTGATTGG 0: 1
1: 0
2: 0
3: 11
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100872984 Original CRISPR GGGGGTAAACACAGGGATGA AGG (reversed) Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
902741064 1:18438345-18438367 AGGGTTAAACACATGGATCAAGG - Intergenic
902899553 1:19505109-19505131 GGTGGTCCACACTGGGATGAGGG - Intergenic
904137776 1:28327376-28327398 AGAGGTAAAGACAGAGATGAAGG - Intergenic
904751465 1:32743242-32743264 GAGGGTAAACACAGGCAGAATGG - Intronic
905581361 1:39084671-39084693 GGGGACAAAGACAGGGAAGAAGG - Intronic
907265959 1:53261434-53261456 GAGGGAAAGCAAAGGGATGATGG - Intronic
908002740 1:59696664-59696686 GGGGCTAGACAGAGAGATGAAGG - Intronic
910843736 1:91585933-91585955 GAGCTTAAACACAGGGAGGAGGG + Intergenic
911824196 1:102460951-102460973 TGGGGTACATACAGTGATGAAGG + Intergenic
914881300 1:151548985-151549007 GGGGGTAAACACATAGCTGAGGG - Intronic
916873994 1:168948966-168948988 ATGGGTAAATTCAGGGATGAGGG - Intergenic
917735355 1:177915207-177915229 GGTGGTAACCATAGGGATGGTGG - Intergenic
919499896 1:198324845-198324867 TGGGGTAAAAATAGGAATGACGG + Intergenic
920035170 1:203060726-203060748 TGGGGGAAACAAAGGGAAGAGGG + Intronic
920440761 1:205979092-205979114 GAGGGGAGACACAGGGAAGAAGG - Intronic
921804807 1:219442165-219442187 GGGGAGAAAAACAGGGAGGAAGG - Intergenic
921930434 1:220749835-220749857 TGGAGTGAACACAGGGATGCAGG - Intronic
922562840 1:226581638-226581660 AGGAGTACACACAGAGATGATGG + Intronic
1062860061 10:803797-803819 GGGAGTGAACACAGGGTTGGTGG + Intergenic
1062914312 10:1235569-1235591 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062914609 10:1236797-1236819 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062914649 10:1236917-1236939 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062914763 10:1237277-1237299 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062914780 10:1237325-1237347 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062914848 10:1237541-1237563 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062914864 10:1237589-1237611 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062914887 10:1237661-1237683 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062914896 10:1237685-1237707 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062914936 10:1237805-1237827 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062914999 10:1237998-1238020 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062915020 10:1238067-1238089 GGGAGTAAACACCGGGATGCAGG - Intronic
1062915036 10:1238115-1238137 GGGAGTAAACACCGGGAGGGAGG - Intronic
1062915058 10:1238184-1238206 GGGAGTAAACACCGGGATGCAGG - Intronic
1062915096 10:1238304-1238326 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062915117 10:1238373-1238395 GGGAGTAAACACCGGGATGCAGG - Intronic
1062915217 10:1238686-1238708 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062915223 10:1238707-1238729 GGGAGTAAACACCGGGATGCAGG - Intronic
1062915261 10:1238827-1238849 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062915282 10:1238896-1238918 GGGAGTAAACACCGGGATGCAGG - Intronic
1062915391 10:1239240-1239262 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062915439 10:1239385-1239407 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062915498 10:1239577-1239599 GGGAGTAAACACCGGGAGGGAGG - Intronic
1062915562 10:1239769-1239791 GGGAGTAAACACCGGGAGGGAGG - Intronic
1062915587 10:1239841-1239863 GGGAGTAAACACCGGGAGGCAGG - Intronic
1062915648 10:1240033-1240055 GGGAGTAAACACCGGGAGGGAGG - Intronic
1062915703 10:1240203-1240225 GGGAGTAAACACCGGGAGGGAGG - Intronic
1063922985 10:10950071-10950093 GGGGATAAACTCAGGAATCAGGG - Intergenic
1065050635 10:21787981-21788003 TGGGGTAGCCTCAGGGATGAAGG - Intronic
1067580840 10:47444453-47444475 GGGCTTCAGCACAGGGATGAAGG - Intergenic
1068216024 10:53983437-53983459 GGTGTTAAAAACAGGGAAGAGGG - Intronic
1069358241 10:67612539-67612561 TGGGGTAAACACAGGCAATAGGG + Intronic
1069419676 10:68235826-68235848 GGGGGTGGACCCAGGGAAGAAGG + Intergenic
1070767072 10:79062916-79062938 GGGGGTTAAGACAAGGAAGACGG + Intergenic
1071751143 10:88477527-88477549 GATGGTGAAGACAGGGATGATGG + Intronic
1072895811 10:99365552-99365574 GGGGGCAGGCACAGGGCTGATGG + Intronic
1073762383 10:106644036-106644058 GCAGGTAAACACAGGGTGGAAGG + Intronic
1076696790 10:132251050-132251072 GGGGGTGACCCCAGGGATGGTGG - Intronic
1079579645 11:22047677-22047699 GGAGGATAAGACAGGGATGAGGG - Intergenic
1080857788 11:36127269-36127291 GGGGTTAAACAGAGGTTTGAAGG + Intronic
1081929429 11:46858516-46858538 GTGGGTAAAGACAGGGATGAAGG - Exonic
1083273485 11:61583961-61583983 CAGGGTAAACACAGCAATGATGG - Intergenic
1083681519 11:64353959-64353981 GGGGGTCAGGACAGGGAGGAGGG - Intronic
1083890806 11:65595014-65595036 GAGGGCACAGACAGGGATGAGGG - Intronic
1085303715 11:75473487-75473509 GGAGGTATACACAGGGATGCAGG - Intronic
1085498600 11:76996121-76996143 AGGGGGAAAGACAAGGATGATGG - Intronic
1086762718 11:90653189-90653211 GTGGGTGAACACAGGAGTGATGG - Intergenic
1089221064 11:116872123-116872145 GGGGGAAAACACAGGGAATGTGG + Intronic
1089340543 11:117754477-117754499 GTGGGGAAGCACAGGGGTGATGG + Intronic
1089365757 11:117919990-117920012 GGGGGTTACCACAGGGATCTTGG + Intronic
1089598588 11:119598629-119598651 GGGAGAAAGCACAGGGTTGAAGG + Intergenic
1091583058 12:1800357-1800379 GGGGGTAGACACGGGGCTGGTGG - Intronic
1096707435 12:53431152-53431174 GGGGGGAATGACAGGGAGGAAGG - Intronic
1096742305 12:53702711-53702733 GGGGGTCAACAGAGAGATGGGGG - Intergenic
1097249200 12:57623124-57623146 GTGGGAAAACACAGGTAAGAGGG + Exonic
1099004907 12:77224518-77224540 TGGGGGAACCACAGGGATTAGGG - Intergenic
1100872984 12:98931753-98931775 GGGGGTAAACACAGGGATGAAGG - Intronic
1102031335 12:109741701-109741723 GGAGGTACCCACAGGGATCATGG + Intronic
1102858523 12:116315491-116315513 AGGGGCACACACATGGATGAAGG + Intergenic
1104346277 12:128002074-128002096 AGGGGTGCACACAGAGATGAGGG + Intergenic
1106658148 13:31769319-31769341 GGGGGTAAATTTAGGAATGATGG - Intronic
1107346822 13:39470876-39470898 GGAGGTAACCACGGTGATGATGG - Intronic
1111629579 13:90832783-90832805 GGGGGTGATCACAGGGTGGAAGG + Intergenic
1113899140 13:113786636-113786658 GAGGGTAACGACAGTGATGATGG - Intronic
1114306462 14:21428128-21428150 GGGGGGAAAGACAGGAATGGAGG - Exonic
1119544842 14:75464102-75464124 GGAGGAGAACACAGGGGTGAGGG - Intronic
1121320433 14:92988647-92988669 AGGGGTACACACAGGGGTGAGGG + Intronic
1122142122 14:99668714-99668736 GCGGGGACACACAGGGATCAGGG - Intronic
1122411860 14:101529627-101529649 AGGGGTCAGCACAGAGATGATGG + Intergenic
1122687719 14:103518013-103518035 CGAGGTGAACACAGGGCTGAGGG - Intergenic
1128566735 15:68705713-68705735 GGGGCTAAGCCCAGGGATGGGGG - Intronic
1129318704 15:74761993-74762015 AGGGGTAAATACAGAGGTGAAGG - Intergenic
1129690347 15:77709839-77709861 AGGGGTAAACACAGGGAAGGTGG + Intronic
1132662498 16:1067905-1067927 GGGGCTACACACAGGGGAGAGGG - Intergenic
1133345149 16:5064894-5064916 GGGTGTAACCTCAGGGATGACGG + Intronic
1133507030 16:6422389-6422411 GAGGGGAAAGACAGGGAGGAGGG - Intronic
1133997454 16:10759228-10759250 GGTGCTGGACACAGGGATGAGGG + Intronic
1137616331 16:49849670-49849692 GGAGGTAAACAGAGGGAGGCAGG + Intronic
1138019010 16:53459924-53459946 GGGGGGAAGCTCAGTGATGATGG + Intronic
1139513086 16:67438256-67438278 GGCTGTAACCACAGGGCTGAGGG + Exonic
1139513198 16:67438885-67438907 GGGGGGAAGCACAAGCATGAGGG + Intronic
1139895612 16:70286135-70286157 GGGGGTAAACAAATGAATGTGGG - Intronic
1141385228 16:83616377-83616399 AGAGGTTCACACAGGGATGATGG - Intronic
1141842423 16:86581812-86581834 AGGGGTAAACACACAGATGGAGG + Exonic
1146179699 17:30689736-30689758 GGGGTTAGACACAGAGAAGAAGG - Intergenic
1146477190 17:33172496-33172518 GGGGGTAAGGACAGGCATGTGGG - Intronic
1148217416 17:45840565-45840587 GGGGGTGGGCACAGGGATGGGGG + Intergenic
1150200394 17:63350296-63350318 GGGGGAAAGCAGAGGGAAGAGGG - Intronic
1150696812 17:67412437-67412459 GAGGCTAATTACAGGGATGAGGG - Intronic
1151284089 17:73097177-73097199 GGGGGCAAGCAGAGGGATCATGG + Intergenic
1152233537 17:79126575-79126597 GGGTGTATAGACAGGGAGGAGGG - Intronic
1154181545 18:12143597-12143619 GGTGGAAAACACCGGGATCAGGG - Intergenic
1154182359 18:12147987-12148009 GGTGGAAAACACCGGGATCAGGG + Intergenic
1156023493 18:32625693-32625715 GGTGACAAACACAGGGATGAAGG + Intergenic
1156382700 18:36578520-36578542 GGCAGTGAACACAGGGATGGGGG - Intronic
1158947234 18:62457596-62457618 GGATGTCAACACAGGAATGATGG - Intergenic
1160413265 18:78688887-78688909 GGGGGTAAACAGGGGGAGGCCGG + Intergenic
1160475111 18:79177164-79177186 GGGGGCAAGGACAGGGAGGAAGG - Intronic
1161604760 19:5208451-5208473 GGGGGTGAAGATAGGGAGGATGG - Intronic
1162395694 19:10417116-10417138 GGGGGTAAACTGAGGCACGAGGG - Intronic
1162978910 19:14225826-14225848 GGGGTTAGACACAGAGAAGAAGG + Intergenic
1165051142 19:33142349-33142371 GGGAGGGAGCACAGGGATGAGGG + Intronic
1165135561 19:33666215-33666237 GGGGGTACACATAGGGAAGATGG + Intronic
1165286380 19:34846200-34846222 GGGAGAAAACAGAGGAATGATGG - Intergenic
1165733911 19:38163905-38163927 GGGAATAAACAGGGGGATGAGGG + Intronic
1167430911 19:49453872-49453894 CTGGGTAATCAAAGGGATGAAGG - Intronic
1167952165 19:53036587-53036609 GGGGGTGTAAACAGGGAAGAGGG - Intergenic
1168144479 19:54412908-54412930 GGGTATAAACTCAGGGCTGAGGG + Intergenic
1168583684 19:57576093-57576115 GTGGGAAGACACAGTGATGATGG - Intronic
925382753 2:3438281-3438303 GGGGGTTAATCCAGGGATGGTGG - Intronic
925382770 2:3438323-3438345 GGGGGCTAACCCAGGGGTGATGG - Intronic
928049399 2:27973647-27973669 GGGGGAAATCACAGAGAAGAGGG + Intronic
928337393 2:30409386-30409408 GGGTGCTAACACAGGGATCAGGG - Intergenic
930599077 2:53423468-53423490 GGTGATGAACACGGGGATGAGGG + Intergenic
932880210 2:75494320-75494342 TGGGGTAAACACAGGGATGCTGG + Intronic
935125923 2:100222896-100222918 AGGGATAAGCACAGGAATGATGG - Intergenic
936799898 2:116254216-116254238 GGGGGGAGAAACAGGGATTATGG + Intergenic
936980157 2:118256491-118256513 GTGGGTAAACACATGGCTGCAGG + Intergenic
937236945 2:120436882-120436904 AGGGGCAAACACATGGCTGAGGG - Intergenic
939877042 2:147589273-147589295 GGGAGGAGTCACAGGGATGACGG - Intergenic
940741032 2:157507776-157507798 GAGGGTAAAGGCAGGGGTGAGGG + Intergenic
940765223 2:157782926-157782948 AGGGGTTAGCACTGGGATGAAGG + Intronic
941408310 2:165120041-165120063 GTGGGTCTACAGAGGGATGATGG + Intronic
942673999 2:178407290-178407312 GGGGTTAAAAACAGGGAAGTTGG + Intergenic
942844014 2:180401098-180401120 GGGGATAGACACAGGGCTGGAGG + Intergenic
942929492 2:181472794-181472816 AGGGGAAAACAGAGGGAAGATGG - Intronic
943086015 2:183312179-183312201 GGAGATAAACACAGTGATGACGG + Intergenic
943699259 2:190972053-190972075 GGGGGTAAAGAGAGGGAGGGAGG + Intronic
944172908 2:196799337-196799359 GGAGCTTAGCACAGGGATGAGGG + Intronic
945089290 2:206163753-206163775 GCAGGTAAATACTGGGATGAGGG + Intergenic
945183960 2:207120978-207121000 GGAGGTAGAGACAGGGATGGAGG - Intronic
946427880 2:219609036-219609058 GGCGGTGATCAGAGGGATGAGGG - Intronic
947229331 2:227869621-227869643 GGGAGGAAACAGAGGGCTGAAGG - Intergenic
947612232 2:231531249-231531271 GGGGGTATAGACAAGGATGGAGG + Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
949021228 2:241742471-241742493 GGGGGGCAACACAGGCATGGTGG + Exonic
1170533724 20:17319668-17319690 GGGGGTGAACACTGGGAGGGGGG + Intronic
1170706224 20:18746874-18746896 GCAGGAAAACACAGTGATGAGGG - Intronic
1174998498 20:55599913-55599935 GGTGGAAAACACAGTGATGGTGG + Intergenic
1175219063 20:57406585-57406607 GGCGGTGACCACAGAGATGATGG - Intronic
1175309325 20:58000484-58000506 GGGTGTTAACACAGTGATGAAGG + Intergenic
1179414200 21:41185297-41185319 GGGGCTAAACAAATGGAGGAAGG + Intronic
1180877247 22:19180327-19180349 TGGGGCAAACACAGGCCTGAGGG - Intronic
1183321820 22:37169651-37169673 GGGGGCAAACCCTGGGAGGAGGG - Intronic
1184293370 22:43509597-43509619 GGGGGTGAATAGAGGGATGATGG - Intergenic
1184500840 22:44870585-44870607 GGGAGTAAAAACATGAATGAAGG - Intergenic
1184690483 22:46115135-46115157 GGAGGTGAGCACAGGCATGAGGG - Intergenic
950141313 3:10617926-10617948 TGGGGTCAACACAGCGATAAGGG - Intronic
950189764 3:10968552-10968574 GGGCGGAAACACAGGGGTGGAGG - Intergenic
951607290 3:24450040-24450062 GGAAGTAAACAGAGGGAAGAAGG + Intronic
951922484 3:27871681-27871703 CTGGGAAGACACAGGGATGAGGG + Intergenic
953378628 3:42449394-42449416 GGGCTTAAAGGCAGGGATGAAGG - Intergenic
954418596 3:50406522-50406544 GGGGGGAACAACAGTGATGATGG - Intronic
954453168 3:50582631-50582653 GAGGGCAGACACAGGGAGGAAGG + Exonic
956450352 3:69368493-69368515 GGGGGTAGGCACAGGCTTGAGGG - Intronic
956684514 3:71812418-71812440 GGGAGTCAAAACAGGGAAGAGGG + Intergenic
959479164 3:106850166-106850188 GGGGAGAAAGAGAGGGATGAAGG + Intergenic
961168462 3:124779594-124779616 GGTGGTTAACACAGGGATTCTGG + Intronic
961431758 3:126888891-126888913 GGGGCACCACACAGGGATGAGGG - Intronic
961662241 3:128475543-128475565 GGGTGCAAACAGAGGGAAGAAGG + Intergenic
962676436 3:137761802-137761824 GGGAGGGAACGCAGGGATGAGGG - Intergenic
963100441 3:141597471-141597493 TGGGGTATAAACAGGCATGAGGG + Intronic
965627645 3:170697732-170697754 GGGGAGAAACACAGAGTTGATGG - Intronic
966216559 3:177508863-177508885 GGGGGTCAACACAAGGCAGAGGG - Intergenic
967828265 3:193896293-193896315 CGGGGAAGACACAGGGAGGAGGG + Intergenic
968581450 4:1397193-1397215 GGAGGTGAGCACAGGGAGGAAGG - Intergenic
970793063 4:19881799-19881821 TGCAGTAAACACAGGCATGAAGG - Intergenic
976616537 4:87083711-87083733 GTGGGGAAACACAGTAATGATGG - Intronic
977709286 4:100106452-100106474 AGGGACAAACACTGGGATGAGGG + Intergenic
979092498 4:116503068-116503090 GCCGGTCCACACAGGGATGAGGG - Intergenic
979132154 4:117060557-117060579 GAAGGTAAACAGAGTGATGAAGG - Intergenic
981205475 4:142034909-142034931 ATTGGTACACACAGGGATGAGGG - Intronic
981210194 4:142094380-142094402 GGGGTAAAATGCAGGGATGAGGG - Intronic
982132944 4:152246916-152246938 GGGGGAAAACAAAGAGGTGAGGG - Intergenic
983970311 4:173863631-173863653 GGGAGAGAAGACAGGGATGAAGG + Intergenic
988520993 5:31945619-31945641 AGGGGGAAAAACAGGGTTGAGGG - Intronic
995313487 5:110739414-110739436 GGGGACCGACACAGGGATGAGGG + Intronic
995903207 5:117093782-117093804 GGCGGTAAACACCTAGATGAGGG + Intergenic
997475056 5:134137992-134138014 GGAGGAAGACACTGGGATGAGGG - Intronic
998658102 5:144205104-144205126 GGAGGTAAAGACAAGGAAGAAGG + Intronic
1001535927 5:172497842-172497864 GGGGGTGAACATGGGGATGCTGG - Intergenic
1001869218 5:175136014-175136036 GGGGCTGAGCACAGGAATGAGGG + Intergenic
1002472236 5:179442400-179442422 GTGGGTGAACAAATGGATGAAGG + Intergenic
1002472264 5:179442578-179442600 GTGGGTGAACAAATGGATGAAGG + Intergenic
1005959053 6:30683602-30683624 GAGGGGAAACCCAGGGAGGAAGG + Intronic
1007081512 6:39108432-39108454 GGGGGTAAACAAACTGACGAAGG + Intronic
1007295582 6:40818394-40818416 TGGGGTAAGCCCAGGGATGTGGG + Intergenic
1011985767 6:93443194-93443216 GGGGAAAAACAGAGGAATGAAGG - Intergenic
1015309667 6:131752673-131752695 GGTCGTAAACACAGGGTGGATGG - Intergenic
1015457186 6:133439737-133439759 GGGGCTAAAAACAGTAATGAAGG - Intronic
1016326917 6:142913376-142913398 GGGGGAAAACCCATGGATCAGGG + Intronic
1016784311 6:147993291-147993313 GGGAGTAAAGAAAGGGAGGAGGG + Intergenic
1017788014 6:157772435-157772457 GGGGCCAAACACAGGGATGAAGG + Intronic
1019109476 6:169698345-169698367 GGTGGTACAGACAGGGATGAGGG + Intronic
1019266782 7:121583-121605 GGCGGAAAAGACAGGGAGGAGGG + Intergenic
1021194764 7:17662972-17662994 AGGGGGAAGCACAGGCATGATGG + Intergenic
1021446149 7:20735768-20735790 AGGGGAAAACACAGAGAGGAAGG + Intronic
1021513784 7:21461334-21461356 GGGGGTAGACTCAGGCATGGTGG + Intronic
1023878862 7:44307396-44307418 GGGGGTAAGCAGAAGGAGGAGGG + Intronic
1024607436 7:51034062-51034084 AGGAAAAAACACAGGGATGAAGG - Intronic
1026771569 7:73204251-73204273 GGGAGTAAACAGAAGGATAAGGG + Intergenic
1027012435 7:74757647-74757669 GGGAGTAAACAGAAGGATAAGGG + Intronic
1027075605 7:75188406-75188428 GGGAGTAAACAGAAGGATAAGGG - Intergenic
1029009884 7:97248494-97248516 GGAGCTAAACAGAGGGATGATGG + Intergenic
1029974781 7:104822771-104822793 AGGGGCAAACACAGGGAGAAAGG + Intronic
1031974296 7:128084225-128084247 GGGGGCAAAAGTAGGGATGAAGG - Intronic
1037961183 8:23099434-23099456 GGGGGGAGACACAGGCATGAAGG - Intronic
1037970494 8:23168423-23168445 GGGGGGAGACACAGGCATGAAGG + Intergenic
1038477915 8:27881487-27881509 GGAGCTAAACACAGGGGTGGGGG + Intronic
1040553294 8:48455986-48456008 GGGGCTAAAAACATAGATGACGG + Intergenic
1041717147 8:60942756-60942778 GGGGGTGAACACCAGGAGGATGG + Intergenic
1043428968 8:80175931-80175953 GGTAGTAAACAAAGGGATGAAGG + Intronic
1044744866 8:95362225-95362247 AGGGGTGAACAAAGGCATGAAGG + Intergenic
1044773717 8:95665275-95665297 GGTTGTAAACTCAGTGATGAAGG - Intergenic
1044935567 8:97290446-97290468 GTGGGGAAAGACAGGGATGGGGG + Intergenic
1045412567 8:101933322-101933344 GGGAGAAAGCACTGGGATGATGG + Intronic
1045948968 8:107830078-107830100 AGGGGTAGACACAGGGAGGGAGG + Intergenic
1046109851 8:109709505-109709527 GGGGTTACAGACAGGAATGAAGG - Intergenic
1047673293 8:127172159-127172181 GAGGATAGACACAGGGTTGAGGG + Intergenic
1053011394 9:34635790-34635812 GGGGCCAAACACATGGATGGTGG - Exonic
1053163665 9:35829805-35829827 TTGGGTAAACACAGAGATGAGGG - Exonic
1054206637 9:62136375-62136397 GGGGATAAAAATAGGCATGAAGG - Intergenic
1054631717 9:67451971-67451993 GGGGATAAAAATAGGCATGAAGG + Intergenic
1059614330 9:115932279-115932301 GGGGGAAAACGATGGGATGAGGG + Intergenic
1060788486 9:126469109-126469131 GGGGCTACACACAGCTATGATGG + Intronic
1060822434 9:126669245-126669267 GAGGGTGGAGACAGGGATGAGGG + Intronic
1061275006 9:129564921-129564943 GGGGGCAAACACAGGGCAGGAGG + Intergenic
1062403161 9:136381331-136381353 CAGGGTAAACACAGGGGTGCTGG + Exonic
1187156052 X:16721163-16721185 GGGGGTGGAGACAGGGATGTGGG + Intronic
1187250386 X:17592848-17592870 GGGGGTATAGACAGGGCAGATGG + Intronic
1187802009 X:23074425-23074447 GAGGGTAAACAGTGGGAGGAGGG + Intergenic
1187844097 X:23518850-23518872 GGTGGTGACCACAGGGATGCTGG - Intergenic
1188453233 X:30331856-30331878 GGTGGTAAATACATGGATGATGG - Intergenic
1189763393 X:44344792-44344814 GGGGGCAAAGAAAGGGATGGAGG - Intergenic
1190433827 X:50403992-50404014 GTGGGTAGATATAGGGATGAAGG - Intronic
1190811002 X:53883375-53883397 GGGGGTAAATAAAAAGATGATGG - Intergenic
1192381256 X:70618900-70618922 GGGGGCAGACATAGGGATGAAGG + Intronic
1193317113 X:80077137-80077159 GTGGGGAATCACAGGGAAGAGGG + Intergenic
1194551983 X:95311840-95311862 GGGGGTGATCTCAGGGATTACGG + Intergenic
1197607672 X:128604464-128604486 TGGGGTAAACAAAATGATGAGGG - Intergenic
1197758969 X:130014697-130014719 GGGGGTCAACACAGGCATGGGGG - Exonic
1200600836 Y:5203282-5203304 GGTGATAAAGACAGGGATCAGGG + Intronic