ID: 1100874916

View in Genome Browser
Species Human (GRCh38)
Location 12:98951669-98951691
Sequence CTGTAGGCCCAGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 383}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100874916_1100874930 28 Left 1100874916 12:98951669-98951691 CCCTCTTCCCTCTGGGCCTACAG 0: 1
1: 0
2: 0
3: 38
4: 383
Right 1100874930 12:98951720-98951742 TCACCGTGTACCCTTGTTCAAGG 0: 1
1: 0
2: 0
3: 2
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100874916 Original CRISPR CTGTAGGCCCAGAGGGAAGA GGG (reversed) Intronic
900144194 1:1150839-1150861 CTAGAGGCCCAGAGGGAATCTGG - Intergenic
900512208 1:3066165-3066187 ATGTAGGCCCAGTGGGGAAAAGG - Intergenic
900704843 1:4073962-4073984 CTGTGAGCCCTGAGGGAAGGGGG + Intergenic
900787198 1:4656162-4656184 CTCCAGGGCCAGATGGAAGAGGG + Intronic
901205324 1:7491437-7491459 GAGTAGACACAGAGGGAAGATGG + Intronic
901816901 1:11799493-11799515 CTGTGGCCCCAGAGGGAATGAGG + Intronic
902511421 1:16968992-16969014 ATGGAGGCCCAGAGAGAAGTGGG + Intronic
902635601 1:17733215-17733237 CTGTAGGCCCACTGGGCCGAGGG - Intergenic
902801079 1:18830655-18830677 TCGTCGGCCCAGGGGGAAGAAGG + Intergenic
903129351 1:21268627-21268649 CTCTAGGCGGAGAGGGGAGAAGG - Intronic
903406336 1:23099927-23099949 GTGAGGGACCAGAGGGAAGAGGG - Intronic
903501907 1:23805123-23805145 CTGTAGGCCCAGATGTAGGCAGG - Intronic
903648443 1:24908881-24908903 CCTGAGGCCCAGAGAGAAGAAGG - Intronic
903886793 1:26545645-26545667 TTGTAGGCCCACAGGGAGGATGG + Intronic
904026973 1:27510104-27510126 GTGAAAGCCCAGAGGGGAGAAGG - Intergenic
904703343 1:32372251-32372273 CTGAAGGCACAGAGGGATGTAGG - Intronic
905009731 1:34739247-34739269 CAGCAGGCCCAGAGGAAAGGCGG - Intronic
905397408 1:37675718-37675740 CAGTAGGACCAGAGAGAAGCTGG + Intergenic
905688629 1:39926755-39926777 ACGAAGGCCCAGAGGCAAGAAGG - Intergenic
905876241 1:41433585-41433607 ATGAAGGCCAAGAGAGAAGACGG - Intergenic
906272943 1:44495769-44495791 ATATTGGCCCAGAGGTAAGAGGG + Intronic
907424846 1:54373146-54373168 CTGGAGGGGAAGAGGGAAGAAGG - Intronic
909501178 1:76337301-76337323 CTGCTGGCCCAGAGGCAAGAGGG + Intronic
909514379 1:76490791-76490813 CTGCAGGCCCACTGGGAAGACGG - Intronic
910668126 1:89746013-89746035 ATCTATGGCCAGAGGGAAGAGGG - Intronic
910952650 1:92667177-92667199 CAGGAGGCTCAGGGGGAAGACGG + Intronic
911809808 1:102261444-102261466 CTGTAGGCCCAAAAGGAAAAGGG - Intergenic
912390656 1:109300382-109300404 GAGGAGGCCCAGAGGGAAGGCGG + Intronic
912474925 1:109929129-109929151 GTGCAGCCCCTGAGGGAAGAGGG - Exonic
913082804 1:115404672-115404694 CTGTAGGTCAAGAAGCAAGAGGG + Intergenic
913996028 1:143652458-143652480 CTGTAAGCTCAGAGGGGAGCCGG - Intergenic
913996599 1:143655909-143655931 CTGAAGACACAGTGGGAAGACGG - Intergenic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915128931 1:153683890-153683912 GTGGGGACCCAGAGGGAAGAGGG + Intronic
915431417 1:155869738-155869760 ATGTCGGTCCAGTGGGAAGAGGG - Intronic
916519839 1:165553717-165553739 CTGCAGTCCCAGAGGGCAGAGGG - Intronic
916929130 1:169556680-169556702 CTGTGGGCCCAGAGGGAAAGTGG - Exonic
918078713 1:181189987-181190009 CTGGAGGCCCAGAGGGCACCCGG - Intergenic
918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG + Intergenic
918183333 1:182105446-182105468 CAGTAGGACCACAGGGAAGGAGG + Intergenic
918841300 1:189543080-189543102 TTGTAGGCCCAAAGGGAATCTGG - Intergenic
920128264 1:203711095-203711117 CTGTGCGCCCAGAGGTGAGAGGG + Exonic
920363904 1:205438148-205438170 CTGAAGCCCAAGAGGGAAAATGG + Intronic
920544825 1:206807450-206807472 GTGAAGGCCCTGAGAGAAGAAGG - Intronic
920612861 1:207458631-207458653 CTGAAGGACAAGAAGGAAGAAGG - Intronic
921980808 1:221256818-221256840 TTGTGGAGCCAGAGGGAAGAGGG + Intergenic
921991798 1:221374779-221374801 CTGTTGGCACAGAAGGAAGTGGG - Intergenic
922098220 1:222460620-222460642 CTGTAGGGCCAGAAGACAGATGG + Intergenic
922333696 1:224600902-224600924 GTGAAGGCACAGAGGGAAGGTGG + Intronic
1064727118 10:18291541-18291563 CTTAATGCCCAGAAGGAAGATGG + Intronic
1066055952 10:31680203-31680225 GTGTATGACCAGAGGGAAGAGGG + Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067456890 10:46425514-46425536 TTGGAGGCCCAGAGGGTAGGGGG - Intergenic
1067514705 10:46928566-46928588 CTGGGGGCTCAGAGGGAAGCAGG - Intronic
1067630313 10:47959125-47959147 TTGGAGGCCCAGAGGGTAGGGGG + Intergenic
1067647551 10:48123247-48123269 CTGGGGGCTCAGAGGGAAGCAGG + Intergenic
1069058738 10:63871747-63871769 CTGGAGGGCAAGAGGGAAGTGGG + Intergenic
1069313222 10:67065515-67065537 CTGTGGGCCCAGGAAGAAGATGG - Intronic
1074475840 10:113773550-113773572 CAGTAGGCCGAAAGGAAAGATGG + Intronic
1075581264 10:123620237-123620259 CTGGTGGCCCAGAGGAAAGGAGG + Intergenic
1075698644 10:124453971-124453993 CTCTATGCACAGAGGGAAGGTGG - Intergenic
1075726391 10:124612965-124612987 CTGGAGGCCCAGAGGGAGCTGGG + Intronic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1076726612 10:132416893-132416915 CTGTGGGCCCTGAGGGAAGGAGG + Intronic
1076911984 10:133394897-133394919 CTGGGGGCCGAGGGGGAAGAAGG + Intronic
1077024313 11:432545-432567 CTGTAGGCACAGGGGGAGGCTGG - Intronic
1077239223 11:1501964-1501986 CTGTAGGCACAGAGAGACGGTGG - Intergenic
1077252575 11:1567125-1567147 CTGTGGGGGCACAGGGAAGATGG - Intronic
1078399587 11:11012502-11012524 CTAGAGGCCCAAAGTGAAGAAGG + Intergenic
1078895565 11:15594246-15594268 TTGAAGGCCCAGAGAGAAGCTGG + Intergenic
1079346716 11:19659063-19659085 TTATAGTCCAAGAGGGAAGATGG + Intronic
1081378766 11:42389502-42389524 CTGTAGGTGCAAATGGAAGAAGG + Intergenic
1081573856 11:44307464-44307486 CTTCAGGTCCAGAGGGAAGGCGG - Intronic
1081734626 11:45394308-45394330 TTGTGGGCACAGAGGGTAGAGGG + Intergenic
1082102407 11:48183560-48183582 GTGTGGGCCCAGAGGGCAGAGGG + Intergenic
1082806845 11:57457239-57457261 GGGTATGCCCAGAGGGAAGGGGG + Intergenic
1083097604 11:60267558-60267580 CAGTAGTCCCAGAGAGAGGATGG + Intergenic
1083169740 11:60915968-60915990 CTGTAAGCCCAGAAGGCAGATGG + Intronic
1083592234 11:63902581-63902603 CTGCTGGGCCAGAGGGAGGATGG - Exonic
1083599799 11:63939500-63939522 ATTGAGGCCCAGAGGAAAGAAGG + Intronic
1084110976 11:67014022-67014044 ATGAAGGCACAGAGAGAAGAAGG - Intronic
1084518622 11:69649696-69649718 CTGTGGGGCCAGAGGAATGAAGG + Intronic
1088847786 11:113682330-113682352 CTGCAGGCCCTGAGGAAGGAGGG + Intergenic
1088980087 11:114854697-114854719 CTTTAGGTCCAGTGGGAAAATGG - Intergenic
1089205488 11:116758269-116758291 CTGTATGCCCAGTGGGGAAAAGG - Exonic
1089456256 11:118627692-118627714 CTGTAGGGCCAGATGGTAGCTGG - Exonic
1089510973 11:118997014-118997036 CTATAGGCCCAGGGGGAATGGGG + Intergenic
1090208672 11:124899936-124899958 CTGTGGGGCCAGAGTGATGAAGG + Intergenic
1090377166 11:126298948-126298970 CCGTTGTTCCAGAGGGAAGAAGG - Intronic
1092051769 12:5475992-5476014 ATGGAGGCCCTGATGGAAGAAGG + Intronic
1092139423 12:6172506-6172528 CTGAAGTTCCAGAGGGAGGAAGG + Intergenic
1093458086 12:19384141-19384163 TCCTAGGCCCAAAGGGAAGAGGG + Intergenic
1096622993 12:52876011-52876033 TCTTAGGCCCAGAGGGCAGAGGG - Intergenic
1097287556 12:57889496-57889518 CCTGAGGCCCAGAGGGAAGCAGG + Intergenic
1097951169 12:65429614-65429636 CAGTGGGCCCAGTGGGAACATGG - Intronic
1100201062 12:92298293-92298315 CTGCATTCTCAGAGGGAAGAGGG + Intergenic
1100475910 12:94935182-94935204 CTTTAGGCCAAGAGGGGAAAGGG - Intronic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1101885792 12:108660559-108660581 CTGTTTGCCTATAGGGAAGAAGG - Intronic
1102596404 12:113996148-113996170 CTGCAAGCCCAGAGGGCTGATGG + Intergenic
1102998664 12:117368510-117368532 GTTAAGGCCCAGAGGGAGGAGGG - Intronic
1107421258 13:40248936-40248958 CTCTAGGCCCAGTGGTAGGAGGG + Intergenic
1107711344 13:43153284-43153306 AGGAAGGCACAGAGGGAAGAAGG - Intergenic
1108691147 13:52860395-52860417 CTGGAGGCTCTCAGGGAAGAAGG - Intergenic
1108977252 13:56462888-56462910 CTGTAGGTCCAGAGGGAGTCAGG + Intergenic
1110603088 13:77399099-77399121 CTTTATGCCCAGAGAGAAAAAGG - Intergenic
1112504249 13:99966048-99966070 CTGCAGTCCCAGAGGGATCAGGG + Intronic
1113335577 13:109373057-109373079 CTGTAGGCTCAGAGGGTTGGAGG + Intergenic
1113458737 13:110467169-110467191 ATGCAGGACCAGAGGAAAGATGG - Intronic
1113868530 13:113544307-113544329 CTTTAGGCCCTGAGTGAGGAAGG + Intronic
1114654991 14:24310649-24310671 CTGTAGGCCCAGAAGGATGTCGG + Exonic
1117708717 14:58500629-58500651 CGGGAGGCTCAGAGGGCAGAGGG + Intronic
1117908398 14:60613490-60613512 CTGTGGGCCCAGAGGGTCCAGGG + Intergenic
1118913494 14:70081521-70081543 ATGGAGGCCCAGAGGGCAGTTGG - Intronic
1119386380 14:74260237-74260259 ATATAGGCCCAGAGGGCAGGTGG - Intronic
1119538534 14:75423018-75423040 CTCCAGGGCCACAGGGAAGAGGG + Intergenic
1119776474 14:77252229-77252251 CTGGAGGCCAAGAGAGAGGATGG + Intronic
1121286900 14:92743097-92743119 GTGAAGGCCCAGAGAGAGGAAGG - Intronic
1121578769 14:95010652-95010674 CTTGAGTCCCAGGGGGAAGAAGG + Intergenic
1121679085 14:95777553-95777575 CTCCAGGCCCAGGGGGAGGAAGG - Intergenic
1122042604 14:98999690-98999712 CGGGGGGCCCAGAGGGAAGCCGG - Intergenic
1122061106 14:99137247-99137269 CTGTAGCCCAGGAGGAAAGACGG - Intergenic
1122737987 14:103854893-103854915 TTGTTGGCCCTGAGGGCAGAGGG + Intergenic
1125727481 15:41875441-41875463 CTGCAGGTCCACTGGGAAGAGGG - Exonic
1128480289 15:68031551-68031573 CTGGAGGCAGAGAGGGAAGTTGG - Intergenic
1128609922 15:69065268-69065290 CTTTAGGGGCAGAGGGCAGAAGG + Intergenic
1129608184 15:77034975-77034997 CCGTGGGCCCACAGGGAGGAGGG + Intronic
1129930610 15:79407507-79407529 CTGGAGGCAATGAGGGAAGACGG + Intronic
1130086133 15:80779601-80779623 CTACAGACCCAGAGGTAAGAGGG + Exonic
1130638932 15:85652713-85652735 CTGTAGGCTCTGAGAGAAAATGG + Intronic
1131029675 15:89176007-89176029 CTGAAGGCCCTGATGGAAGGCGG - Intronic
1131400395 15:92120719-92120741 CTGTAGGCCCAGAGCAGAGTGGG - Intronic
1131588070 15:93717539-93717561 CTGGAAGCCCAGGGAGAAGAGGG + Intergenic
1131863038 15:96674972-96674994 CTGAAGGAACAGAGGGAAGGAGG + Intergenic
1132240718 15:100255322-100255344 CTTTGGGCCCTGAGAGAAGATGG - Intronic
1132289058 15:100686577-100686599 GTCAAGGCCCAGAGGGAAGCGGG + Intergenic
1132524193 16:406217-406239 CTGAAGGCCCAGCTGGCAGAGGG - Intronic
1132556971 16:576812-576834 CTGAAGGCCCAGAGGCAGCATGG - Intronic
1132644034 16:990687-990709 CCGTAGGCCCATGGGGAAGGCGG - Intergenic
1132976535 16:2713893-2713915 CAGCAGACCCAGAAGGAAGAGGG - Intronic
1133056762 16:3149310-3149332 CTGCAGGGCCAGTGGGAAGCTGG + Intronic
1133062762 16:3185498-3185520 ATGAAGGCCCAGGGAGAAGATGG + Intergenic
1134444474 16:14320458-14320480 CTGTGGGCGCTTAGGGAAGAAGG - Intergenic
1134685763 16:16157043-16157065 CTGTAGGTTCAGAGGGAGGGAGG + Intronic
1136690953 16:32028641-32028663 CTGGATGTCCAGAGAGAAGATGG - Intergenic
1138094647 16:54202313-54202335 CTGTAGGATGAGAGAGAAGAGGG - Intergenic
1138514647 16:57529281-57529303 CCGGTGGCCCAGAGGGAAGCGGG - Exonic
1138590259 16:57995859-57995881 CAGTGGGCCCAGGGGGAAGGGGG - Exonic
1139890774 16:70252027-70252049 CTGGAGGCCCGGAGGGAGAACGG + Intergenic
1139917560 16:70438037-70438059 CTGTAAAGCAAGAGGGAAGATGG + Intronic
1139939667 16:70596157-70596179 CTGTAGCCTCAGAGGCAGGAGGG + Intronic
1140412413 16:74748943-74748965 ATGGAGGCCCAGGGGGAAGGTGG + Intronic
1140730636 16:77852723-77852745 CTGTAGGCCAAAAGGAGAGAAGG - Intronic
1140954437 16:79849198-79849220 CTGCAGGACCAGCGGGAAGGTGG - Intergenic
1141756836 16:85996986-85997008 CTGCAGGCCCTGGGGGAAGCGGG - Intergenic
1142278670 16:89136720-89136742 CTGTAGGCACAGAGGCAGGTGGG - Intronic
1143208160 17:5161319-5161341 CTGTAAGCCCAGATAGAGGATGG + Intronic
1143542947 17:7580373-7580395 ATATAGGCTCAGAGGGAAGAAGG + Intronic
1144764727 17:17726148-17726170 CTTGTGGCCCGGAGGGAAGAGGG + Intronic
1145062435 17:19741614-19741636 GAGCAGGCCCAGAGGGGAGAAGG - Intronic
1146299097 17:31674263-31674285 CAGTAGGCAAGGAGGGAAGAAGG + Intergenic
1147356926 17:39905651-39905673 CTGCAGGCCAAGAGGGAAGCAGG - Intronic
1148379912 17:47188952-47188974 ATGTAGGGCCAGAGGTAACACGG + Intronic
1148685959 17:49501415-49501437 ATGAAGACTCAGAGGGAAGATGG + Intronic
1149230339 17:54526389-54526411 TTTTAGGCACAGAGGGTAGAAGG + Intergenic
1149380539 17:56088870-56088892 TTATTGGCCCAGAGGGAAAAAGG + Intergenic
1149412590 17:56424111-56424133 CTGGAGTCCCACAGGGTAGAAGG + Intronic
1149872241 17:60193117-60193139 CTGTAAGCCCAGATAGAGGATGG - Intronic
1150264277 17:63821844-63821866 CTGTAGACCCAAAGGAAAGTAGG + Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1151293452 17:73166285-73166307 CTGCAGGCCCTGAGGGAGGCGGG + Intronic
1151618273 17:75228975-75228997 CTGTAAGCCAGGAGGGAAGAAGG - Intronic
1151750186 17:76032746-76032768 CTCTAGGCCCAGCTGGAGGAGGG - Intergenic
1153464335 18:5372228-5372250 CTGTAGGCTCACAGGGTGGAAGG - Intergenic
1153516343 18:5905781-5905803 TTGTAGGACAGGAGGGAAGATGG - Intergenic
1154392563 18:13952894-13952916 CTAAAGGCCCAAAGGGTAGATGG - Intergenic
1155108364 18:22689254-22689276 CTGGAGGCAGAGAGGGAAGCTGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157445749 18:47745643-47745665 CTGTAACCCACGAGGGAAGATGG - Intergenic
1157749755 18:50167845-50167867 CCGTGGGGCCAGAGGGCAGATGG - Intronic
1159687304 18:71438402-71438424 GAGTAGGCCCTGAGGGAAGAAGG + Intergenic
1160191878 18:76721506-76721528 CAGTAGGGGCAGGGGGAAGATGG + Intergenic
1161665551 19:5574056-5574078 CTGTAGGCAAATAGGGAAGGAGG - Intergenic
1162059429 19:8085841-8085863 CAGAAGGGACAGAGGGAAGAGGG + Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163633363 19:18427875-18427897 CTGTGGGCCAAAGGGGAAGATGG - Intronic
1164536172 19:29087898-29087920 CTGTGGGGCCAGGGGGAACAAGG + Intergenic
1164727515 19:30476184-30476206 CTGGGGCCACAGAGGGAAGAAGG - Intronic
1164729885 19:30495601-30495623 GCGTAGGCCCACAGGGCAGAAGG + Intronic
1165141747 19:33704000-33704022 CTGGGGTCCCAGAGGGAAGTCGG + Intronic
1165142970 19:33713447-33713469 CTGTAGGAAAAGAGGGAAGTGGG - Intronic
1165386558 19:35513591-35513613 CTGCAGACCCAGAGGGAGGGAGG - Exonic
1165854527 19:38871482-38871504 TTGTAGTCCCAGAGGGAGGAGGG - Intronic
1165895818 19:39140251-39140273 CTGAAGCCACAGAGGGGAGATGG + Intronic
1165924454 19:39318628-39318650 CTCTTGGGTCAGAGGGAAGAGGG - Intergenic
1166714897 19:44960723-44960745 CTGGAGCCTCAGAGGGAAGTGGG + Intronic
1167600482 19:50451678-50451700 CTGTAGGGTCTGAGGGAGGAGGG + Intronic
925346722 2:3176851-3176873 AGGAAGGCCCAGAGGGGAGAAGG + Intergenic
925734321 2:6948023-6948045 ATCTAGGTCCCGAGGGAAGAGGG + Intronic
926019519 2:9482963-9482985 CTGCAGGCCCAGAAGCAAGCTGG - Intronic
926369839 2:12168663-12168685 CAGGGGGCCCAGAGAGAAGAAGG + Intergenic
927062067 2:19432621-19432643 CAGTAGCCCCAGAGCGAGGAGGG + Intergenic
927937354 2:27083291-27083313 CTGCAGGCCCATGGGGATGAGGG + Exonic
932005450 2:67922604-67922626 CTGTTGGCCTTGAGGGGAGAAGG + Intergenic
935535051 2:104284168-104284190 AGGTAGGCCCAGAATGAAGAAGG - Intergenic
935552698 2:104475227-104475249 CTGTGGGGACAGAGGGAATATGG - Intergenic
936059698 2:109286398-109286420 CTGGAGGCCCAGAGGGGCAAAGG + Intronic
937211330 2:120273690-120273712 CTGTAAGACCAGAGGCAAGATGG + Intronic
937862213 2:126720085-126720107 CTGTGGGCCTTGAGGGAAGTGGG + Intergenic
938904539 2:135825816-135825838 CTGTGGGCTGCGAGGGAAGAGGG - Intronic
939475532 2:142681535-142681557 CTAGAGGCACAGAGGGACGAAGG + Intergenic
940039920 2:149349328-149349350 CTGTAGGTACAGAGAGAAGTAGG + Intronic
940125571 2:150319795-150319817 CTGAAAGTCCAGAGAGAAGAAGG - Intergenic
940716679 2:157233769-157233791 CTGTAGGCACAAAGTGATGATGG - Intergenic
941055499 2:160783396-160783418 CTGCAGGCCCAGAGGGTTTAGGG - Intergenic
942999754 2:182311511-182311533 CTGTAGGACCAGAAGTAGGAAGG - Intronic
947179004 2:227395578-227395600 CTGTGTGCCCAGAGGGAGGCTGG - Intergenic
947351721 2:229253246-229253268 CTCTAGGCTCAGAGATAAGAGGG + Intronic
947746286 2:232508876-232508898 ATGGAGGCTCAGAGAGAAGAGGG - Intergenic
948783435 2:240338863-240338885 CAGAAGGCGAAGAGGGAAGAGGG - Intergenic
948814361 2:240502357-240502379 ATGTTGGGCCAGAGGGGAGAAGG - Intronic
948873468 2:240815450-240815472 CGGGAGGCCCAGAGGGAAGGGGG + Intronic
948931869 2:241137199-241137221 CTTTAAGCTCAGAGGGAAGGTGG + Exonic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1168854294 20:997991-998013 CTGCAGTCCAAGAGGGAAGGGGG - Intronic
1169482841 20:6000967-6000989 CTGCAGGACCAGAGGGAAACAGG + Intergenic
1170161675 20:13319791-13319813 CTGCAGGCCCAGGGACAAGAAGG - Intergenic
1170926352 20:20727944-20727966 CTGGAAGGACAGAGGGAAGAGGG + Intergenic
1171542803 20:25977366-25977388 CTCTAGGCCCACAAGGAACATGG - Intergenic
1171798251 20:29583159-29583181 CTCTAGGCCCACAAGGAACATGG + Intergenic
1171845836 20:30274015-30274037 CTCTAGGCCCATAAGGAACATGG - Intergenic
1172856654 20:38009471-38009493 GGGAAGGCCCAGAAGGAAGAAGG - Intronic
1173275991 20:41583024-41583046 CTGGAGTCCCAGATGGCAGAAGG + Intronic
1173495079 20:43513047-43513069 CTGAATCCCCAGAGGGAGGAGGG + Intronic
1174061279 20:47834711-47834733 CTGGAGACCCAGGGAGAAGATGG - Intergenic
1174070248 20:47894612-47894634 CTGGAGACCCAGGGAGAAGATGG + Intergenic
1174149021 20:48473086-48473108 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149047 20:48473244-48473266 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149085 20:48473495-48473517 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174156146 20:48516614-48516636 CTGGAGACCCAGGGAGAAGATGG - Intergenic
1175281728 20:57808325-57808347 CGCTAGGGCCAGTGGGAAGATGG - Intergenic
1176032725 20:63021504-63021526 CTGTAGGACAGGAGGGAAGGAGG - Intergenic
1176149379 20:63581510-63581532 CTGTATGTCCAGGGAGAAGAGGG - Intergenic
1176933231 21:14838909-14838931 CTGTAAGACCAGAAGGAAGGTGG + Intergenic
1178818738 21:35955526-35955548 CTGAAACTCCAGAGGGAAGAGGG + Intronic
1179410943 21:41162774-41162796 CTTTGGGACCAGAGGGAAGTAGG - Intergenic
1180006300 21:45022538-45022560 CTGGAGGCCCGGGTGGAAGACGG + Intergenic
1180926120 22:19556165-19556187 CTGCAGGGCCAGAGGCAAGATGG - Intergenic
1181629635 22:24143822-24143844 CTGATGGCCCAGGGGGCAGAGGG - Intronic
1181997999 22:26898097-26898119 CTGTAGGGCCAGGAGCAAGATGG + Intergenic
1182414360 22:30211536-30211558 ATATAGGCCCTGAGGGAGGAAGG + Intergenic
1182606440 22:31508818-31508840 CTCTAGGCCCAAAGAGATGAGGG - Intronic
1183269380 22:36851114-36851136 ATGGAGGCCGAGAGTGAAGAAGG - Intergenic
1183591526 22:38781870-38781892 GTGGAGGCCCAGAGCGATGAGGG - Intronic
1184368777 22:44069351-44069373 CTGCGGCCCCAGAGGGATGAGGG + Intronic
1184488403 22:44795474-44795496 CAGCTGGCCCAGAGGGTAGAGGG - Intronic
1184515140 22:44957096-44957118 CTGTGAGCTCAGAGGGAGGAGGG - Intronic
1184803069 22:46774296-46774318 CAGGAGGCCCAGAGGGAACAGGG + Intronic
1184907333 22:47497756-47497778 AAGTAGGCCCTGAGGGAAGCCGG - Intergenic
949159086 3:859190-859212 CTGGAGTCCCAGGGGGAAAATGG - Intergenic
949918923 3:8986247-8986269 CTGGGGGCTCAGAGGGATGAGGG - Intronic
953288574 3:41638292-41638314 GAGTAGGCCCAAAGGGAAAATGG - Intronic
953410111 3:42686022-42686044 CAGGAGGCCGAGACGGAAGACGG - Exonic
953449801 3:42996703-42996725 CTCTGGGCCTAGAGGGGAGATGG - Intronic
953462842 3:43095361-43095383 CTGTAAGCCCAGAGGGCAGTGGG - Intronic
958856687 3:99393973-99393995 CTGCAGGCCCAAAGGGAACACGG + Intergenic
961006656 3:123410129-123410151 GTGGAGGCCCTGAGGGCAGATGG - Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961934154 3:130565414-130565436 CTCTATGCCCAGGGTGAAGATGG - Exonic
963015306 3:140818786-140818808 GTGTGGGCCCAGAGGTAAGGTGG + Intergenic
963035117 3:141019353-141019375 GTCTAGGCCCAGATGGCAGACGG - Intergenic
963398411 3:144763811-144763833 TTGTATGCCCAGATGGAATATGG - Intergenic
964124170 3:153218540-153218562 CTGTAGCCCCAGATGTGAGAGGG + Intergenic
966318853 3:178678373-178678395 CCTTAGGCCCACAGGCAAGAGGG - Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
968077645 3:195825226-195825248 CTCTGGGGCCAGAGGGAAGCTGG - Intergenic
968518115 4:1023360-1023382 CTGCAGGCCCCGGGGGAGGAGGG - Intronic
969082734 4:4632340-4632362 CTGTAGGAGAAGAGGGAAAAGGG - Intergenic
969167593 4:5330117-5330139 ACTGAGGCCCAGAGGGAAGAAGG - Intronic
969276698 4:6140535-6140557 CTGCAGGGTCAGAGGGAAGTCGG + Intronic
969525443 4:7701793-7701815 ATGGAGGGGCAGAGGGAAGACGG + Intronic
969707390 4:8819227-8819249 CTGTAGCCCAAGAGGGAGAAGGG + Intergenic
970194367 4:13541033-13541055 CTGGAGTCGCAGAGGGCAGAAGG + Exonic
970594391 4:17586633-17586655 CTGCAGGATCAGAGGGATGAGGG + Intronic
971325153 4:25637477-25637499 TTGTAGGTCCAGAAGGAAGCAGG - Intergenic
971606250 4:28661618-28661640 CTGTATCCCCAGAGGGGAGTAGG - Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
972639391 4:40911886-40911908 GTGTAGGGGCAGAGGGAGGAGGG - Intronic
973723707 4:53751107-53751129 CTGCAGGCTGGGAGGGAAGAAGG - Intronic
974118678 4:57611810-57611832 CTGTAGTCCCAGGGGGATGAGGG + Intergenic
974236937 4:59193501-59193523 TGGTATGCCCAGAGGGTAGAAGG + Intergenic
976413069 4:84739518-84739540 ATGAATGCCCAGAGGGAAGAAGG - Intronic
976733075 4:88283930-88283952 CGGTACGCCCAGAGGGAGGTTGG - Intronic
976837010 4:89386116-89386138 ATGGAGGGACAGAGGGAAGAAGG + Intergenic
978277400 4:106968183-106968205 ATGTAGGCAGAGAGGGAAAAAGG + Intronic
984842440 4:184080788-184080810 CAGAAGGCCCAAGGGGAAGAAGG - Intergenic
986011336 5:3718602-3718624 CTGAAGACCCAGAGAGAAGATGG + Intergenic
988065697 5:26227422-26227444 CTGGAGACCCAGAGGGGAGCTGG - Intergenic
988695975 5:33623249-33623271 CAGTAGGGCCTGAGGGGAGAGGG - Intronic
989043042 5:37249045-37249067 GGGTAGGCCCAGAGCGAGGACGG + Intronic
990232521 5:53729129-53729151 CTGTAGTCCCAGAAGGTGGAGGG + Intergenic
990453611 5:55961373-55961395 CTCTAGGCCCAAAGGGATGAGGG + Intronic
991220777 5:64213552-64213574 CTGTAGGCCCAGTGGACAGTTGG + Exonic
992049630 5:72930574-72930596 ATCTAGGCCCAGAGGGACCAAGG + Intergenic
992227787 5:74635577-74635599 CTGTCCTCCCAGAAGGAAGAGGG + Exonic
992391888 5:76337239-76337261 CTGAAGACACAGAGAGAAGATGG - Intronic
992869661 5:80993677-80993699 CTGTAGGCCTGAAGGCAAGAGGG + Intronic
994382584 5:99088796-99088818 TGGTAGTCCCAGAGGGAGGAGGG - Intergenic
994471329 5:100211770-100211792 CTGTAGGCCCAGTGGGTACAGGG - Intergenic
995753001 5:115473059-115473081 ATGGAGGCCCCGAGGGAAGCAGG + Intergenic
996871620 5:128199092-128199114 CTACAGACCCAGAGAGAAGAGGG - Intergenic
997813335 5:136993411-136993433 GCGTATGCCCTGAGGGAAGAGGG - Intronic
998848906 5:146336362-146336384 CTGGAAGCCCAAAGGGAAAAGGG - Intronic
999148550 5:149411896-149411918 CTGTGTGCCCAGAGGGATAATGG - Intergenic
999217165 5:149944889-149944911 CTGTGGGGCCAGATGGGAGAAGG + Intergenic
999905371 5:156135428-156135450 CTGTAAGGCTACAGGGAAGAGGG - Intronic
1001162733 5:169335824-169335846 CTGGAGGCCAAGTGGGAAGGAGG - Intergenic
1001720779 5:173855361-173855383 CTGTTGGCCAGGAGGGAAAAAGG - Intergenic
1002133126 5:177093309-177093331 CTGTCGGGCCAGAGGGAAGCGGG - Exonic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1002439172 5:179255529-179255551 GTGGAGGCAGAGAGGGAAGATGG - Intronic
1002807580 6:591845-591867 GTGGAGGCCCTGAGGGAAGCTGG - Intronic
1003838417 6:10095171-10095193 TGGTGGGCCCAGAGGGAGGAAGG + Intronic
1005030240 6:21501481-21501503 CTGTATGCAAAGAAGGAAGATGG - Intergenic
1005657275 6:27953647-27953669 CTGTAATCCCAGCGGGAAGCTGG - Intergenic
1005973596 6:30780254-30780276 CTGAAGGCCCAGAGTGAACAGGG - Intergenic
1006051673 6:31350145-31350167 CTGAATTCCAAGAGGGAAGAGGG + Intronic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1006055119 6:31378472-31378494 CTGTAGGACCAGCAGGAACACGG + Intergenic
1007103417 6:39267268-39267290 GTGATGGCCCAGAGGGAAGGTGG - Intergenic
1007984214 6:46191132-46191154 CTGTTGGCCTTGAGGGAACAAGG + Intergenic
1008418322 6:51268709-51268731 CTGGAGGAACAGGGGGAAGAGGG - Intergenic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1010809964 6:80289922-80289944 CTCTAGTCCCACAGGGAAGCTGG - Intronic
1013172382 6:107648417-107648439 CTGTAGTCACAGTGGGGAGAGGG + Intronic
1014827838 6:126066469-126066491 ATGTATGTCGAGAGGGAAGATGG + Intergenic
1015312329 6:131779379-131779401 CCCTAAGCCCAGGGGGAAGAGGG - Intergenic
1015330889 6:131977890-131977912 CTGGGGGCTCAGAAGGAAGAGGG - Intergenic
1016648365 6:146435352-146435374 CTGTCAGCCCAGCGGGGAGAAGG - Exonic
1017341604 6:153330656-153330678 CTGTATGTTCAGATGGAAGATGG + Intergenic
1017631225 6:156397757-156397779 CTGCTAGCCCAGAGGGAGGAAGG + Intergenic
1019402977 7:866786-866808 CTGAAGGCCCAGGGAGAAGGGGG - Intronic
1019861491 7:3662537-3662559 CTGGAGGTCCAGAGAGAAGAAGG + Intronic
1019881984 7:3869490-3869512 GTGCAAGCCCAGAGGGAAGCAGG + Intronic
1021623640 7:22571992-22572014 ATGTGGGCCCAGGAGGAAGAAGG + Intronic
1021927837 7:25550416-25550438 CTTTAATCCCAGAGGGGAGAAGG - Intergenic
1022644380 7:32216912-32216934 CTCTAGCCCCAGTGGGAGGAGGG + Intronic
1022959485 7:35412955-35412977 GTGTAGGTCCACAGGCAAGATGG - Intergenic
1023659946 7:42460903-42460925 CTGCAGGCCCAGTGCGAGGAAGG + Intergenic
1023839628 7:44089058-44089080 GAGCAGGCCCAGAGGGAAGGAGG - Intergenic
1023881448 7:44323837-44323859 CTGGAGGCCAAGAGGACAGACGG + Intronic
1024842188 7:53600120-53600142 CTGGAAGCCCAGAGGAAAGCGGG + Intergenic
1025233143 7:57216357-57216379 CTGGAGACCCAGGGAGAAGATGG + Intergenic
1025294180 7:57762474-57762496 CTCTAGGCCCACAAGGAACATGG - Intergenic
1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG + Intronic
1031047111 7:116903723-116903745 CTGTGGGCCCAGAGGCAAGGTGG + Intronic
1032007713 7:128317000-128317022 CTGTATGTCCTGGGGGAAGATGG + Intronic
1032675485 7:134126405-134126427 CTGTAAGGCCAGAAGGATGAGGG + Intergenic
1033074949 7:138240118-138240140 CTGTGCGGCCAGAAGGAAGATGG + Intergenic
1033345940 7:140525859-140525881 CTGCATGCCAAGAAGGAAGAAGG - Intronic
1033353973 7:140584661-140584683 CTGAATGCCCAGAGGGCAGGGGG - Intronic
1034337141 7:150330885-150330907 CTGCTGGCCCAGAGGGAGAAGGG + Exonic
1035051661 7:156002309-156002331 TTTCAGGCCCAGAGGGAAGTAGG + Intergenic
1035312520 7:157978709-157978731 GTGCAGTCCCAGAGGGAAGTGGG - Intronic
1035869124 8:3118026-3118048 TTGTAGGACCAGAGGGAAAAAGG - Intronic
1036048128 8:5166729-5166751 CTGCAGGCCCAAATAGAAGATGG - Intergenic
1036911754 8:12763376-12763398 CTGTATCCCCACATGGAAGAAGG + Intergenic
1037940522 8:22947720-22947742 CTGTAGCTCCAGAGGGGAAATGG + Intronic
1039045907 8:33449200-33449222 CTGTGGGCACTGAGAGAAGAAGG + Intronic
1039254225 8:35701381-35701403 GAGTAGGCCCTGGGGGAAGATGG - Intronic
1040543122 8:48377069-48377091 CTGTGGGGCCTGAGGGAAGCTGG + Intergenic
1041395382 8:57384804-57384826 CTGGAATCCCAGAGGAAAGAGGG + Intergenic
1042229833 8:66544351-66544373 GTGTAGGCCCAGCGGGAAGTGGG + Intergenic
1042803967 8:72751892-72751914 ATGGAGGCCAGGAGGGAAGAAGG + Intronic
1042852289 8:73227832-73227854 GGGTAGGACCAGATGGAAGAAGG - Intergenic
1044776725 8:95697150-95697172 CTGTAGGCCCAAATGGTGGAGGG + Intergenic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1045203191 8:100008570-100008592 CTGAAGGAGAAGAGGGAAGAAGG + Intronic
1047211252 8:122842266-122842288 CTGGGGGCCCTGAGAGAAGAAGG - Intronic
1047316672 8:123741103-123741125 TTGGAGGCCCAGAGGGGAGAAGG + Intergenic
1047343965 8:124009533-124009555 CTGGAGACCCAGGGAGAAGATGG + Intronic
1047935923 8:129778047-129778069 CTAAAGGGCCAGAGGGAAGGCGG + Intronic
1048248048 8:132830948-132830970 CTGGAGGCCGAGAGCTAAGACGG - Intronic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1049431584 8:142567673-142567695 CTCGAGGACCAGAGGGATGAGGG + Intergenic
1049592062 8:143467086-143467108 CTGCAGCCGCAGAGGGGAGAGGG + Intronic
1049609900 8:143550069-143550091 TTGCGGACCCAGAGGGAAGAAGG - Intergenic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1053130767 9:35614039-35614061 CTGTATGGCCAAATGGAAGAGGG + Intronic
1054162238 9:61681829-61681851 CTCTAGGCCCACAAGGAACATGG + Intergenic
1054934687 9:70674109-70674131 CTGTCTGCCCACAGGAAAGAGGG + Intronic
1056577761 9:87869089-87869111 CTGTAGGAGAAGAGAGAAGATGG + Intergenic
1057700453 9:97360175-97360197 CAGTAGAGCCAAAGGGAAGAGGG + Intronic
1058324412 9:103677788-103677810 GTGTAGGCACAGAGGGACGGTGG - Intergenic
1059336528 9:113572559-113572581 CTGCAGGCCCTGAAGGAGGAGGG + Intronic
1059587293 9:115619898-115619920 CTGGAGGCCCAGGAGGAAAAGGG - Intergenic
1059694862 9:116721435-116721457 ATGGAGCCCCAGTGGGAAGAAGG + Intronic
1060112629 9:120917627-120917649 CTGGAGGCCCAAGGGGAGGATGG + Intronic
1060658289 9:125387883-125387905 GTGAAGGCCCAGAGGGGACACGG + Intergenic
1061091310 9:128428152-128428174 CTGTGGGACCAGAGGGAGAAAGG - Intronic
1185843033 X:3410905-3410927 GTGAGGGCCCAGAGAGAAGACGG - Intergenic
1187225786 X:17374923-17374945 CAGTAAGCGCAGAGGGAAGAGGG - Intergenic
1187433577 X:19246943-19246965 CTGTAGCCCTGGAGTGAAGAGGG - Intergenic
1187561351 X:20406475-20406497 TTATAGGCCCAAAGGGATGAGGG - Intergenic
1191670626 X:63745267-63745289 CTCTGGGCCCTGAGGGTAGATGG + Intronic
1192201341 X:69068575-69068597 CTGTGGGCCCTGAAGGAAAAAGG - Intergenic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1194227547 X:91279762-91279784 CTGCAGGCACACAGGGCAGATGG - Intergenic
1196115147 X:111991256-111991278 ATGTAGGCCCAGAGGAAAATGGG - Intronic
1196181605 X:112698169-112698191 CTGAAGGGCCAGAAGGAAGGCGG - Intergenic
1197765555 X:130057367-130057389 CTGGAGGCCCAGAGGCCAGGGGG - Exonic
1197881293 X:131169599-131169621 CTATAGGCCAAGAGGGAATATGG + Intergenic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1199331481 X:146565754-146565776 CTCAAGGCCCTGAGAGAAGAAGG - Intergenic
1199787471 X:151117833-151117855 CTGTGAGCCCACAGGCAAGAAGG - Intergenic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1201232162 Y:11875670-11875692 GTGAGGGCCCAGAGAGAAGACGG + Intergenic
1201311068 Y:12598512-12598534 CTGGAGGCCTAGAGGCCAGAGGG + Intergenic