ID: 1100876805

View in Genome Browser
Species Human (GRCh38)
Location 12:98970760-98970782
Sequence ATCTGTTACTACTTCCTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100876804_1100876805 -9 Left 1100876804 12:98970746-98970768 CCATGCGACTAATGATCTGTTAC 0: 1
1: 0
2: 0
3: 1
4: 46
Right 1100876805 12:98970760-98970782 ATCTGTTACTACTTCCTGAAAGG 0: 1
1: 0
2: 1
3: 19
4: 169
1100876803_1100876805 -3 Left 1100876803 12:98970740-98970762 CCTTCTCCATGCGACTAATGATC 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1100876805 12:98970760-98970782 ATCTGTTACTACTTCCTGAAAGG 0: 1
1: 0
2: 1
3: 19
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100876805 Original CRISPR ATCTGTTACTACTTCCTGAA AGG Intronic
901578292 1:10218865-10218887 ACCAGTTACTACTTCTAGAAAGG + Intronic
901950469 1:12741360-12741382 AACTGTTACTTCTTCATCAAAGG - Intergenic
906558645 1:46736326-46736348 GCCTGTTACCTCTTCCTGAAAGG + Intergenic
908857395 1:68446065-68446087 ATTTGTTAATACTTCATTAATGG + Intronic
909415021 1:75396405-75396427 GTCTGTTTCTCCTTCCTGAAAGG - Intronic
909777962 1:79507360-79507382 ATCTGTTTCTTCTTAATGAATGG + Intergenic
912914410 1:113798593-113798615 AACTGGTACAACTTTCTGAAGGG + Intronic
913481219 1:119291130-119291152 TTCTGGTAGTACTCCCTGAAGGG - Intergenic
914994313 1:152528323-152528345 GCCTGTTTCTACGTCCTGAATGG + Intronic
915988326 1:160488742-160488764 ATCAGTAAATACTTGCTGAATGG - Intronic
918364759 1:183795972-183795994 ATCTGTTACTACTACATGTTAGG - Intronic
919770059 1:201152371-201152393 ATCTCTTACTCATTCCAGAAGGG - Intronic
1066082411 10:31944600-31944622 TTCTGTAGCCACTTCCTGAAAGG - Intergenic
1071725608 10:88195479-88195501 ATCTGTAACTACTTGCTGAATGG + Intergenic
1073385321 10:103122538-103122560 ATCTGTTGCTAGTTACTGATAGG + Intronic
1073392201 10:103188594-103188616 ATCTGTTTCTACATCTGGAAGGG - Intronic
1073947381 10:108766691-108766713 AATTCTTACTACTTCCTCAAAGG - Intergenic
1074064076 10:109996930-109996952 ATGTGTTACTACTCCCAGGAAGG + Intronic
1076765020 10:132628375-132628397 AGCAGTTAGTGCTTCCTGAATGG - Intronic
1078817408 11:14839799-14839821 ATCTGTTACTTCTTGCTCAATGG - Intronic
1080002819 11:27370295-27370317 TTCTCTTAGCACTTCCTGAAGGG - Intronic
1081571366 11:44293512-44293534 ACCTGTTACTACTTCTTGGCAGG + Intronic
1085633440 11:78139187-78139209 ATCTGATAATACTGGCTGAATGG + Intronic
1087876309 11:103362182-103362204 ATCTTCAACTACTTCCTCAACGG - Intronic
1087968335 11:104447709-104447731 GCCTGTGCCTACTTCCTGAATGG - Intergenic
1089408368 11:118217940-118217962 ATCTGTTCCTCCTGACTGAATGG + Intronic
1090595701 11:128319013-128319035 ATCGCATACCACTTCCTGAAGGG - Intergenic
1093086535 12:14871483-14871505 AATGGTTACTCCTTCCTGAAAGG - Intronic
1095324985 12:40878672-40878694 ATGTGTTATTACTTCCTAAGAGG - Intronic
1095532484 12:43205328-43205350 ATCTTTTATTACTTCTTAAATGG + Intergenic
1095943820 12:47742447-47742469 ATCTCTCCCCACTTCCTGAAGGG + Intronic
1096725533 12:53558802-53558824 AACTGATACTACCTCCAGAATGG + Intronic
1098088160 12:66870798-66870820 GTATGTTACTACTTCATTAAAGG + Intergenic
1098340527 12:69445978-69446000 TTCTGTTTCTCCTTCCTGCATGG + Intergenic
1098595250 12:72266724-72266746 ATGTCATACTACTTCCTGAAAGG - Intronic
1099015070 12:77334783-77334805 ATATATTACAACTTTCTGAAGGG - Intergenic
1099716409 12:86298997-86299019 ATATGTTACAACTCCCTGTAAGG + Intronic
1100876805 12:98970760-98970782 ATCTGTTACTACTTCCTGAAAGG + Intronic
1102616071 12:114155376-114155398 ATCAGTTACAACTTCAGGAAAGG + Intergenic
1104124289 12:125831026-125831048 ATTTGTCACTTTTTCCTGAATGG + Intergenic
1106112463 13:26789066-26789088 GTCTGTCACTACTTTCTGGATGG + Intergenic
1110568340 13:76978509-76978531 ATCAGTAACTACTTGTTGAAAGG + Intergenic
1111710780 13:91811080-91811102 AACTGTCACAACTTCCTTAAAGG + Intronic
1111861265 13:93709865-93709887 ATATGCTAGTACTTCCTGACGGG - Intronic
1112078869 13:95944683-95944705 ATCAGTTACTCATTTCTGAATGG + Intronic
1113005209 13:105694263-105694285 CTCTGTTACTCTTTTCTGAAGGG + Intergenic
1114175883 14:20319103-20319125 ATCTGTTACTAATTCATAATAGG - Intronic
1115067325 14:29279904-29279926 ATCTGTTACCTCTTCCTAGATGG + Intergenic
1117401291 14:55360502-55360524 ATCTGTAGCTACTTCCTCCATGG + Intronic
1120296129 14:82643835-82643857 ATCTGTTACTTTTCCCTCAATGG + Intergenic
1124397273 15:29313981-29314003 ATCTGTGATTACTTCCTCCACGG - Intronic
1124643213 15:31412328-31412350 ATTTGTTACTGCAGCCTGAATGG + Intronic
1125034379 15:35106989-35107011 ATCTGTTACTACCTCCTAACTGG - Intergenic
1126245410 15:46499083-46499105 ATCCTTTACTACTTCCCCAAAGG - Intergenic
1126443379 15:48716247-48716269 ATCTGTGACTTCTTCATGGATGG - Intronic
1128811414 15:70575564-70575586 ATCTGTTTCCACTTTCTCAAGGG + Intergenic
1129938277 15:79469672-79469694 ATCTGTTTCCACCTGCTGAATGG + Exonic
1133677461 16:8088296-8088318 ATCTGTTACTAATTCATAACCGG - Intergenic
1134164250 16:11917039-11917061 ATTTTTTCCTACTTCATGAAGGG - Intergenic
1135240263 16:20799979-20800001 TTCTATTCCTACTTCCTGCAAGG + Exonic
1135344685 16:21679028-21679050 ATCTATTATTTCTTCCTAAAAGG - Exonic
1140405156 16:74705041-74705063 TTCTTTTACTAGTTCCTTAAAGG - Intergenic
1146582379 17:34050252-34050274 ATTTGTCACCACTTCGTGAAAGG + Intronic
1149358111 17:55864958-55864980 TTTTGTTACTGCATCCTGAATGG + Intergenic
1156083708 18:33373873-33373895 ATCAGTTACTCCTTCATGGATGG - Intronic
1158346620 18:56522775-56522797 GTCTGTTGCTACTTTCTGTAAGG + Intergenic
1160367649 18:78341952-78341974 TTCTGTTTCTACTTTCTGGAAGG + Intergenic
1160597532 18:79987338-79987360 ATCTGTTACTCTTTACTCAAAGG + Intronic
1165039836 19:33061165-33061187 AGCTGTTCCCTCTTCCTGAAGGG + Intronic
1166383015 19:42364892-42364914 ATTTTTTAGTGCTTCCTGAATGG - Intronic
1166409679 19:42548131-42548153 ATCTGTTGCCACTCCCTGCAGGG - Intronic
925237679 2:2293603-2293625 ACCAGTTACTACTTCCTCAGGGG - Intronic
925323013 2:2991450-2991472 ATCTGTCACTATTTCCTCAAAGG + Intergenic
926651206 2:15348230-15348252 ATCTATTACAATTTGCTGAAAGG + Intronic
930345000 2:50169205-50169227 ATCTTTTACTGCTTTCTGTACGG - Intronic
930565755 2:53018469-53018491 ATGTTTTAATACTTCCTAAATGG - Intergenic
930686216 2:54311449-54311471 ATCAGTTGCTAATTCCAGAATGG - Intergenic
930931539 2:56889421-56889443 ATCTTTTACTTCTTTCTGATTGG + Intergenic
933226180 2:79751958-79751980 ATCTTTTTCAACTTACTGAAGGG + Intronic
933290713 2:80435474-80435496 TTCTGAAACTACTTCCAGAAGGG + Intronic
933951653 2:87335537-87335559 ACCTGTGACTACTTGATGAAGGG - Intergenic
934134409 2:88981930-88981952 ACCTGTGACTACTTGATGAAGGG + Intergenic
934235897 2:90231847-90231869 ACCTGTGACTACTTGATGAAGGG - Intergenic
935053185 2:99541820-99541842 ATCTGTGAATACTTCTTGCAGGG - Intergenic
935100341 2:99988628-99988650 ATATGTTACTAATCTCTGAAAGG - Intronic
935843077 2:107134561-107134583 TTTTGTTACTATTTCCTAAAAGG + Intergenic
936118922 2:109725053-109725075 CTCTGTAACTACTTGCTGAGTGG + Intergenic
936416288 2:112316551-112316573 ATCTGTAAATACTTCCTGGAAGG + Exonic
940335166 2:152519165-152519187 ATTTGTTACTTTTTCCTGAGAGG + Intronic
940591852 2:155739158-155739180 ATCTGTTCCAACCTCCTTAATGG - Intergenic
941092592 2:161195736-161195758 ATCTATTACCACATCCTTAATGG - Intronic
941500467 2:166269001-166269023 ATCTGTTACTACAACCTCTAAGG + Intronic
941567201 2:167124114-167124136 TTCTATTACTCCTTCCAGAATGG - Intronic
942101184 2:172585640-172585662 ATCTGTTACTCCTTTCTGGTGGG - Intronic
942291578 2:174477015-174477037 ATCTGAAAATACTTGCTGAATGG + Intronic
943982273 2:194569330-194569352 ATATGCTACTAATTCCTGAAGGG - Intergenic
944763101 2:202837690-202837712 ATCTTTTTCTAGTTCCTTAAGGG + Intronic
945537399 2:211035791-211035813 ATCTGTTTACATTTCCTGAAAGG - Intergenic
1168774925 20:439434-439456 ATATGTTATTACTTCCTTGATGG - Intronic
1169509510 20:6248617-6248639 TTCTTTTAGTATTTCCTGAAAGG + Intergenic
1169625796 20:7567151-7567173 CTTTGTTCCTACTTCTTGAATGG + Intergenic
1169943905 20:10968083-10968105 ATCTGTCACTACATCCAAAATGG - Intergenic
1170155241 20:13263173-13263195 CTCTGTTCCTGCTGCCTGAAGGG + Intronic
1172131943 20:32661741-32661763 ATCTGTGGCTGCATCCTGAATGG - Intergenic
1177991794 21:28043943-28043965 ATTTTTTTCTACTTCCTGACAGG - Intergenic
1178422270 21:32452231-32452253 ATATCTTAGTGCTTCCTGAAGGG + Intronic
1179882318 21:44298242-44298264 AGCTGTTCCAGCTTCCTGAATGG + Intronic
1181760934 22:25058410-25058432 GTCTGATACTACATCCTGGATGG - Intronic
951471955 3:23065954-23065976 ATCTGTAACTTCTTCATGACTGG - Intergenic
952732095 3:36649382-36649404 ATCTGTTATTACAGCCAGAATGG + Intergenic
955000565 3:54923573-54923595 ATCTGTTTCTACTACCAGAATGG + Intronic
956394158 3:68806906-68806928 TTCTGTTACAGCATCCTGAAAGG + Intronic
957026958 3:75193090-75193112 ACCTGTGACTAGTTTCTGAAGGG - Intergenic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
960119769 3:113935886-113935908 ATATGCTACTCCTTCCTGTAAGG + Intronic
960843561 3:121986003-121986025 CTCTGTTACTGCTGCCTGAAAGG + Intergenic
964879296 3:161405948-161405970 ATCTGTTTAAACTTCCTGGAAGG + Intergenic
964882011 3:161433189-161433211 ATCTGTTAATATTTTCTAAATGG + Intergenic
965341192 3:167493302-167493324 ATCTGATACCACTCCATGAACGG + Intronic
966098075 3:176230182-176230204 ATCTGTAACTTCTTCCTCCATGG + Intergenic
966190388 3:177267085-177267107 ATTTCTCACTATTTCCTGAATGG - Intergenic
967093772 3:186159813-186159835 ATCCGTTATTACCTCCTTAAAGG - Intronic
967671367 3:192239335-192239357 ATTTGTTCCTACTTCTTTAATGG - Intronic
968992697 4:3925329-3925351 ATACGTTAGTGCTTCCTGAAGGG - Intergenic
970731705 4:19112545-19112567 TCCTGTTACTACTTCTAGAATGG + Intergenic
970813021 4:20118013-20118035 ATCTGTAACTATTTTCAGAAGGG + Intergenic
971511302 4:27428571-27428593 TCCTGTTTGTACTTCCTGAAAGG + Intergenic
974291671 4:59940505-59940527 ATATCTTATTACTTCCTAAATGG - Intergenic
974573945 4:63691717-63691739 ATCTTTTAGTATTTCCTGAAGGG - Intergenic
975300594 4:72786007-72786029 ATCTGATCCTACTTTTTGAATGG - Intergenic
977861487 4:101966163-101966185 ATCTGTAACCATTTCCTTAATGG + Intronic
979059595 4:116041162-116041184 TTCTATTACTCCTTGCTGAAAGG + Intergenic
980017291 4:127665496-127665518 TTCTTTTACCTCTTCCTGAAAGG + Intronic
980224759 4:129967556-129967578 CTCTGTTAGGACTTCCTGAGAGG - Intergenic
983589952 4:169397663-169397685 ATCTGATATTGCTTCCTGAGTGG + Intronic
984039237 4:174708693-174708715 AACTATTACTACTTCCATAAAGG - Intronic
984719137 4:182953822-182953844 TTCTGATCCTACTTCCTGATGGG - Intergenic
987651505 5:20746509-20746531 ATCTGTGTCTACTTTCTGAAAGG - Intergenic
988744056 5:34114955-34114977 ATCTGTGTCTACTTTCTGAAAGG + Intronic
993778345 5:92031440-92031462 ATTTGTTACCCCTTCCTGGATGG + Intergenic
996998037 5:129723150-129723172 ATCTGTTACTACATCATCCATGG + Intronic
999737314 5:154522313-154522335 ATCTGCTTCTCCTTCCTGCAGGG + Intergenic
1000604035 5:163309121-163309143 TTCTCTTACTACTTCTTTAACGG - Intergenic
1000640148 5:163692505-163692527 ATTTATGACTACTTCCTTAAAGG - Intergenic
1000733774 5:164872215-164872237 ATCACTTATTACTTCCAGAAGGG - Intergenic
1001018779 5:168165350-168165372 ATCAGCTTCTACTTCCAGAAAGG + Intronic
1001356032 5:171023245-171023267 ATCTTTATCTACTTCCTCAATGG + Intronic
1004636246 6:17470721-17470743 ATCTGTTACTTCTTCCTTCCAGG - Intronic
1016339401 6:143045594-143045616 ATCTGTGCCTATGTCCTGAATGG + Intergenic
1016601764 6:145870215-145870237 ATCTCTTATTAGTTCCAGAAGGG + Intronic
1016717146 6:147247799-147247821 CTCTTTTACAACTTCCTGACAGG + Intronic
1017556965 6:155582201-155582223 ATGTGTTACCACTTCCTGGCAGG + Intergenic
1020834563 7:13132785-13132807 CTCTGTTACTCCATCCTGTATGG - Intergenic
1021529308 7:21625562-21625584 TTCTTTTTCTAGTTCCTGAAGGG + Intronic
1022051153 7:26674104-26674126 ATCGGTAACTAATTTCTGAAAGG - Intronic
1022154253 7:27643312-27643334 ATCTGATACTACCTGTTGAATGG + Intronic
1025242580 7:57290112-57290134 ACCTGTTACTAATTCAAGAAGGG - Intergenic
1026398357 7:69982859-69982881 ATCTCTTATTTCTTGCTGAATGG - Intronic
1027820182 7:83032614-83032636 ATTTGATACAATTTCCTGAAGGG + Intronic
1028397310 7:90385121-90385143 TGCTGTTACTACTTCCAAAATGG + Exonic
1031185288 7:118472113-118472135 CTCTGTAGCTACTTCCTTAAGGG - Intergenic
1032111087 7:129076148-129076170 TTCTTTTACTCCTTCCAGAAAGG - Intergenic
1032809937 7:135402855-135402877 TTCTTTTACTACTTCCTTAATGG + Intronic
1033001478 7:137509845-137509867 ATCTGTTACTAACTCCTGAGGGG - Intronic
1033820648 7:145130725-145130747 ATCTAATACTACTTCCTCCATGG + Intergenic
1037384640 8:18325303-18325325 ATCTGTTACTACTAACTCTATGG + Intergenic
1038093818 8:24285319-24285341 CTCTGTGCCTACGTCCTGAATGG - Intergenic
1039231338 8:35452021-35452043 ATGTGTTACTTCTTCCTATAGGG + Intronic
1041966259 8:63681347-63681369 ATCTGTTCTTAGTTTCTGAATGG + Intergenic
1042375639 8:68048307-68048329 ATCTGATACTACTTTCCGAATGG - Intronic
1042734788 8:71976232-71976254 ATCTGTTTCTTCTTCCTAAAAGG - Intronic
1043221708 8:77673819-77673841 GTCTGTTAATTCTTCTTGAAAGG + Intergenic
1043524610 8:81083054-81083076 CTCTGTTACCACTCCCAGAAGGG + Intronic
1047210303 8:122835228-122835250 ATTTTCTACTACTTTCTGAAGGG + Intronic
1048262339 8:132955681-132955703 ATCTGTGACTGCTTCCTGGAGGG + Intronic
1049591722 8:143465820-143465842 GTGTGCTCCTACTTCCTGAAGGG - Exonic
1049850880 8:144829470-144829492 AAATGTTACCACCTCCTGAAAGG - Exonic
1049975719 9:859900-859922 ATCTGTTACTATATGCTGAATGG - Intronic
1051331805 9:16031713-16031735 ATATGTAACCACTTCCTGAGGGG + Intronic
1053112795 9:35477333-35477355 ATCTGCTACTATTTGCTGACTGG - Intergenic
1058289626 9:103222838-103222860 GTCTATTACTATATCCTGAATGG - Intergenic
1185713075 X:2319591-2319613 ATATTTTACTACTTACTAAATGG - Intronic
1188380452 X:29485331-29485353 GTCTGTTAATACTTGCTGAGTGG + Intronic
1190067953 X:47255346-47255368 AACTCTTACAATTTCCTGAATGG - Intergenic
1194874566 X:99171013-99171035 ATCTGTCAATGCTTCCTGAGAGG - Intergenic
1195724975 X:107905456-107905478 TTCTTTTACTAATTCCTTAAAGG + Exonic
1198738811 X:139818217-139818239 TTCTGTTAATGCTTCTTGAATGG + Intronic
1199479502 X:148282606-148282628 ATCTCTTCTTACTTCCTGAGAGG - Intergenic
1199518220 X:148703368-148703390 ACCTGTTACCAGTTCATGAATGG - Intronic
1199644877 X:149898457-149898479 ATCTCTTCCTACTTCCTGTAAGG + Intergenic