ID: 1100876881

View in Genome Browser
Species Human (GRCh38)
Location 12:98971605-98971627
Sequence CTCACCTAACATTCAAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100876878_1100876881 20 Left 1100876878 12:98971562-98971584 CCTTTGTCTAGAGTGATCTTATG 0: 1
1: 0
2: 0
3: 7
4: 90
Right 1100876881 12:98971605-98971627 CTCACCTAACATTCAAATGAAGG 0: 1
1: 0
2: 0
3: 14
4: 132
1100876877_1100876881 21 Left 1100876877 12:98971561-98971583 CCCTTTGTCTAGAGTGATCTTAT 0: 1
1: 0
2: 0
3: 10
4: 147
Right 1100876881 12:98971605-98971627 CTCACCTAACATTCAAATGAAGG 0: 1
1: 0
2: 0
3: 14
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100876881 Original CRISPR CTCACCTAACATTCAAATGA AGG Intronic
903971046 1:27119104-27119126 CTCACCAAACTTCCAATTGATGG + Intronic
907765628 1:57407912-57407934 CTCATCAAACATTTAAATGCTGG - Intronic
908341789 1:63188518-63188540 CTCACGTAACAGTCCAGTGAAGG + Intergenic
910897977 1:92088073-92088095 CTAATCTATCATTAAAATGATGG - Intronic
911513986 1:98844780-98844802 TTCACCTAAAATTAAAATGTTGG + Intergenic
912978932 1:114353299-114353321 CTCACCTAGCATCCTACTGAGGG - Intergenic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
917185287 1:172347078-172347100 CAGACCTTACATTCAAATGGGGG - Intronic
919659523 1:200230190-200230212 TTGAGCTAACATTCTAATGATGG - Intergenic
923281560 1:232448009-232448031 CACACCTGACTTTCACATGATGG - Intronic
1065129813 10:22609161-22609183 CTAAAACAACATTCAAATGAAGG + Intronic
1065821066 10:29526019-29526041 CTCATATAACAGTAAAATGAAGG + Intronic
1067022925 10:42817851-42817873 ATCACCTGCCATTCAAATCAGGG - Intronic
1070510369 10:77155462-77155484 CTCACCTAGCAATGAGATGATGG + Intronic
1073772429 10:106750074-106750096 CTCACTTAGCTTTCAAATTAAGG - Intronic
1075986809 10:126795126-126795148 CACAACTAACATTCAAATTTTGG + Intergenic
1081583621 11:44369412-44369434 CTCCCCTACCAGTCAAAGGATGG - Intergenic
1088394358 11:109350238-109350260 CTCAACTACAATTCAAATGCCGG - Intergenic
1088972654 11:114787309-114787331 CTCACTTAAGAATCAAGTGATGG - Intergenic
1092522873 12:9291730-9291752 CTCAGCTCACTTTCAAATGGAGG + Intergenic
1092544415 12:9440167-9440189 CTCAGCTCACTTTCAAATGGAGG - Intergenic
1094508535 12:31081900-31081922 CTCAGCTCACTTTCAAATGGAGG + Intronic
1097803517 12:63940553-63940575 CTCAACTATCCTGCAAATGAAGG - Intronic
1097849649 12:64399115-64399137 CTAACCTATCTCTCAAATGAAGG - Intergenic
1100876881 12:98971605-98971627 CTCACCTAACATTCAAATGAAGG + Intronic
1102581851 12:113894142-113894164 CTCACCTACCATTCAGGGGAAGG - Intronic
1104031483 12:125068150-125068172 CTCTCCTAACTTTTAAATGCAGG - Intronic
1105977550 13:25485938-25485960 CTCAACAAAAATTTAAATGAGGG + Intronic
1106883946 13:34162442-34162464 CTGACCTAACATTTCAAAGAGGG - Intergenic
1113666603 13:112146115-112146137 CTCACCTCCCATTCAAATCAAGG - Intergenic
1115678966 14:35714835-35714857 CTGACCAAACTTTCAAATGGAGG - Intronic
1117445348 14:55798938-55798960 CTCACATAACAGTCAAATGCAGG + Intergenic
1120064129 14:80019842-80019864 ATCAGCTAACATTCACATGAAGG - Intergenic
1123424076 15:20155003-20155025 ATCACCTGCCATTCAAATCAGGG - Intergenic
1123533296 15:21161532-21161554 ATCACCTGCCATTCAAATCAGGG - Intergenic
1123798289 15:23795649-23795671 CTAAGCCCACATTCAAATGAAGG - Intergenic
1125256829 15:37774198-37774220 CTCTCCTAACATTTAATTGAAGG + Intergenic
1126492653 15:49256452-49256474 ATCAAATAACAATCAAATGATGG - Intronic
1126738199 15:51752085-51752107 CTCACCAAACATGCACAGGAAGG - Intronic
1127536871 15:59898341-59898363 TTGACCTAACCTTCAAATGTCGG - Intergenic
1129830611 15:78667472-78667494 CTCTCCTTCCATTCAACTGATGG - Intronic
1130374694 15:83318361-83318383 CACACCCAACATACATATGATGG - Intergenic
1131705842 15:94994925-94994947 CTCACCTGACATTCAAAAGCTGG - Intergenic
1137689455 16:50411643-50411665 CACACCCAACATTGAAATCAAGG - Intergenic
1138147833 16:54628024-54628046 ATCCCCTAGCATTCAAAGGATGG - Intergenic
1138318384 16:56089978-56090000 CTCACAGAACATCCAACTGAGGG - Intergenic
1144112917 17:12055488-12055510 CTAACCTATCATGAAAATGAAGG + Intronic
1145786827 17:27599037-27599059 CTCACGTAACAATGAAATCACGG - Intronic
1146072375 17:29694708-29694730 CTCACCTAACTTTAAAATTCTGG + Intronic
1149414415 17:56444288-56444310 TTCACCTAACATTCAACTGTAGG + Intronic
1150506596 17:65704726-65704748 CACACCTCACATTCACATGACGG + Intronic
1150769154 17:68026570-68026592 CTCACCTCACAGTGAAATTATGG + Intergenic
1152902501 17:82951304-82951326 CTCACCTCACACTCATATTACGG + Intronic
1153474232 18:5480431-5480453 CTCTCCTTATATGCAAATGAGGG - Intronic
1155706227 18:28817269-28817291 ATCACCTAAAATGCAAATGATGG + Intergenic
1156187464 18:34679575-34679597 CTCACCTAAAATTCAATGAAGGG - Exonic
1157211278 18:45744391-45744413 CTAAACTAAAATTTAAATGAAGG - Intronic
1157699943 18:49755933-49755955 CTGAGCTTACATTCAAATGGAGG - Intergenic
1158995972 18:62920085-62920107 CCCACCTAACCTTCTGATGAAGG + Exonic
928650523 2:33399514-33399536 TTCCCCTAACATTCATATGTGGG + Intergenic
929620807 2:43351977-43351999 TTAACCCAACATACAAATGAAGG + Intronic
932596705 2:73098159-73098181 CTCACCTATCTATAAAATGATGG + Intronic
934459172 2:94202039-94202061 ATCACCTGCCATTCAAATCAGGG + Intergenic
942235496 2:173899966-173899988 CTTCCCTAACATTGAAATAAAGG + Intergenic
942493359 2:176511945-176511967 CCCACTTAACATTGACATGAAGG - Intergenic
943059996 2:183032631-183032653 TTCACATAACACTGAAATGATGG - Intronic
943562077 2:189476230-189476252 CCCCCCTAAAATTCAAATGTTGG + Intergenic
948223697 2:236292588-236292610 CTAACCTTACACTTAAATGAGGG - Intergenic
1170586148 20:17735557-17735579 CTCACGTGACAATCAAAGGAGGG - Intronic
1172956224 20:38761352-38761374 GTCACCTAACTTTCAAGTGGTGG - Intronic
1173537209 20:43824652-43824674 CTCAACTAACTTTCAAATAGAGG + Intergenic
1180792844 22:18586194-18586216 CTCAATTAAAAGTCAAATGAGGG + Intergenic
1181228892 22:21409125-21409147 CTCAATTAAAAGTCAAATGAGGG - Intergenic
1181249759 22:21525740-21525762 CTCAATTAAAAGTCAAATGAGGG + Intergenic
1181357038 22:22304450-22304472 ATCACCTGCCATTCAAATCAGGG - Intergenic
950687638 3:14629937-14629959 GTCAGCTTACATTCAAGTGACGG - Intergenic
952505174 3:34000636-34000658 CCCATCAAACAGTCAAATGAGGG + Intergenic
954905501 3:54059048-54059070 CTCAGCTAACATTTGAAGGATGG - Intergenic
955432752 3:58866074-58866096 TGCACCTAACATTTTAATGAAGG + Intronic
955596602 3:60597189-60597211 CTCACCCAACATTAACATGGGGG + Intronic
955820052 3:62887267-62887289 ATCACCTAAGATGCAGATGATGG + Intergenic
957923292 3:86775138-86775160 GTGACCTAAAATTCTAATGAAGG + Intergenic
957932929 3:86905830-86905852 CCTACCTAAAATTCAAATGAAGG + Intergenic
960402299 3:117216252-117216274 CTAAATTGACATTCAAATGAAGG - Intergenic
962011408 3:131394803-131394825 CTACCATTACATTCAAATGATGG + Intergenic
962260719 3:133902064-133902086 CTCATCTAAAATTCAAATATGGG - Intergenic
963472454 3:145758619-145758641 ATCACATTACATACAAATGAGGG + Intergenic
970422544 4:15918911-15918933 CTCACCTAATGTTCACAAGAGGG - Intergenic
971924064 4:32983745-32983767 CTTACATAAAATTCAAATGTTGG - Intergenic
974367519 4:60971720-60971742 TTCAACAATCATTCAAATGAGGG - Intergenic
975596744 4:76054239-76054261 CTCTTCTAACATTCACATGCAGG - Intronic
976064154 4:81164620-81164642 CACACCTAACACTCTAATGGTGG - Intronic
977660095 4:99575315-99575337 CTCATTTACAATTCAAATGAAGG - Intronic
981020868 4:140026757-140026779 CTCACCTAACATTAAAATATGGG + Intronic
981327170 4:143463218-143463240 GACACCTGAAATTCAAATGATGG + Intronic
981824389 4:148923567-148923589 GTCAACTAACATTCACATGTAGG - Intergenic
983130513 4:164013030-164013052 CTCACCAAACACACAAAAGAAGG + Intronic
985519439 5:366136-366158 CACACCTAACATTCAGATGTTGG + Intronic
988289083 5:29261512-29261534 CTGAGCTAAAACTCAAATGAAGG - Intergenic
990853906 5:60241011-60241033 CTCACCAAACAATCTAATTAAGG + Intronic
994342291 5:98644866-98644888 CTGACCCACCATTAAAATGAAGG - Intergenic
995337111 5:111012035-111012057 CTCACCAAACAAACAAATTAAGG + Intergenic
995901261 5:117069582-117069604 ATCAGCTAACACTAAAATGAAGG - Intergenic
998748387 5:145288578-145288600 CACACCTAACATACAGATGCTGG - Intergenic
1000654559 5:163860505-163860527 CTCACCTAGCATTCCAATCTTGG + Intergenic
1003446682 6:6191349-6191371 CTAACATTACATTCAAAAGAAGG - Intronic
1003637438 6:7845631-7845653 CTCACCTATCATTCAAAATGAGG - Intronic
1005399461 6:25416662-25416684 CTCACCTTACATTAAAAGTAAGG - Intronic
1006164242 6:32055291-32055313 CTCACCTAAAATTGAATGGATGG - Intronic
1009869599 6:69436989-69437011 CTAAGGTAACATTCAAATCAAGG - Intergenic
1013241489 6:108250251-108250273 CTCATGTAACATTGAAATAATGG - Intronic
1016161086 6:140880209-140880231 CTGAACTAGAATTCAAATGAAGG + Intergenic
1020842547 7:13237803-13237825 CTCCCCTCACATTCTAATGAAGG + Intergenic
1021203112 7:17747990-17748012 TTCATTTAACCTTCAAATGAAGG - Intergenic
1021884719 7:25127692-25127714 CTCACCAAACAAACTAATGAAGG - Intergenic
1023114493 7:36848522-36848544 CGCATCTAACTTGCAAATGAGGG + Intergenic
1023617885 7:42039220-42039242 TTCACCTAAAATTCATATGTTGG + Intronic
1024188554 7:46981188-46981210 GTCACCAAAGGTTCAAATGAGGG + Intergenic
1025755973 7:64341630-64341652 CTCCCTTAACATGAAAATGATGG - Intronic
1030007809 7:105135740-105135762 ATCACCTCACATTTAAATGCAGG + Intronic
1030819540 7:114079130-114079152 CAAACCTCACATTCTAATGAAGG - Intergenic
1031222687 7:118991080-118991102 TAAACATAACATTCAAATGAGGG - Intergenic
1031356554 7:120793951-120793973 CTCTCCTAACATTAGAATTATGG + Intronic
1034872491 7:154696451-154696473 ATAACCTATCATCCAAATGAGGG - Intronic
1038001986 8:23399749-23399771 CTCCCCAAACTTTAAAATGAAGG + Intronic
1043314871 8:78908069-78908091 CTCACCCTACATTCAAACTACGG - Intergenic
1043888367 8:85628812-85628834 CTCACTTAACAGTCCAATGAAGG + Intergenic
1045402221 8:101830712-101830734 CTCTCCAAAAATGCAAATGAGGG - Intronic
1046144630 8:110142061-110142083 CTCACCGAAATTTCAAAGGAGGG - Intergenic
1048698589 8:137057606-137057628 CTCAGTTAAGAATCAAATGATGG - Intergenic
1050243506 9:3662113-3662135 CACAGCTAGCATTCAAATGCAGG - Intergenic
1050837886 9:10107071-10107093 CTAACTTAAAATACAAATGAGGG + Intronic
1052204204 9:25818927-25818949 ATGACCTAAAAGTCAAATGAAGG - Intergenic
1053689668 9:40577826-40577848 ATCACCTGCCATTCAAATCAGGG + Intergenic
1054300915 9:63378765-63378787 ATCACCTGCCATTCAAATCAGGG + Intergenic
1054724280 9:68634764-68634786 CTCACATCACAGTCCAATGAGGG + Intergenic
1055638904 9:78304156-78304178 CTCACCTAACAGATAAATGCAGG + Intronic
1059082764 9:111267257-111267279 CTCAGTTATCATACAAATGAAGG + Intergenic
1059475610 9:114544768-114544790 ATAAACTATCATTCAAATGAGGG - Intergenic
1190472488 X:50796832-50796854 CTCAGCTAGCATTAAAATCATGG - Intronic
1194777621 X:97984414-97984436 CTCACCTAACATGTAAATCAAGG - Intergenic
1197217282 X:123878565-123878587 TTCAGAAAACATTCAAATGATGG + Intronic
1199192658 X:144989494-144989516 CCCACTTATCAATCAAATGAAGG + Intergenic