ID: 1100878803

View in Genome Browser
Species Human (GRCh38)
Location 12:98993455-98993477
Sequence CACTGTGCCCAGCCTGTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1490
Summary {0: 1, 1: 7, 2: 45, 3: 256, 4: 1181}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100878797_1100878803 9 Left 1100878797 12:98993423-98993445 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1100878803 12:98993455-98993477 CACTGTGCCCAGCCTGTAGTTGG 0: 1
1: 7
2: 45
3: 256
4: 1181
1100878791_1100878803 22 Left 1100878791 12:98993410-98993432 CCGCCCGCCTTGGCCTCCCAAAG 0: 17665
1: 104567
2: 162703
3: 161462
4: 107266
Right 1100878803 12:98993455-98993477 CACTGTGCCCAGCCTGTAGTTGG 0: 1
1: 7
2: 45
3: 256
4: 1181
1100878793_1100878803 18 Left 1100878793 12:98993414-98993436 CCGCCTTGGCCTCCCAAAGTGCT 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
Right 1100878803 12:98993455-98993477 CACTGTGCCCAGCCTGTAGTTGG 0: 1
1: 7
2: 45
3: 256
4: 1181
1100878795_1100878803 15 Left 1100878795 12:98993417-98993439 CCTTGGCCTCCCAAAGTGCTGGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
Right 1100878803 12:98993455-98993477 CACTGTGCCCAGCCTGTAGTTGG 0: 1
1: 7
2: 45
3: 256
4: 1181
1100878800_1100878803 5 Left 1100878800 12:98993427-98993449 CCAAAGTGCTGGGATTACAGGCC 0: 4832
1: 222861
2: 273207
3: 187102
4: 182881
Right 1100878803 12:98993455-98993477 CACTGTGCCCAGCCTGTAGTTGG 0: 1
1: 7
2: 45
3: 256
4: 1181
1100878792_1100878803 19 Left 1100878792 12:98993413-98993435 CCCGCCTTGGCCTCCCAAAGTGC 0: 56485
1: 171609
2: 226607
3: 184242
4: 115036
Right 1100878803 12:98993455-98993477 CACTGTGCCCAGCCTGTAGTTGG 0: 1
1: 7
2: 45
3: 256
4: 1181
1100878799_1100878803 6 Left 1100878799 12:98993426-98993448 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1100878803 12:98993455-98993477 CACTGTGCCCAGCCTGTAGTTGG 0: 1
1: 7
2: 45
3: 256
4: 1181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100878803 Original CRISPR CACTGTGCCCAGCCTGTAGT TGG Intronic
900011236 1:111072-111094 CACTGTGTCCAGCCAGTGGTGGG - Intergenic
900027340 1:287636-287658 CACTGTGTCCAGCCAGTGGTGGG - Intergenic
900041295 1:467080-467102 CACTGCGTCCAGCCAGTGGTGGG - Intergenic
900062729 1:702055-702077 CACTGCGTCCAGCCAGTGGTGGG - Intergenic
900874528 1:5331955-5331977 CACCGTGCCCGGCCTGTTGTGGG + Intergenic
901027065 1:6284286-6284308 CACTGCGCCCGGTCTGTAGCTGG - Intronic
901260234 1:7865647-7865669 CACCATGCTCAGCCTGTATTTGG - Intergenic
901356570 1:8654912-8654934 CACTGTGCCCAGCCTAAAAAAGG + Intronic
901448907 1:9324469-9324491 CTCTGTGCCCAGCCTCTGGAGGG + Intronic
901471179 1:9457507-9457529 CACTGTGCCCGGTCGGTTGTAGG - Intergenic
901524661 1:9812556-9812578 CACCGTGCCCAGCCAGCAATAGG - Intronic
901578221 1:10218164-10218186 CACTGAAGCCAGCCTGTAGTGGG - Intronic
901856245 1:12045985-12046007 CACTGTGCCCGGCCAGTAAGAGG + Intergenic
902244176 1:15108546-15108568 CAGTGTGCCCAGCACGTAGTGGG + Intronic
902411940 1:16216968-16216990 CACTGTGCCTGGCATGTTGTAGG - Intergenic
902472400 1:16657943-16657965 CACTGCACCCAGCCAGAAGTGGG - Intergenic
902486404 1:16749503-16749525 CACTGCACCCAGCCAGAAGTGGG + Intronic
902523548 1:17037846-17037868 CACTGTGCCTGGCCTGAAGCAGG - Intronic
903025668 1:20428435-20428457 CACTGGGCCCAGCCTGGAAGGGG - Intergenic
903107778 1:21098923-21098945 CACTGTGCCTAGCCTCAAATGGG + Intronic
903268961 1:22176028-22176050 CACTGTGCCCGGCACATAGTAGG + Intergenic
903603288 1:24557167-24557189 CACGGTGCCCAGCATGCAGTAGG + Intronic
903696211 1:25209271-25209293 CACTGTGCCCGGCCCCTAGAAGG - Intergenic
903766392 1:25737564-25737586 CTCTGTGCCCAGCCTGAGGATGG + Intronic
903819084 1:26087417-26087439 AACTGTGCCTGGCATGTAGTAGG - Intergenic
903988484 1:27247343-27247365 CACTGTGCCCAGCCTTGTGCAGG + Intronic
904010870 1:27389627-27389649 CACTGTGCCCAGCCCAAAATGGG - Intergenic
904029280 1:27523928-27523950 CCCTGTGCCCAGGCTGGAGGTGG - Intergenic
904142423 1:28364090-28364112 CACTGCGCCCAGCCTCTGGACGG + Intergenic
904163485 1:28537859-28537881 CCCTGTGCCCAGCTGGTAGTTGG - Exonic
904193908 1:28770309-28770331 CACTGTGACCAGCCTAAAATGGG - Intergenic
904194145 1:28772082-28772104 CACCGTGCCCAGCCTGAGGCTGG + Intergenic
904653478 1:32024613-32024635 CCCTGTGCCCAGCCAGGCGTGGG + Intronic
904711109 1:32431030-32431052 CACTGTGCCCAGCCAAGACTAGG - Intergenic
904728065 1:32565359-32565381 CACTGTGCCCAGCCTTAAAACGG - Intronic
904935897 1:34129361-34129383 CACTGCGCCCAGCCTATCATGGG - Intronic
905004349 1:34698111-34698133 GAGTGTGCCCAGCCAGTGGTGGG - Intergenic
905125108 1:35710665-35710687 CACTGTGCCCAGCCTGCATTAGG + Intergenic
905217224 1:36417366-36417388 CACTGTGCCCGGCCTATGCTGGG + Intronic
905554018 1:38867700-38867722 CAATGTGCTCAGCGTATAGTTGG - Intronic
905664065 1:39751646-39751668 CACTGCGCCCAGCCTCTAGCAGG + Intronic
905676358 1:39828169-39828191 CACCATGCCCAGCCTGAGGTGGG - Intergenic
905685390 1:39903754-39903776 CACTGTGCCCTGCCTAAGGTTGG - Intergenic
905870474 1:41401164-41401186 CACTGCACCCAACCTGTAGCAGG + Intergenic
905989747 1:42325970-42325992 CACAGTGCCCAGCCTGATTTTGG - Intronic
906223489 1:44102243-44102265 CACCGTGCCCGGCCTAAAGTGGG - Intergenic
906728995 1:48064977-48064999 CACTGTGCCTAGCATGTAGTAGG - Intergenic
906937895 1:50230317-50230339 AACTGGGCCCAGTCTGTAGTAGG - Intergenic
907014355 1:50997377-50997399 CACTGCGCCCGGCCTGTAAATGG - Intergenic
907019010 1:51046836-51046858 CACTGCACCCAGCCTTGAGTTGG + Intergenic
907039363 1:51244660-51244682 CACCGCGCCCAGCCTGAATTTGG + Intronic
907083557 1:51647824-51647846 CACTGTGCCTAGCCAAAAGTTGG - Intronic
907187487 1:52621363-52621385 CACTGTGCCCAGCCTTGAAATGG - Intergenic
907233212 1:53020585-53020607 CACTGTGCCCAGCCTGAAAATGG + Intronic
907620020 1:55967980-55968002 CACTGTGCCCAGCCAATAACTGG + Intergenic
908012037 1:59787789-59787811 CTCTGTGCAGGGCCTGTAGTAGG - Intergenic
908025157 1:59942850-59942872 CTCTGTGCCCAGCACATAGTAGG - Intergenic
908173378 1:61529666-61529688 CACTGTGCCCAGACTGTTTGTGG + Intergenic
908493284 1:64668038-64668060 CACTGTGCCCGGCCTGAACCTGG - Intronic
908504616 1:64784093-64784115 CACTGTGCCCAGCCAGTAGAAGG - Intronic
908646814 1:66287389-66287411 CACAGTGCCCAACATTTAGTAGG + Intronic
909225414 1:73014597-73014619 CACTGTGCCCAGCCTCCCCTAGG - Intergenic
909436898 1:75652501-75652523 CACTGTGCCTGGCTTGTAGCTGG - Intergenic
909502824 1:76354236-76354258 CACAGGGCCCAGCCTGGAGCTGG - Intronic
910083916 1:83374895-83374917 CACTGTGTCCAGTATGCAGTTGG - Intergenic
910374368 1:86552762-86552784 TACTGTGTCCAGGTTGTAGTAGG + Intronic
910719215 1:90267130-90267152 CACAGTGCCAAGCTTGTAATAGG + Intergenic
910886049 1:91964481-91964503 CACTGTGCCCAGCCAGAATATGG + Intronic
911202558 1:95060426-95060448 CACTGTGCCCAGCCAGATTTTGG - Intronic
911288357 1:96026102-96026124 CACTGCGCCTAGCCTATAGATGG - Intergenic
911330668 1:96522298-96522320 GACAGTGCCTAGCCTGTAGAGGG + Intergenic
911477074 1:98386882-98386904 AAAAGTGCCCAGCCTGTAGGAGG - Intergenic
911731736 1:101298631-101298653 CACTGTGCCTTGCATGCAGTAGG + Intergenic
912788033 1:112623390-112623412 CACTGGGCCCGGCCTGTCCTAGG - Intronic
912809899 1:112786139-112786161 CACTGTGCCCAGCCAAGACTGGG + Intergenic
912824447 1:112893016-112893038 TACCGTGCCCAGCCTGTGTTAGG - Intergenic
913010757 1:114681304-114681326 CACTGTGCCCAGCCTGGAAACGG - Intronic
914232325 1:145774956-145774978 CACTGTGCCCAGCCTGTTTTTGG - Intronic
914751374 1:150537378-150537400 CACTGTGCCCAGCCTCCACAGGG - Intergenic
915176953 1:154023764-154023786 CACTGTGCCCGGCTTGAAATGGG + Intronic
915434201 1:155891199-155891221 CACCGTGCCCAGCTGATAGTGGG - Intergenic
915872666 1:159577824-159577846 CACCGTGCCCAGCCTGTTTAAGG - Intergenic
915938539 1:160103391-160103413 AACGGTGCCCAGCATGAAGTAGG - Intergenic
916017772 1:160765187-160765209 CACTGGGCCCAGCCTCCAGTGGG + Intergenic
916100798 1:161391532-161391554 CACTGTGCCTGGCCCGAAGTGGG + Intergenic
916217341 1:162408817-162408839 CACTGCACCCAGCCTATATTGGG - Intronic
916234733 1:162575355-162575377 CACTGTGCCCAGCCTACAAAAGG + Intronic
916607356 1:166356214-166356236 CACAGTTCCCAGCTTGTGGTAGG + Intergenic
916753412 1:167744393-167744415 CACTGTGCCCGGCCTTTTTTTGG - Intronic
917008446 1:170443348-170443370 CACAGTGTCTAGCATGTAGTAGG - Intergenic
917078804 1:171235756-171235778 CACAGTGCCTGGCATGTAGTAGG - Intergenic
917361517 1:174181623-174181645 CACCATGCCCAGCCTGTACAAGG + Intronic
917569247 1:176247208-176247230 CACTGTGCCATGCCTTTAGTAGG + Intergenic
917796459 1:178536498-178536520 CACTGTGCCCAGCCCCCAGGTGG - Intronic
917842937 1:178996846-178996868 CACTGCGCCCAGCCAGCACTAGG + Intergenic
917877956 1:179304240-179304262 CACCGTGCCCAGCCTGGTCTAGG + Intronic
918141829 1:181726252-181726274 AACAGTTCCCAGCATGTAGTAGG - Intronic
918272310 1:182913691-182913713 CACTGTGCCCCGCCTATCTTTGG - Intronic
918314210 1:183309286-183309308 CACTGTGCCCGGCCTTTGGAGGG + Intronic
918383699 1:183984118-183984140 CACTGTGTCCAGCCTTTCCTTGG - Intronic
918391374 1:184066692-184066714 CACTGTGCCCGGCTTGTAATAGG + Intronic
918561027 1:185867780-185867802 CACTGCGCTCAGCCTGTTTTGGG - Intronic
918649085 1:186937910-186937932 CACAGTGCCCAGAATATAGTAGG + Intronic
919088814 1:192953481-192953503 CACTGCTCCCAGCCTCAAGTTGG - Intergenic
919116106 1:193282628-193282650 CACTGCGCCCAGCCAGTACCTGG + Intergenic
919137628 1:193530654-193530676 CACTGTGCTCAGCCAGTAAGGGG + Intergenic
919161218 1:193833326-193833348 CACTGTGCCCGGCCTCCAGCAGG + Intergenic
919891239 1:201976676-201976698 CACTGTGCCCAGCCTGGTATCGG + Intergenic
919931268 1:202222812-202222834 CACTGCGCCCAGCCTGTGGATGG - Intronic
920357931 1:205389335-205389357 CACTGTGCCCAGCCTACATTTGG + Intronic
920677257 1:208046876-208046898 CACTTTGCTCAGTATGTAGTAGG + Intronic
920860843 1:209705177-209705199 CCCTGTCCACAGCCTGTAGCTGG - Intronic
920907459 1:210184963-210184985 CACTGTACTCAGCCTGAATTGGG + Intergenic
920950763 1:210569934-210569956 CCCTATGCCTAGCCTATAGTTGG + Intronic
921570206 1:216768777-216768799 CACTGTGCCCAGCCTCTGTGAGG + Intronic
921853266 1:219953306-219953328 CACCGTGCCCGGCCTGAAGGTGG - Intronic
922173877 1:223179662-223179684 CACTGTGCCCAGCCTTTGTCAGG + Intergenic
922179856 1:223225156-223225178 CACTGTGCCCGGCCGGAACTTGG + Intronic
922234836 1:223714763-223714785 CATTGTGCCCAGCATATAGTAGG - Intronic
922242307 1:223763784-223763806 CACTGTGCCCAGCCTAGATACGG - Intronic
922259677 1:223927075-223927097 CACTGCGTCCAGCCAGTGGTGGG - Intergenic
922313603 1:224420884-224420906 CACCGTGCCCAGCCAGAAGTTGG + Intronic
922367418 1:224878896-224878918 CACTGTGCCCTGCCAATCGTTGG - Intergenic
922431827 1:225562282-225562304 CACTGCGCCCGGCCTGTGCTTGG - Intronic
922797304 1:228346763-228346785 ATCTGTGCCCTGCCTGTGGTGGG + Intronic
923057038 1:230434496-230434518 CACTGCGCCCGGCCAGTAGTGGG + Intergenic
923406248 1:233664116-233664138 CACCGTGCCCGGCCTTCAGTTGG + Intronic
923442541 1:234034809-234034831 CACTGTGCCCAGCCCATAGATGG + Intronic
923750982 1:236745873-236745895 CACTGTGCCCAGCCAGAACGTGG - Intronic
924340842 1:243029631-243029653 CACTGCGTCCAGCCAGTGGTGGG - Intergenic
924429695 1:243986402-243986424 CACTGTGCCCAACCTCTACCAGG + Intergenic
924614522 1:245601641-245601663 CACAGTGCCCAGCACATAGTAGG + Intronic
924785140 1:247188931-247188953 CACCATGCCCAGCCTCAAGTAGG - Intergenic
1062816125 10:501773-501795 CACAGTGCCTGGCCTGTGGTCGG - Intronic
1063983837 10:11479861-11479883 CACTGTGCCCAGCCTCATGGAGG + Intronic
1064057490 10:12110008-12110030 CACCACGCCCAGCCTGTATTGGG - Intronic
1064072587 10:12243498-12243520 CTCTGTGCCCAGCCTCTACTTGG - Intronic
1064195655 10:13242138-13242160 CACTGTGCCCCGCCTATACCTGG - Intergenic
1064305239 10:14159759-14159781 CACTGTGCCCAGCCAGCATTTGG - Intronic
1064337316 10:14455412-14455434 CACTGTGCCCAGCCTATATACGG + Intronic
1064385847 10:14890651-14890673 CACTGTGCCCAGCCAGATGCAGG + Intronic
1064412381 10:15118247-15118269 CACTGTGCCCAGCCCGTGAAAGG - Intronic
1064559452 10:16581894-16581916 CACTGGGGCCTGCCTGAAGTGGG + Intergenic
1064731854 10:18339230-18339252 CACTGTGCCCAGCCTGTTGGTGG - Intronic
1064759401 10:18602656-18602678 CACCGCGCCCAGCCTATGGTGGG + Intronic
1064799362 10:19051634-19051656 CACCGCGCCCAGCCTATATTCGG - Intronic
1064910935 10:20401089-20401111 CACCATGCCCAGCCTGTTATAGG - Intergenic
1065095998 10:22281520-22281542 CACTGCGCCCGGCCTGTAGAAGG - Intergenic
1065183405 10:23149230-23149252 CACTGGGCCCAGCCAGAAGTGGG - Intergenic
1065354199 10:24823399-24823421 CACTGTGCCCAGCCATTGATTGG - Intergenic
1065457532 10:25922686-25922708 CACTGCACCCAGCCTCCAGTAGG + Intergenic
1065711123 10:28519149-28519171 CACTGCGCCCAGCCAGTAAGAGG + Intergenic
1065836761 10:29665505-29665527 CACTGTGCCTGGCCAGCAGTAGG - Intronic
1065841393 10:29704089-29704111 CACTGTGCCTAGCCTCAGGTGGG + Intronic
1065873779 10:29979647-29979669 CCCTGTGCCCAGCCTCAAGGTGG - Intergenic
1066153208 10:32647216-32647238 CACTGTTCCCAGCCTATAAAAGG - Intronic
1066299996 10:34088121-34088143 CACCGTGCCCAGCCTGGTGCTGG - Intergenic
1067075515 10:43178332-43178354 CACCGTGCCTGGCCTGTATTAGG - Intronic
1067322505 10:45235480-45235502 CACTGCGCCCGGCCTGGTGTAGG - Intergenic
1067568070 10:47352283-47352305 CACTGGGCCCTGCCTGCAGAGGG - Intronic
1068061023 10:52067914-52067936 CACTGCGCCCGGCCTCAAGTAGG - Intronic
1068140115 10:52995608-52995630 CACTGTGCCCAGCCCCTTCTAGG - Intergenic
1068697436 10:59982623-59982645 CACTGCACCCAGCATGAAGTAGG + Intergenic
1068727276 10:60317410-60317432 CACTGTGCCCGGCCCCTACTTGG + Intronic
1068751562 10:60599217-60599239 CACTGAGCCCAGCCTGTGTTTGG + Intronic
1068778315 10:60891634-60891656 CACTGTGCCCAGCCTAGAGGAGG + Intronic
1068820123 10:61365805-61365827 CACTGTGCCCAGACAGTCCTAGG + Intergenic
1068863542 10:61870782-61870804 CACAGTGCTCAGCACGTAGTAGG - Intergenic
1069455795 10:68552813-68552835 CACTGTGCCCAGCCAGCAATAGG - Intergenic
1069502739 10:68968439-68968461 CACTGTGCCTGGCCTGGAATTGG + Intronic
1069525052 10:69162276-69162298 CACTGTGCCCAGCCTCAAAATGG + Intronic
1069568706 10:69480984-69481006 CACTGCGCCCGGCCTGGACTTGG + Intronic
1070243690 10:74709701-74709723 CACTGTGCCCAGCCTGTGGCTGG - Intergenic
1070315841 10:75311544-75311566 CACTGTGCCCAGCCTGTTTCAGG - Intergenic
1070611363 10:77935142-77935164 CACCGTGCCCAGCCTTAAATGGG + Intergenic
1070793251 10:79202313-79202335 CACTGGGTCCAGCCTATAATGGG - Intronic
1070885812 10:79896983-79897005 CACTGCGCCCAGCCTTTCCTTGG + Intergenic
1071194022 10:83136187-83136209 CACTGTGCCCAGCCTATTTGTGG - Intergenic
1071310519 10:84339290-84339312 CACTGTGCCCAGCCTCTCCAGGG + Intronic
1071330989 10:84560361-84560383 CACTGTGCCCGGCCTGATTTTGG + Intergenic
1071562728 10:86656216-86656238 CACTGTGCCCAGGGTATAGTGGG - Exonic
1071940039 10:90580030-90580052 CAGAGTGCCCAACCTGTAGGTGG - Intergenic
1071977224 10:90967278-90967300 CACTACACCCAGCCTTTAGTTGG - Intergenic
1072142922 10:92605855-92605877 CACTGTGCCCAGCCACTAACAGG - Intronic
1072218942 10:93311319-93311341 CACTGCGCCCAGCCAAAAGTGGG - Intronic
1072351545 10:94562112-94562134 CACTGCACCCAGCCCATAGTTGG - Intronic
1072351716 10:94563776-94563798 CAGTGTGCCCAGCTTTTTGTTGG + Intronic
1072588171 10:96800766-96800788 CACTGCGCCCAGCCGGTCATAGG - Intergenic
1072590546 10:96825125-96825147 CACTGTGCCCAGCCAATATGCGG - Intergenic
1072937395 10:99726597-99726619 CACTGCGCCCGGCCCCTAGTTGG - Intronic
1073112489 10:101070872-101070894 CACTGTGCCTGGCCTGGATTTGG + Intergenic
1073157867 10:101362243-101362265 CACCGTGCCCGGCCTTGAGTTGG + Intronic
1073235891 10:102015676-102015698 CACTGCACCCAGCCTGTTTTAGG + Intronic
1073336768 10:102715335-102715357 CACTGTGCCCAGCCTCTGGCCGG + Intronic
1073373734 10:103014736-103014758 CACTGCACCCAGCCTGTAAATGG - Intronic
1073375975 10:103034994-103035016 CACCATGCCCAGCCAATAGTAGG - Intronic
1074182003 10:111073889-111073911 CATTGTGCCTAGCATGTGGTTGG + Intergenic
1075216331 10:120539421-120539443 CACTGTGCCCAGCACACAGTGGG + Intronic
1075431461 10:122385602-122385624 CACTGTGCCCAGCCTATTTCTGG + Intronic
1075694490 10:124423576-124423598 CACCGTGCCCAGCCCCAAGTGGG - Intergenic
1075864979 10:125710659-125710681 CACTGCGCCCGGCCAGTATTTGG - Intergenic
1075995187 10:126871375-126871397 CACAGTGCCTGGCCTGAAGTGGG - Intergenic
1076049051 10:127318208-127318230 CACTCTGCCCAGCCCTTAGCAGG - Intronic
1076378408 10:130008523-130008545 CACTGTACCGATCCTGTAGGCGG - Intergenic
1076967568 11:103309-103331 CACTGCGTCCAGCCAGTGGTGGG - Intergenic
1077095849 11:798679-798701 CACTGCGCCCAGCCCCAAGTGGG - Exonic
1077254797 11:1575629-1575651 CACTGCACCCAGCCAGTAGATGG + Intergenic
1077526476 11:3068816-3068838 CACTGTGCCCAGCCTCCGCTGGG - Intergenic
1077593192 11:3508785-3508807 CACCGTGCCCAGCCTGGATGAGG - Intergenic
1077606007 11:3612958-3612980 CACTGCGCCCAGCCTGGGTTTGG + Intergenic
1077666035 11:4110477-4110499 CACCATGCCCAGCCTGTTATAGG - Intronic
1077858207 11:6150636-6150658 CACTGTGCCCAACCTGTAAAAGG + Intergenic
1078000484 11:7490752-7490774 CACAGGGCCCATCCAGTAGTGGG - Intronic
1078151764 11:8765747-8765769 CACTGTGCCTGGCCTTAAGTAGG - Intronic
1078234571 11:9472215-9472237 CATTGTTCCCAGCCTGTTTTTGG + Intronic
1078347435 11:10563235-10563257 CACTGTGCCCGGCCTGAACTCGG + Intronic
1078380696 11:10837515-10837537 CACTGTGCCCAGCCTGAAATGGG + Intronic
1078399449 11:11011101-11011123 CTCTGTGCCCAGCCTGGAGAGGG + Intergenic
1078438070 11:11341831-11341853 CACTGTGCCCAGCCTGATCAAGG - Intronic
1078521730 11:12069126-12069148 CACTGTGCCCAGCTGGAAGAGGG - Intergenic
1078539714 11:12203582-12203604 CCCTTTGCCCAGTCTTTAGTGGG + Intronic
1078575477 11:12498322-12498344 CACTGTGCCCAGCCTAGAACAGG + Intronic
1078691388 11:13583679-13583701 CACTGTGCCCGGCCTTGATTTGG - Intergenic
1078892269 11:15567921-15567943 CACTGTGCCTGGCCTGTCATGGG + Intergenic
1079161399 11:17998121-17998143 CTCTGTGCCCAGCCTGAATGAGG - Intronic
1079389803 11:20012385-20012407 CACTGTGCCCGGCCATGAGTGGG - Intronic
1080070349 11:28076644-28076666 CACTGTGCCCGGCCTGGTGGCGG - Intronic
1080499394 11:32854265-32854287 CACTGCGCCCAGCCTGACTTTGG - Exonic
1080510461 11:32964575-32964597 CACCGTGCCTGGCCTATAGTAGG - Intronic
1080640977 11:34158124-34158146 CACTGCGCCCAGCCTCTAAAAGG - Intronic
1081046009 11:38273752-38273774 CACAGCGCCCGGCCAGTAGTTGG + Intergenic
1081535753 11:43995134-43995156 CACCGTGCCCAGCATGCAGTAGG - Intergenic
1081828570 11:46084541-46084563 CACAGTGCTGAGCATGTAGTGGG - Intronic
1081883832 11:46477621-46477643 CACTGTGCCCAGCCTCTTTGAGG + Intronic
1081923132 11:46798284-46798306 CACTGTGCCCAGCCTGTGACTGG - Intronic
1082045509 11:47722877-47722899 CACAGTGCCCAGCCTGAAAATGG + Intronic
1082062828 11:47875186-47875208 CACTGTGCCCAGTCTGGTATTGG + Intergenic
1082813861 11:57495536-57495558 CACTGTGCCCAGCCTCCCATGGG - Intronic
1083230948 11:61318908-61318930 CACTGAGCCTAGCCTAAAGTTGG - Intronic
1083250381 11:61463076-61463098 CACTGTGCCCAGCCTGAGACTGG + Intronic
1083346594 11:61997693-61997715 CACTGTGCCCAGCCTTTTTATGG - Intergenic
1083388458 11:62330409-62330431 CACTGTGCCCGGCCTATCATTGG - Intergenic
1083671438 11:64302096-64302118 GACAGTGCCCAGCACGTAGTAGG - Intronic
1083699630 11:64467378-64467400 CACTGTGCCCAGCCTTTTAGGGG - Intergenic
1084071552 11:66739738-66739760 CACTGCGCCCAGGCTATAATTGG - Intergenic
1084154533 11:67306309-67306331 CACTGTGCCCAGCAAGAAGGAGG - Intronic
1084249027 11:67881503-67881525 CACCGTGCCCAGCCTGGATGAGG - Intergenic
1084583120 11:70036893-70036915 CACCGTGCCTAGCCTGTATGTGG + Intergenic
1084729259 11:71062705-71062727 CACCATGCCCAGCCTATAATAGG - Intronic
1084823788 11:71713967-71713989 CACCGTGCCCAGCCTGGATGAGG + Intergenic
1084913041 11:72406756-72406778 CTCTGTGCCCAGCCTCTTGCTGG + Intronic
1084927146 11:72522870-72522892 CACTGTGCCCGGCCGAGAGTTGG + Intergenic
1085052235 11:73385736-73385758 CGCTGTGCCCAGCCAGTCATGGG - Intronic
1085065151 11:73488417-73488439 CACTGTGCCCAGCCTCATGTCGG + Intronic
1085127134 11:74009357-74009379 AGCTGTGCCCAGCCTATCGTGGG - Exonic
1085164024 11:74379633-74379655 CACCGCGCCCAGCCTGAATTTGG - Intronic
1085584581 11:77689873-77689895 CACTGTGCCCAGCCTGGAGAAGG - Intronic
1085656593 11:78320857-78320879 CACTGTGCCCAGTCTCAACTGGG + Intronic
1085678817 11:78551560-78551582 CACCGCGCCCAGCCTGGAGCAGG - Intronic
1085685152 11:78614991-78615013 CACCGTACCCAGCCTGTCTTTGG + Intergenic
1085795126 11:79532442-79532464 CACTGTGCCCAGTCTGGTGAAGG + Intergenic
1086388811 11:86339334-86339356 CACCGCGCCCAGCCTGTACCAGG + Intronic
1087903186 11:103665555-103665577 CACTATGCCCGGCCAGGAGTAGG + Intergenic
1088258240 11:107921048-107921070 CACTGCGCCCAGCCTTTTTTAGG + Intronic
1088289289 11:108219142-108219164 TACTGAGCCCAGCCAGTAGCAGG - Intronic
1088297682 11:108318395-108318417 CACTGTGCCCAGCCCTGAGTAGG - Intronic
1088890266 11:114038532-114038554 CACTGCACCCAGCCTAAAGTTGG - Intergenic
1089304056 11:117515904-117515926 CACTGTGCCCGGCCTGAGGGAGG + Intronic
1089874486 11:121706515-121706537 CACTGTGCCCAGCCTGTGAATGG + Intergenic
1089909907 11:122087350-122087372 CAAAGTGCCCAGCACGTAGTAGG + Intergenic
1090226353 11:125074405-125074427 CCCTGTGCCCATCCTGTACCAGG - Intronic
1090248304 11:125233510-125233532 CAGAGTGCCCAGCCTGTGCTGGG - Intronic
1090249876 11:125243908-125243930 CACCATGCCCAGCCTGTACCTGG + Intronic
1090295034 11:125579950-125579972 CACTGTGCCCACCCTGCACTCGG + Intronic
1090332918 11:125945250-125945272 AACAGTGCCCAGCATGCAGTAGG - Intergenic
1090823030 11:130362034-130362056 CACTGTGCCCGGCCAGTCCTAGG + Intergenic
1091298804 11:134491896-134491918 AACAGTGACCAGCATGTAGTGGG + Intergenic
1091422768 12:357539-357561 CACCGTGCCCAGCCTCCAGAAGG - Intronic
1091549254 12:1525478-1525500 CACCATGCCCAGCCAGTACTTGG + Intergenic
1092263086 12:6962814-6962836 CGCAGTGCCCAGCCTGTGCTGGG - Intergenic
1092419312 12:8316925-8316947 CACCGTGCCCAGCCTGGATGAGG - Intergenic
1092468122 12:8753032-8753054 CACTGCGCCCAGCCTAAGGTAGG + Intronic
1092569217 12:9703681-9703703 CACTGAGCTCAGCCTGTCCTAGG + Intergenic
1093319059 12:17689708-17689730 CTCTGTGCCCGGCCTAAAGTAGG + Intergenic
1093417928 12:18942010-18942032 CACTGTGCCCGGCCTCCATTAGG - Intergenic
1094141944 12:27190435-27190457 CTCTGTGCCTAGCCTGTAACTGG + Intergenic
1094201950 12:27803910-27803932 CACCGTGCCCAGCCTCAAATGGG - Intergenic
1094542353 12:31372942-31372964 CACTGTGTCCAGCCTTTTGTGGG + Intergenic
1094590331 12:31813668-31813690 CACTGTGCCCGGCCTGGAGAGGG - Intergenic
1095177809 12:39113341-39113363 CACTGTGCCCAGCCTGTACTTGG + Intergenic
1095685556 12:45029574-45029596 CACTGCGCCCAGCCTATTCTGGG - Intronic
1095825873 12:46530636-46530658 CACTGTGCCCACCCCGTGGAGGG + Intergenic
1095955988 12:47806386-47806408 CACCTCGCCCAGCCTGAAGTAGG - Intronic
1095963972 12:47854410-47854432 CACTGTGCCCAGCCAGGAAATGG + Intronic
1096265742 12:50121195-50121217 CACCGTGCCCAGCCGAAAGTTGG - Intergenic
1096385768 12:51194313-51194335 CACTGTGCCCAGCCTATAACAGG + Intronic
1096415456 12:51408523-51408545 CACTGCGCCCGGCCTATAATGGG + Intronic
1096646107 12:53036972-53036994 CACTGCACCCAGCCAGTAGGTGG + Intronic
1096659703 12:53116573-53116595 CACTGTGCTCAGCCTGCAGCTGG - Intronic
1096663318 12:53143918-53143940 CACTGTGCCCAGCCAAATGTTGG - Intergenic
1096728162 12:53582345-53582367 CACTATGCCAGGCCTATAGTAGG - Intronic
1096746905 12:53734919-53734941 CACCGTGCCCAGCCAGGAGTAGG + Intergenic
1097066063 12:56321516-56321538 CACTGTGCCTGGCCTATACTAGG + Intronic
1097080523 12:56427409-56427431 CACTGTGCCCAGCCTGTCCTAGG + Intronic
1097158031 12:57026890-57026912 CACTGTGCCCATCATGTAGATGG - Intronic
1097887985 12:64749225-64749247 CACTGTGCCCGGCCTTGATTTGG + Intronic
1098143112 12:67470835-67470857 CACTGTGCTCGGCCTGTTGCAGG - Intergenic
1098329858 12:69341879-69341901 CACTATGCCCAGCCAGTGTTTGG - Intergenic
1098445883 12:70565087-70565109 AACAGTGCCTAGCCTATAGTAGG + Intronic
1098794447 12:74870735-74870757 CATAGTGTCCAGCATGTAGTAGG - Intergenic
1099434217 12:82624103-82624125 CACCGCGCCCGGCCTGTAGTGGG + Intergenic
1099839728 12:87950392-87950414 CACTTTGCACAGCTTGTACTTGG - Intergenic
1100363458 12:93898409-93898431 CACCGCGCCCAGCCTGTTTTAGG - Intergenic
1100474836 12:94925699-94925721 CACTGTGCCCAGCCTGACTGAGG - Intronic
1100493826 12:95106248-95106270 CACTACGCCCAGCCTTTATTTGG + Intronic
1100515962 12:95328002-95328024 CACTGTGCCCAGCCTAGAGATGG - Intergenic
1100585107 12:95972212-95972234 CACTGCACCCAGCCTGTGATGGG + Intergenic
1100633874 12:96415544-96415566 CATTGTGCCCAGCCTAAAGTGGG + Intergenic
1100843387 12:98635290-98635312 CACTGTGCCCAGCCCCAAGGTGG + Intronic
1100878803 12:98993455-98993477 CACTGTGCCCAGCCTGTAGTTGG + Intronic
1101463854 12:104926793-104926815 CACTGTGCCCAGCCAACACTGGG - Intronic
1101637802 12:106560600-106560622 CCCAGTGCCTAGTCTGTAGTCGG + Intronic
1101899548 12:108781128-108781150 CACTGTGCCCAGCCCCTTCTAGG - Intergenic
1101949077 12:109160417-109160439 CCCTGTGCCCAGTCCATAGTGGG + Intronic
1102006161 12:109590501-109590523 CGCTGTGCCTAGCATGTTGTAGG + Intronic
1102496892 12:113325895-113325917 CCCTGAGCCTGGCCTGTAGTAGG + Intronic
1102779552 12:115552423-115552445 TTCTGTGCCCAGCCTGTACCAGG + Intergenic
1102886980 12:116529725-116529747 CACAGTGCCCAGCCTGAAGCAGG + Intergenic
1102909138 12:116699322-116699344 CACTGTGCCCGGCCTCTATTGGG - Intergenic
1103331248 12:120155504-120155526 CAGTGTGCTCAGCCTCCAGTGGG - Intronic
1103455577 12:121062777-121062799 CCCAGTGCCCAGCACGTAGTAGG - Intergenic
1103680870 12:122692587-122692609 CACTGTGCCCGGCCTGGATCTGG + Intergenic
1103783919 12:123417871-123417893 CACTGTGCCTGGCCTGTTCTGGG + Intronic
1103991902 12:124804967-124804989 AACTGTGCCCCGCATGTAATGGG - Intronic
1104453452 12:128890060-128890082 TACCGTGCCCAGCCTGAAATGGG + Intronic
1104508470 12:129354608-129354630 CACTGCGCCCAGTCTTTATTGGG + Intronic
1104928383 12:132325543-132325565 CACTGTGGCCAGCCAGTTGCTGG - Intronic
1105071587 12:133236849-133236871 CACCGTGCCCGGCCTTGAGTTGG + Intergenic
1105451903 13:20507628-20507650 CACTGTGCCCAGCCTGGGCGTGG - Intronic
1105472932 13:20707878-20707900 CCCTGTGCCCAGCCTGCAGGTGG - Intronic
1105473217 13:20710323-20710345 CACTGCGCCCAGCCTGTCTTTGG - Intronic
1105633223 13:22192795-22192817 CACTGCGCCCAGCCTCTCCTGGG - Intergenic
1105684896 13:22771074-22771096 CTCTGTGCTCAGCCCGCAGTTGG + Intergenic
1105814483 13:24021997-24022019 CACTGCGCCCGGCCAGTTGTTGG + Intronic
1106135465 13:26970110-26970132 CACTGTGCCCAGCCTTAACATGG - Intergenic
1106672517 13:31921910-31921932 CACTGTGCCCAACCTTTTTTGGG + Intergenic
1106715999 13:32388405-32388427 CACTATGCCCAGCGTGTCTTAGG + Intronic
1106720728 13:32432272-32432294 CACGGTGCCCAGCTTGTATTTGG + Intergenic
1107241385 13:38238981-38239003 CACTGCGCCCAGCCTGCACAAGG - Intergenic
1107958436 13:45539491-45539513 CACTGTGCCCAGCCAGGCCTGGG + Intronic
1108035388 13:46285379-46285401 CACCGTGCCCGGCCTGTTGGAGG - Intergenic
1108039040 13:46322279-46322301 CACTGTACCCAGCCGTTTGTGGG + Intergenic
1108297724 13:49041520-49041542 CACTGTGCCTAGCCAATAATAGG - Intronic
1108333060 13:49409784-49409806 CACTGTGCCCAGCCACATGTGGG - Intronic
1109072188 13:57784163-57784185 CACTGTGCCCAGCCTGGTCCTGG + Intergenic
1109158039 13:58935914-58935936 CTCTGTGCTCAGCCTGTGGCTGG + Intergenic
1109500446 13:63230189-63230211 CACTGTGCCCAGCCAGGGCTTGG - Intergenic
1110326100 13:74217438-74217460 CACCGCGCCCAGCCTGTAGTGGG - Intergenic
1110543830 13:76734786-76734808 CACTGTGCCCAGCCTGAAGTAGG + Intergenic
1110593863 13:77296129-77296151 CACTGTGCCCAGCCTATTTCTGG - Intronic
1110778890 13:79441567-79441589 CACTGTGCCCAGCCCAAAATGGG - Intergenic
1111277278 13:85966816-85966838 CTCTGTGCTCAGCCTGTGGCTGG + Intergenic
1111487807 13:88926921-88926943 CACTGTGGACAGCATGTTGTTGG - Intergenic
1112005888 13:95253385-95253407 CTATGTGCCCAGCATGTTGTTGG - Intronic
1112006086 13:95254895-95254917 CTATGTGCCCAGCATGTTGTAGG - Intronic
1112055100 13:95683636-95683658 CACAGTGCCCAGCCGGAACTGGG - Intronic
1112203453 13:97301216-97301238 CACAGTGCACAGCCTGTAGCAGG - Intronic
1112574572 13:100624036-100624058 CACCATGCCCAGCCTGGAGGTGG - Intronic
1112585828 13:100717863-100717885 CACTGTGCCCCGCACATAGTAGG - Intergenic
1112910124 13:104472213-104472235 CACCACGCCCAGCCTATAGTAGG + Intergenic
1113021605 13:105893683-105893705 CACTGTGCCCAGCCTCTATAGGG - Intergenic
1113464177 13:110502611-110502633 CACCTTGCCCAGCCTTTATTCGG + Intronic
1113588778 13:111483631-111483653 CAATGTGCCCAGCACATAGTAGG + Intergenic
1114718474 14:24854029-24854051 CACAGTGACTAGCATGTAGTAGG + Intronic
1114851188 14:26384105-26384127 CACCGCGCCCGGCCTGTAGTTGG + Intergenic
1115097650 14:29657576-29657598 CACTGCGCCCGGCCTGTAGCAGG - Intronic
1115251702 14:31355442-31355464 CACTATGCCCAGCCTGTGTGTGG - Intronic
1115399854 14:32943976-32943998 CACTGTGCCTGGCCTTTATTTGG + Intronic
1115675272 14:35666511-35666533 CACCATGCCCAGCCTGGACTGGG + Intronic
1115691695 14:35850482-35850504 CACTGTGCCCGGCCTTCAGTAGG + Intronic
1115925401 14:38428112-38428134 CACCGTGCCCAGCCTAAGGTTGG - Intergenic
1116257972 14:42581945-42581967 CACCGCGCCCGGCCTGTAATAGG + Intergenic
1116437293 14:44909752-44909774 CACCGTGCCCAGCCAGTAATGGG + Intergenic
1116656648 14:47662023-47662045 CACCGCACCCAGCCAGTAGTTGG + Intronic
1117284680 14:54275673-54275695 AACTGTGCCCAGCACATAGTAGG - Intergenic
1117538674 14:56725725-56725747 CACTGTACCCAGCCTGGATGAGG - Intronic
1117589633 14:57254144-57254166 CACTGCGCCCAGCCAGTGTTAGG - Intronic
1117772002 14:59142957-59142979 CACCGTGCCCAGCCTGCCTTTGG - Intergenic
1117836838 14:59816643-59816665 CACTGTGCCCCGCTAGTACTGGG - Intronic
1118093515 14:62510044-62510066 CACTATGCCCAGCCTGGATTGGG - Intergenic
1118302378 14:64627068-64627090 TATTGTGCCCAGCATATAGTAGG - Intergenic
1118386379 14:65258787-65258809 CACCGCGCCCAGCCTGAGGTGGG - Intergenic
1119062763 14:71492912-71492934 CATTGTGCCCAGCCAGTAAATGG + Intronic
1119173964 14:72555541-72555563 CCCTGTGCCCAACCCGTACTGGG - Intronic
1119241781 14:73066345-73066367 CACTGCGCCCAGCCCTTAGGAGG - Intronic
1119389037 14:74277677-74277699 CACCATGTCCAGCCTGCAGTGGG + Intergenic
1119593621 14:75913524-75913546 CATAGTGCCCAGCCTGTAGTAGG + Intronic
1119713393 14:76840015-76840037 CACCGTGCCCAGCCTGTTTATGG + Intronic
1119855191 14:77894631-77894653 CACAGTGCCTGGCATGTAGTAGG + Intronic
1120161568 14:81151079-81151101 CACCCCGCCCAGCCTGTAATGGG + Intergenic
1120365499 14:83562965-83562987 CACTGTGCCCGGCCTGAAACTGG + Intergenic
1120432629 14:84438744-84438766 CACTGTGCCCGGCCGGGATTGGG - Intergenic
1120757190 14:88255403-88255425 CACCATGCCCAGTCTGAAGTAGG - Intronic
1120986903 14:90343032-90343054 CACCGTGCCCAGCTTGGATTTGG + Intergenic
1121284715 14:92726351-92726373 CAGTCTGCCCAGCCTGTCTTTGG + Intronic
1121351255 14:93174888-93174910 CACTGTGCCCGGCCTGAAGCTGG + Intergenic
1121413051 14:93761055-93761077 CACTGCGCCCAGCCAGAGGTGGG - Intronic
1121578658 14:95009893-95009915 CACTGTGCCCAGCCAGTTCTAGG - Intergenic
1121696158 14:95914017-95914039 CACCGTGCCCAGCCCCTAGGTGG + Intergenic
1121713869 14:96058971-96058993 CACTGCGCCCAGCCTGGGGAAGG - Intronic
1121721349 14:96110901-96110923 TCCTGTGCCCAGCACGTAGTAGG - Intergenic
1121996522 14:98607386-98607408 CCCTGTGACCAGCCTGTGGGTGG - Intergenic
1122140165 14:99658839-99658861 CACTGTGACCAGCACATAGTAGG - Intronic
1122471572 14:101970769-101970791 CACTGTGCCCAGCCCATGTTTGG + Intronic
1122533846 14:102448246-102448268 CACTGTGCCCGACCAGGAGTAGG + Intronic
1202882291 14_KI270722v1_random:72086-72108 CACTGTGCCCAGCCAAAAGGAGG - Intergenic
1123415443 15:20091621-20091643 CACTGAGCCCAGCCAGGACTTGG + Intergenic
1123524782 15:21098735-21098757 CACTGAGCCCAGCCAGGACTTGG + Intergenic
1123633646 15:22280318-22280340 CACTGTGCCCAGCCTAAAAAAGG - Intergenic
1124345510 15:28919146-28919168 CACTGCGCCCGGCCGGTTGTGGG + Intronic
1124576275 15:30911773-30911795 CACTGTGCCCAGCCAGAGGGTGG - Intronic
1124638590 15:31380883-31380905 CACTGTGCCCAGCCAGCAACTGG - Intronic
1124649277 15:31463023-31463045 CACTGTGCCCAGCCTCCTTTTGG - Intergenic
1124780982 15:32633350-32633372 CACCGTGCCCAGCCTCTAACAGG - Intronic
1125047458 15:35258858-35258880 CACCGTGCCCGGCCCATAGTAGG - Intronic
1125314819 15:38419622-38419644 CACTGTGCTCAGCCGATACTAGG + Intergenic
1125583528 15:40804288-40804310 CACTGTGCCCTGCCCATAATTGG - Intronic
1125652315 15:41327463-41327485 CACTGTACCCAGCCAGAATTGGG + Intronic
1125726598 15:41871412-41871434 CACTGTGCCCACGCTCTAGCAGG + Exonic
1125847026 15:42865530-42865552 GACTGTGCCCAGCCTGTTGTTGG - Intronic
1125902055 15:43357556-43357578 CACTGTACCCAGCCAGTTTTGGG + Intergenic
1126019065 15:44381939-44381961 CACTGTGCCCAGCCTATTCAAGG + Intronic
1126071407 15:44867842-44867864 CACTGTGCCCAGCCAAAACTTGG - Intergenic
1126078858 15:44939079-44939101 CACCGTGCCCAGCCTGAAACAGG + Intergenic
1126115784 15:45206351-45206373 CACTGTACCCAGCCAGTGATAGG + Intergenic
1126177046 15:45745594-45745616 CCCTGTGCCCAGCATGTGGCAGG - Intergenic
1126470458 15:49005039-49005061 CACTGCGCCCAGCCAATAGTGGG - Intronic
1126739291 15:51761436-51761458 CACAGTGCCCAGCCTCTATTTGG - Intronic
1126826243 15:52552279-52552301 CACTGTGCCCAGTCTGAAGGGGG - Intronic
1127171100 15:56302197-56302219 CACTGTGCCCAGACTGTTGGAGG - Intronic
1127422593 15:58821959-58821981 CACTGTGCCCAGCCTATGGATGG - Intronic
1127431835 15:58918041-58918063 CATTGCGCCCAGCTGGTAGTTGG + Intronic
1127438140 15:58978808-58978830 CACTGTGCCCAGCCGATAAACGG - Intronic
1127911989 15:63424155-63424177 CACTGTGCCTGGCCTAAAGTGGG + Intergenic
1127915883 15:63454470-63454492 CACTGCGCCCAGCCTCTAAAAGG + Intergenic
1128345996 15:66852698-66852720 CACTGTGCCCAGCCCACAGAAGG - Intergenic
1128402009 15:67292970-67292992 GACAGTGCCTAGCCTGGAGTAGG + Intronic
1128829486 15:70754092-70754114 CACTACGCCCAGCCTATATTTGG + Intronic
1128843558 15:70870776-70870798 CACCGTGCCCAGCCAGCAGTAGG + Intronic
1128993231 15:72277896-72277918 CACTGGGCCCAGCCTATTGAAGG - Intronic
1129428025 15:75479018-75479040 CACCATGCCCAGCCTCTAGGAGG - Intronic
1129497539 15:75999745-75999767 CACTGTGCCAAGTCTCTATTTGG - Intronic
1129604828 15:77019753-77019775 CTCTGTGCCCAGCCTGCACCCGG - Intronic
1129824167 15:78623892-78623914 CACAGTGCCTGGCATGTAGTAGG - Intergenic
1129873408 15:78956305-78956327 CACCGCGCCCAGCCTGTTGGTGG - Intergenic
1129979768 15:79857730-79857752 CACTGTGCCCAGCCGGATTTTGG - Intronic
1129995527 15:80001951-80001973 CACCGTGCCCAGCCCGTAAATGG - Intergenic
1130559878 15:84949697-84949719 CACTGTGCCCAGCCTTAGGAAGG + Intergenic
1130601173 15:85274727-85274749 CACCGTGCCCAGCCTCAAATCGG + Intergenic
1130635672 15:85617526-85617548 CACCGCGCCCAGCCGGTAGGAGG + Intronic
1130905352 15:88236382-88236404 CACAGTGCCCAGCCTGTTTTGGG - Intronic
1130965418 15:88694114-88694136 AACAGTGCCTAGCATGTAGTGGG - Intergenic
1131021873 15:89105988-89106010 CACTGTGCCCAGCCGAGAGGTGG + Intronic
1131150819 15:90046271-90046293 CTCAGTGCCCAGCCCATAGTAGG + Intronic
1131197248 15:90365519-90365541 CACAGTGCCCAGCACGCAGTAGG + Intronic
1131387025 15:92016439-92016461 CACTGAGCCCAGCCTGAAGAAGG + Intronic
1132283368 15:100640431-100640453 CACCATGCCCAGCCTATGGTAGG + Intronic
1132958280 16:2608148-2608170 CACTGCACCCGGCCTGTACTTGG + Intergenic
1132993059 16:2807344-2807366 CACTGTGCCCGGCCTAGAGATGG + Intergenic
1133114901 16:3572574-3572596 CACTGTGCCAGGCCTGTAGTGGG + Intronic
1133189786 16:4125180-4125202 CTCTCTTCCCAGCATGTAGTGGG + Intergenic
1133293593 16:4738592-4738614 CACTGTGCTCAGCCAGAAATGGG - Intronic
1133404115 16:5509469-5509491 CACTGTGGCTGGCTTGTAGTTGG + Intergenic
1133552006 16:6865289-6865311 CACCGTGCCCGACCTGGAGTGGG + Intronic
1133570180 16:7033229-7033251 CACTGTGCCCGTCCTGTTTTTGG - Intronic
1133890632 16:9875841-9875863 CCCAGTGCCCAGGCTGGAGTAGG + Intronic
1133890763 16:9876657-9876679 CTCAGTGCCAGGCCTGTAGTAGG - Intronic
1134054358 16:11160197-11160219 CTCTGTGGCCTGCCTGGAGTTGG - Intronic
1134095441 16:11415584-11415606 CCTTGTGCCCTGCATGTAGTAGG - Intronic
1134222211 16:12363605-12363627 CACCATTCCCAGCATGTAGTAGG + Intronic
1134643412 16:15847540-15847562 CGCTGTGCCCAGCCCTAAGTGGG + Intronic
1134756305 16:16670517-16670539 CACAGTGCCCAGCACATAGTAGG + Intergenic
1134989765 16:18688647-18688669 CACAGTGCCCAGCACATAGTAGG - Intergenic
1135055802 16:19231280-19231302 CACTGTGCCCAGCATACAGAGGG - Intronic
1135074821 16:19384122-19384144 CACTGCGCCCAGCCTATAGAAGG + Intergenic
1135146507 16:19967303-19967325 CACCGTGCCCAGCCTGTGTTTGG + Intergenic
1135402610 16:22176709-22176731 CACTGCTCCCAGCTAGTAGTAGG + Intronic
1135410933 16:22233903-22233925 CACCATGCCCAGCCTGTTGTTGG + Intronic
1135857838 16:26028558-26028580 CACTGTGCCCAGCCTGAGAGAGG + Intronic
1135921628 16:26654254-26654276 CACTGTGCCCGGCCTATTTTAGG + Intergenic
1136046026 16:27615640-27615662 CACTGTGCCCGGCCTGTAGTGGG + Intronic
1136249360 16:28993822-28993844 CACTGAGCCTGGCCTGGAGTTGG - Intergenic
1136329726 16:29564488-29564510 CACTGGGCCCTGCCTAGAGTGGG - Intergenic
1136340833 16:29642089-29642111 CACTGTACCCAGCCAGCAGCTGG - Intergenic
1136380874 16:29894889-29894911 CACTGTGCCCGGCCTATAGAGGG - Intronic
1136444353 16:30304192-30304214 CACTGGGCCCTGCCTAGAGTGGG - Intergenic
1136524933 16:30822930-30822952 CACTGGGCCCAGCCTCGAATGGG + Intergenic
1136584255 16:31173754-31173776 CACTGTGCCCGGCCTCTATTTGG - Intergenic
1136584304 16:31174074-31174096 CACCATGCCCAGCCTCTATTTGG - Intergenic
1136607552 16:31346683-31346705 CACTCAGCCCAGCCTGCAGAGGG - Intergenic
1136689617 16:32019858-32019880 CACTGCGCCCGGCCTCCAGTGGG + Intergenic
1136714410 16:32265289-32265311 GCCTGTGCCCTGCCTGTATTGGG + Intergenic
1136790205 16:32963417-32963439 CACTGCGCCCGGCCTCCAGTGGG + Intergenic
1136879608 16:33890511-33890533 CACTGCGCCCGGCCTCCAGTGGG - Intergenic
1136925017 16:34363677-34363699 CACTGTGCCCAGCCTTGAGCAGG + Intergenic
1136979556 16:35048129-35048151 CACTGTGCCCAGCCTTGAGCAGG - Intergenic
1137344600 16:47644382-47644404 CACTGTGCCTAGTATGTAGCTGG - Intronic
1137357053 16:47777142-47777164 AACTGTGCAGAGCCTGTAGTGGG + Intergenic
1137612758 16:49829899-49829921 CACAGTGCCTGGCATGTAGTTGG - Intronic
1137636443 16:49991089-49991111 CACTGTGCCCAGCCTAGTGTTGG - Intergenic
1137769460 16:51004426-51004448 CACTGTGCCCGGCCTGAAGCAGG + Intergenic
1137844349 16:51672692-51672714 CACAGTGCTCAACCTATAGTAGG + Intergenic
1137886642 16:52111540-52111562 CACTGTGCCCAGCCAGAAGTAGG - Intergenic
1138059206 16:53872013-53872035 CACTGTGCCTGGCCAGAAGTTGG + Intronic
1138537525 16:57667836-57667858 CTCTGTGCCCAGCTTGTTGCAGG + Intergenic
1138773518 16:59692848-59692870 CACTGTGCTCAGCCAATAGCTGG + Intergenic
1138898836 16:61244160-61244182 CTCTGTGCTCAGCCTGCAGCAGG + Intergenic
1138964111 16:62063203-62063225 CTCTGTGCCCAGCCTCTATTAGG + Intergenic
1139399505 16:66669830-66669852 CACTGTGCCCAGCCATTTGCTGG + Intronic
1139616298 16:68095640-68095662 CCCTGTGCCCAGCCAGTTGAGGG + Intronic
1139644389 16:68317537-68317559 CACTGTGCCCAGCCTGTTTTTGG - Intronic
1139888883 16:70233808-70233830 AACAGTGCCTAGTCTGTAGTAGG - Intergenic
1140111810 16:72011348-72011370 CACCGTGCCCAGCCTCTACATGG - Intronic
1140616316 16:76668502-76668524 GACTGTGGCCAGCCTCTAGAGGG + Intergenic
1140660567 16:77188115-77188137 CACTGTACCCAGCCTGACATTGG + Intergenic
1141136764 16:81470744-81470766 CACTGTGCCCAGCCAAAATTGGG + Intronic
1141146924 16:81537575-81537597 CACCGTGCCCAGCCTCTATTTGG - Intronic
1141258356 16:82425563-82425585 CAATGTGCTTAGCCTGTAATTGG + Intergenic
1141434739 16:83993588-83993610 CACTGTGTCCAGCACATAGTAGG - Intronic
1141479816 16:84299060-84299082 CACTGTGCCCGGCCTGGAATGGG - Intronic
1141658823 16:85430675-85430697 CCCTGTGCCCAGCCCGTACCTGG - Intergenic
1141674636 16:85511236-85511258 CACTGAACCCAGCCTGGAGGGGG - Intergenic
1141753588 16:85976211-85976233 CACTGCGCCCGGCCGGGAGTAGG - Intergenic
1142120515 16:88384335-88384357 CTCAGTGCCCAGCCTGTCCTAGG + Intergenic
1142453113 16:90195834-90195856 CACTGTGTCCAGCCAGTGGTGGG + Intergenic
1203055640 16_KI270728v1_random:924480-924502 GCCTGTGCCCTGCCTGTATTGGG - Intergenic
1203092410 16_KI270728v1_random:1224868-1224890 CACTGCGCCCGGCCTCCAGTGGG + Intergenic
1142622958 17:1176555-1176577 CACTGCGCCCGGCCTGTGCTAGG - Intronic
1142644527 17:1303231-1303253 CACTGTGCCTGGCCGGTAGTAGG - Intergenic
1142699964 17:1653226-1653248 CACTGTGCCCAGCCGAGTGTTGG + Intronic
1142722572 17:1786500-1786522 CACTGTGCCCAGCCTATCCTGGG + Intronic
1142736540 17:1903984-1904006 CACTGTGCCCGGCCAGTAAGAGG + Intergenic
1142742535 17:1939674-1939696 CGATGTGTCCAGCCTGTGGTCGG + Intronic
1142877800 17:2862707-2862729 CACTGTGCACAGCCCATATTCGG - Intronic
1142971447 17:3614557-3614579 CACTGTGCCTGGCCTGATGTAGG - Intronic
1143023643 17:3929096-3929118 GACTGTGCCCAGGCTGGGGTGGG - Intronic
1143096843 17:4482834-4482856 CACTGTCCCCTGCCTGGAGGGGG - Intronic
1143156681 17:4841811-4841833 CACCGTGCCCAGCATATACTGGG - Intronic
1143170711 17:4928445-4928467 CACCGTGCCCAGCCTCCAGATGG + Intergenic
1143225271 17:5296547-5296569 CACCGTGCCCAGCCTGGTTTTGG + Intronic
1143469477 17:7163138-7163160 CACTGTGCCTGGCCTCAAGTGGG - Intergenic
1143556522 17:7665096-7665118 CACCGTGCCCAGCCCAAAGTTGG - Intronic
1143834404 17:9678626-9678648 CACTGCGCCCGGCCTGTATTTGG + Intronic
1144076776 17:11726758-11726780 CACCATGCCCAGCCTTCAGTGGG - Intronic
1144526838 17:15997812-15997834 CACCGTGCCCAGCCAGTTTTGGG - Intronic
1144528883 17:16016844-16016866 TACTGTGCCCAGCCAGTTTTTGG + Intronic
1144699804 17:17329685-17329707 CACTGTACCCGGCCTGAAGTGGG - Intronic
1145017230 17:19407285-19407307 CACTGTGCCCAGCACTTAGTAGG + Intergenic
1145098333 17:20051461-20051483 CACTGTGCCCAGCTAGCACTTGG + Intronic
1145822392 17:27849146-27849168 CAATGTGCCCAGCCAGTGTTAGG - Intronic
1145823009 17:27854797-27854819 CACTGTGCCCGGTCCCTAGTAGG - Intronic
1146024641 17:29309065-29309087 CACTATGCCCAGCCTCCAGCTGG + Intergenic
1146088701 17:29854657-29854679 CACCGTGCCCGGCCTCTTGTGGG - Intronic
1146239889 17:31210292-31210314 CACTGTGCCCGGCCTGTACGAGG - Intronic
1146381960 17:32337170-32337192 CATTGTGCCCAGCCTACAGGTGG - Intronic
1146470667 17:33121756-33121778 CACAGTGCCTGGCATGTAGTAGG - Intronic
1146729754 17:35183365-35183387 CAATCTGCCCAGCCTGAAGAGGG - Intronic
1147009712 17:37435574-37435596 CACTGTGCCCGGCCTGTTTTTGG + Intronic
1147120540 17:38332893-38332915 CACTGTGCCCAGCCAGCTGAGGG + Intronic
1147124911 17:38360477-38360499 CACTGTGCCCAGCCAGCATATGG + Intronic
1147644276 17:42024482-42024504 CACTGAGCCCAGCCAGGGGTGGG - Exonic
1147674899 17:42198406-42198428 CACCATGCCCAGCCTGGAGCTGG - Intergenic
1147807499 17:43142200-43142222 CACTGTGCCCAGCCTAGTCTTGG + Intergenic
1147898847 17:43770367-43770389 CACTGTGCCCAGCCCCTTGCAGG - Intronic
1147909606 17:43847540-43847562 CCCTGTGCCAAGCCTGGAGGCGG + Intronic
1148077338 17:44945929-44945951 CACTGTGCCCAGCCCATGTTTGG - Intronic
1148092979 17:45033751-45033773 CACTGTGCCCAGCCTCATGTTGG + Intronic
1148140522 17:45324731-45324753 CACTGTGCCCAGCCCACAGGAGG - Intergenic
1148203907 17:45767757-45767779 CAGTGTGCCCAGCACATAGTAGG + Intergenic
1148292842 17:46471357-46471379 CACTGTGCCCAGCCTATTTATGG - Intergenic
1148315026 17:46689054-46689076 CACTGTGCCCAGCCTATTTATGG - Intronic
1148344811 17:46895988-46896010 CACTGCGCCCAGCCTGGCCTTGG - Intergenic
1148393962 17:47293892-47293914 CACTGCGCCCAGCCAGCATTGGG + Intronic
1148570322 17:48663070-48663092 CACTGCACCCAGCCTTGAGTTGG + Intergenic
1148642304 17:49197254-49197276 CACCGCGCCCAGCCTGGAGATGG + Intergenic
1148781929 17:50127312-50127334 CACTGCGCCCAGCCTAGAGGTGG - Intronic
1149130006 17:53287718-53287740 CACCGCGCCCGGCCTTTAGTTGG + Intergenic
1149430200 17:56591614-56591636 CACCGTGCCCGGCCTGTACCAGG + Intergenic
1149436206 17:56635497-56635519 CACCGCGCCCAGCCAGTAGAAGG + Intergenic
1149544028 17:57489730-57489752 CACTGTGCCCAGCACACAGTGGG - Intronic
1149697722 17:58629534-58629556 CACCGTGCCCGGCCAATAGTTGG - Intronic
1149832544 17:59884630-59884652 CACTGCACCCAGCCTGATGTTGG - Intronic
1150055839 17:62014603-62014625 CACTGCACCCAGCCTGTATATGG + Intronic
1150056546 17:62021876-62021898 CACTGTGCCCAGGCTTTAGAAGG - Intronic
1150189208 17:63220004-63220026 CACTGTGCTCAGCCTATTTTTGG - Intronic
1150232148 17:63560979-63561001 CACTGCACCCAGCCTGTAGTGGG - Intronic
1150408293 17:64920753-64920775 CACTGTGCCCGGCCTCAATTTGG + Intergenic
1150477634 17:65487022-65487044 CACTGTGCTTGGCCTGCAGTGGG - Intergenic
1150494837 17:65599369-65599391 CACAGTGCCCAGCACATAGTAGG - Intronic
1150678343 17:67264105-67264127 CACTGTGCCCAGCCTGTTCCAGG - Intergenic
1150759775 17:67951095-67951117 CACTGTGCCCAGCCTCAATTTGG + Intronic
1150866476 17:68855922-68855944 CACTGTGCCCAGCCTAGAGTTGG - Intergenic
1150898135 17:69237872-69237894 CACTGTGCCCGGCCAGTTGCTGG - Intronic
1150931304 17:69588317-69588339 CACTGTGCCCGGCCATAAGTGGG + Intergenic
1151282233 17:73085217-73085239 CACTGTGCCCGGCCTGTGTGAGG - Intronic
1151497179 17:74466038-74466060 CTCTGTGCCCAGCCCCGAGTTGG + Intergenic
1151524072 17:74651768-74651790 CACTGTGCCTGGCCAGTAATGGG + Intergenic
1151535070 17:74734553-74734575 CACTGTGCCCAGCCAGGATGCGG - Intronic
1151606985 17:75143884-75143906 CACTGTGCCCAGCCCCTTTTGGG - Intronic
1151772888 17:76176890-76176912 CACTGTGCCCACCCTGCCGAGGG + Intronic
1151816180 17:76472575-76472597 CACGGTGCCCCTCCTGTACTGGG - Intronic
1152003711 17:77663720-77663742 CACCGTGCCCAGCCTTTATTTGG - Intergenic
1152083287 17:78202134-78202156 CACTGTGCCCAGCCAGGTGGCGG - Intronic
1152193415 17:78902394-78902416 CACCATGCCCAGCCTGCACTGGG + Intronic
1152253782 17:79225776-79225798 GAATGGGCCCAGCCTGCAGTTGG - Intronic
1152347643 17:79763218-79763240 CACTGTGGCCAGCCAGTATGTGG - Intergenic
1152729997 17:81965270-81965292 CACTGTGCCCAGCTGGTACGGGG + Intergenic
1153426362 18:4969227-4969249 CACTGTGCCCAGCCCAAACTTGG + Intergenic
1153623144 18:6998742-6998764 CACCATGCCCGGCCTGTCGTGGG - Intronic
1153842588 18:9020373-9020395 CACTTTGCACAACCTGTACTTGG - Intergenic
1154380965 18:13849484-13849506 CACTGTGCCCAGCCAGGAGAAGG - Intergenic
1154382747 18:13867396-13867418 CACTGTGCCCAGCTTAAATTTGG - Intergenic
1154971195 18:21411492-21411514 CACGGTGCCCAGCCAGATGTTGG + Intronic
1154993377 18:21616972-21616994 CACTGTGCCCAGCCTATATCTGG + Intronic
1155420442 18:25649930-25649952 CACTGCGCCCAGCCTCTCTTTGG - Intergenic
1156356420 18:36346075-36346097 CACTGTGCCCAGCCAAAATTGGG - Intronic
1156906825 18:42362699-42362721 CACTGTGCCCGGCCTGAACAGGG + Intergenic
1157267210 18:46236299-46236321 CACTGTGCCCAGCCATTCGTGGG + Intronic
1157521718 18:48349906-48349928 CACAGTGCCTGGCCTGTAATGGG + Intronic
1157828626 18:50835746-50835768 TACTGAGCCCAGCCAGTGGTAGG + Intergenic
1158128914 18:54131308-54131330 CACTGCGCCCAGCCACAAGTAGG - Intergenic
1158462730 18:57660803-57660825 CACTGTGCCCAGCCAATATCAGG + Intronic
1158599138 18:58842068-58842090 CACTGTGCCCAGCCGGGTCTTGG + Intergenic
1158988901 18:62848750-62848772 TACTGCGCCCAGCCTGTGGTTGG + Intronic
1159033215 18:63251985-63252007 CACTGTGCCCAGCCCAAAGAAGG + Intronic
1159795149 18:72833619-72833641 CAATGTGGCAGGCCTGTAGTTGG - Intronic
1160644373 19:172932-172954 CACTGCGTCCAGCCAGTCGTGGG - Intergenic
1160669673 19:354774-354796 CACTGTGCCTGGCCTGTATTTGG + Intergenic
1160728133 19:627438-627460 CACTGTGCCCGGCCGGTTTTGGG + Intronic
1160793850 19:934894-934916 CACGGTGCCCAGCCAGTCCTGGG + Intronic
1160936036 19:1595298-1595320 CACTGCGCCCAGCCTGGAATTGG - Intergenic
1160999645 19:1903977-1903999 CACCGTGCCCAGCCTGTTCCTGG - Intergenic
1161053798 19:2179872-2179894 CCCTGCACCCAGCCTGTTGTGGG + Intronic
1161239304 19:3213177-3213199 CACTGCGCCCGGCCTGGAGGGGG + Intergenic
1161350424 19:3788198-3788220 CACTGGGCCCAGCCTACAGATGG - Intronic
1161361783 19:3854100-3854122 CACTGTGCCCTGCCTGTGTCAGG - Intronic
1161657866 19:5526843-5526865 CACTGTGCCCAGCCCACAGCTGG + Intergenic
1161670624 19:5606335-5606357 CACTGTGCCCAGCCTGTGCCTGG - Intronic
1161684987 19:5698140-5698162 CACTCTGACCAGCCGGGAGTTGG - Intronic
1161718512 19:5890859-5890881 CACCGCGCCCAGCCCTTAGTGGG + Intronic
1161994786 19:7705591-7705613 CACTGTGCCCAGCTGGAATTTGG + Intergenic
1162003087 19:7760511-7760533 CACCATGCCCAGCCTGTTCTAGG + Intergenic
1162536371 19:11264891-11264913 CACTGTGCCCGGCGGGTTGTGGG - Intergenic
1162580148 19:11524549-11524571 CGCTGTGCCCAGCCTTCAGTGGG - Intronic
1162722549 19:12670896-12670918 CACTGTGCCCAGCTGAGAGTAGG - Exonic
1163056145 19:14719895-14719917 CACCGTGCCCAGCCGGGAGATGG - Exonic
1163072955 19:14860828-14860850 CACAGCGCCCAGCCAGTAGATGG - Intergenic
1163136128 19:15312645-15312667 CACCGTGCACAGCCTGTTTTTGG - Intronic
1163179084 19:15585849-15585871 CACTGTGCTCAGCCAGAAGAAGG + Intergenic
1163286593 19:16352287-16352309 CACTGTGCCCTGCCTGTATGTGG + Intergenic
1163574721 19:18103921-18103943 CACTGCACCCAGCCAGTTGTGGG - Intronic
1163600296 19:18245121-18245143 CACTGTGCCTAGCCTGTTGTTGG + Intronic
1163702612 19:18793745-18793767 CACTGTGACCAGCCTGTGGCAGG - Intergenic
1163801545 19:19368699-19368721 CACCGTGCCCGGCCTGTGCTGGG - Intergenic
1163818870 19:19484819-19484841 CACCGCGCCCAGCCTGTCATAGG + Intronic
1163934835 19:20433415-20433437 CACTGTGCCTGGCCAGTAGCTGG - Intergenic
1164221743 19:23201169-23201191 CACTGGGCCCAGCCTGTAATAGG - Intergenic
1164279017 19:23751973-23751995 CACTGCGCCCGGCCTGAGGTTGG + Intronic
1164539597 19:29113048-29113070 CACTGTGCCCAGCCTGACCCTGG - Intergenic
1164556937 19:29260387-29260409 CCCAGTGCCCAGCATATAGTTGG - Intergenic
1164566544 19:29329853-29329875 CACAATGCCCAGCATGTAGCCGG - Intergenic
1164587934 19:29488804-29488826 TACTGTGCCCGGCCACTAGTGGG - Intergenic
1164664902 19:30022449-30022471 CACTGTGCCCAGCCCTAATTAGG + Intergenic
1164718527 19:30413801-30413823 CACCGTGCCCAGCCAGTACAGGG - Intronic
1164949276 19:32322781-32322803 CACAGTTCCCAGCCCGTAGCTGG + Intergenic
1164997378 19:32732291-32732313 CACTGTGCCCAGCCAGTGTAAGG + Intronic
1165191707 19:34069095-34069117 CACCGCGCCCGGCCTGTAATTGG + Intergenic
1165206571 19:34193447-34193469 CACTGTGCCTAGCCAGAAATTGG + Intronic
1165343798 19:35230675-35230697 CACTGTACCCGGCCTGTCCTAGG - Intergenic
1165352573 19:35284081-35284103 CACTGCGCCCAGCCTCCTGTAGG + Intronic
1165358430 19:35318649-35318671 CACTGTGCCCAGCCAGGACTTGG + Intergenic
1165468490 19:35989429-35989451 CACCGCACCCAGCCTGAAGTAGG + Intergenic
1165775199 19:38400261-38400283 CACTGTGCCTAGCCAGGAGCTGG + Intergenic
1166043264 19:40215467-40215489 CCCTGTGCCCACCCTGCACTGGG + Exonic
1166219852 19:41357337-41357359 CCCTGTGTCCAGCCTGTGTTGGG - Intronic
1166395248 19:42434889-42434911 CACCGTGCCCAGCCTGTCATAGG - Intronic
1166859474 19:45801470-45801492 CACTGTGCCCAACCTGGAGCTGG - Intronic
1166929115 19:46290552-46290574 CACTGTGCCCGGCCTGAGTTAGG - Intergenic
1166990379 19:46689394-46689416 CACTGCGCCCAGCCTGATGATGG + Intronic
1167089576 19:47334339-47334361 CACTGTGCCCAGCCTTACGATGG - Intronic
1167169626 19:47822460-47822482 CCCAGTGCCCAGCGTGTGGTTGG + Intronic
1167176445 19:47867829-47867851 CACTGTGCCCAGCCTGCGAATGG + Intergenic
1167233455 19:48299119-48299141 CACTGCACCCAGCCTGTCCTGGG - Intronic
1167412740 19:49354709-49354731 CACCGTGCCCAGCCTCTATTAGG - Intronic
1167440592 19:49506570-49506592 CACCGTGCCCGGCCTGCAATTGG + Intergenic
1167714656 19:51134443-51134465 CACTGCGCCCAGCCAGTCCTAGG + Intronic
1167931245 19:52867482-52867504 CACCGTGCCCAGCCCATATTTGG + Intronic
1167962796 19:53121105-53121127 CACTGTGCCCGGCCAGCTGTAGG - Intronic
1167998980 19:53429800-53429822 CACCGTGCCCAGCCTATAAGTGG - Intronic
1168090338 19:54078789-54078811 CACTGTGCTCGGCCTACAGTGGG + Intronic
1168274814 19:55271769-55271791 CACTGTGCCTGGCCTGAGGTTGG - Intronic
1168408937 19:56126509-56126531 CACCGTGCCCAGACGGTATTGGG - Intergenic
1168446160 19:56415852-56415874 CACTGCCCCCAGCCTGTCTTTGG + Intronic
1168639143 19:58019311-58019333 CACTGTGCCCAGCCCATGCTTGG + Intergenic
1168662678 19:58180483-58180505 CACTGTGCCCAACCTAAAGATGG - Intergenic
1202657902 1_KI270708v1_random:41184-41206 CACTGTGCCCAGCCAAAAGGAGG - Intergenic
1202704795 1_KI270713v1_random:14737-14759 CACTGCACCCAGCCAGAAGTGGG - Intergenic
925104820 2:1282495-1282517 CACTCAGCCCAGCCTGAAGCTGG - Intronic
925230527 2:2229676-2229698 CACAGTGCCTTGCCTATAGTGGG - Intronic
925265294 2:2562743-2562765 CACTGCGCCCAGCTTGAGGTGGG + Intergenic
925788199 2:7453424-7453446 CACAGTGCCTGGCCTGTAGCAGG - Intergenic
926180091 2:10634818-10634840 CTCTGTGCCCAGCTTCTAGAAGG - Intronic
926292089 2:11539337-11539359 CATTGTGCCCAGCCAATAGCTGG + Intronic
926551792 2:14310097-14310119 CACTGTGCCTGGCCTGCAGAGGG - Intergenic
926658053 2:15431093-15431115 CACTGTGCCCAGCCGGTAGAGGG + Intronic
926697112 2:15778479-15778501 CACTGTGCCCGACCTGGATTTGG + Intergenic
926842588 2:17098722-17098744 CACTGCGCCCAGCCTCTAGCAGG + Intergenic
927310190 2:21621901-21621923 CACAGTGCCCAGCCTGTTTCTGG + Intergenic
927393420 2:22622202-22622224 CAGTGAGCCAAGACTGTAGTTGG + Intergenic
927504258 2:23603030-23603052 CTCTGTGCCCAGCCTGATGGTGG + Intronic
927668946 2:25052789-25052811 CACTTTGCCCAGCCTGTGCCAGG + Intronic
927702177 2:25275691-25275713 CACTGTGCCTGGCATGTGGTGGG - Intronic
928131924 2:28658078-28658100 CACTGTGCCCAGCCATTGGGTGG - Intergenic
928241492 2:29590781-29590803 CACCGCGCCCGGCCTGCAGTGGG - Intronic
928832146 2:35500134-35500156 CACCGCGCCCAGCCTGTAGGTGG - Intergenic
929341602 2:40825572-40825594 CACTGTGGTCAGTCTGTACTGGG - Intergenic
929476663 2:42257545-42257567 CACCGTGCCCGGCCTCTAGACGG - Intronic
929506863 2:42535096-42535118 CACCGCGCCCAGCCTGTACTGGG - Intronic
929582593 2:43092190-43092212 CACCGTGCCCAGCCTTCATTAGG + Intergenic
929613663 2:43291159-43291181 CACTGCGCCCAGCCTGTTTTAGG - Intronic
929634552 2:43504589-43504611 CACCATGCCCAGCCTATAGTAGG - Intronic
929715011 2:44301450-44301472 CACTGTGCCCGGCCTGGAACTGG - Intronic
929848199 2:45555096-45555118 TACTGTGCCCAGCCTGGGCTAGG - Intronic
930068488 2:47346269-47346291 CACTGTGTTCAGCCTATTGTAGG - Intronic
930086110 2:47498417-47498439 CACCGTGCCCAGCCTGGAGGGGG - Intronic
930146733 2:48014880-48014902 CACAGTGTCCAGCATATAGTTGG + Intergenic
930826947 2:55704572-55704594 CACTGTGCCCAGCCAGATGCAGG + Intergenic
931332214 2:61299462-61299484 TGCTGTGCCCAGCCTGAAGATGG - Intronic
931356818 2:61544352-61544374 CACTGTGCCCAGCCTGTGCCGGG + Intergenic
931440686 2:62288098-62288120 CACTGTGCCCAGTCTGTCTGGGG + Intergenic
931666191 2:64610948-64610970 CACTGTGCCCAGCCTATTGTTGG - Intergenic
931702987 2:64924058-64924080 CACTGTGCCTGGCCTCTAGAAGG + Intergenic
931722388 2:65076783-65076805 CACCGTGCCCAGCCAGAACTTGG - Intronic
931862755 2:66373560-66373582 CACTGTGCCCAGCCAGAACTTGG - Intergenic
932217382 2:69975688-69975710 CACAGTGCCCAGCACGCAGTAGG + Intergenic
932260644 2:70324210-70324232 CACCTTGCCCAGCCTGTTGAGGG - Intergenic
932323649 2:70839844-70839866 CACTGCACCCAGCCTATGGTGGG - Intergenic
932559689 2:72856167-72856189 CACAGTGACCAGCATGTAGTAGG + Intergenic
932717533 2:74112712-74112734 CACTGCACCCAGCCTGCTGTGGG - Intergenic
933101338 2:78262193-78262215 CACGGTGCCCAGCCTGTTTATGG - Intergenic
933492749 2:83008570-83008592 CACTGTGCTCAGCCAAGAGTTGG + Intergenic
933551489 2:83782931-83782953 CACTGTGCCCTGCCTGATATTGG - Intergenic
933814123 2:86052231-86052253 CACTGCACCCAGCCGGCAGTGGG + Intronic
934034353 2:88076715-88076737 TGCTGTGCCCAGCCTGGGGTAGG - Intronic
934549347 2:95245555-95245577 CACCGTGCCCAGCCTGGAGCTGG + Intronic
934662676 2:96151455-96151477 CACAGTGCCCAGCCCTGAGTGGG + Intergenic
934749654 2:96785164-96785186 CACTGTGCCCAGCATTTACGGGG + Intronic
934772271 2:96914598-96914620 CACAGTGCCCAGCCCTTGGTGGG - Intronic
935210640 2:100937075-100937097 CAGTGTGCCCAGCATAGAGTAGG + Intronic
935229356 2:101082406-101082428 CAGGGTGCCCAGCCTGCAGGAGG - Intronic
935697035 2:105779016-105779038 CACTGTGCCCAGCCTTATGATGG - Intronic
936007197 2:108900265-108900287 CACCAGGCCCAGCCTTTAGTTGG - Intronic
936139114 2:109923748-109923770 CACTGCGCCCAGCCTATACCTGG - Intergenic
936205582 2:110447737-110447759 CACTGCGCCCAGCCTATACCTGG + Intronic
936401076 2:112164873-112164895 CACAGTGCACAGCCTGCAGCAGG + Intronic
936450003 2:112626784-112626806 CACCATGCCCACCCTGCAGTGGG - Intergenic
937091136 2:119206942-119206964 CACTGTGCCCAGCCCCAAGAAGG - Intergenic
937390056 2:121478310-121478332 CACTGTGCCCAGCCTGTAGGTGG - Intronic
937861634 2:126715896-126715918 GAATGTGCCCAGCCTGAAGCAGG - Intergenic
937864615 2:126739773-126739795 CACATGGCCAAGCCTGTAGTCGG + Intergenic
938060639 2:128251831-128251853 CACTGTGCCCAGCCAGCTATAGG + Intronic
938370414 2:130764599-130764621 CTCTGTGGCCAGCCAGAAGTGGG + Exonic
938494491 2:131786389-131786411 CACCATGCCCAGGCTGCAGTGGG - Intergenic
938749743 2:134317313-134317335 GTCTCTGGCCAGCCTGTAGTTGG + Intronic
938933652 2:136109588-136109610 CACTGTGCCTGGCGTATAGTAGG - Intergenic
939415758 2:141894759-141894781 CACTGTGCCCAGCATAAATTAGG - Intronic
939739720 2:145891454-145891476 CACGATGCCCAGCCTGAAATTGG - Intergenic
939988033 2:148851289-148851311 CCCTGAGGCCAGCCTGTAGGTGG - Intergenic
940273902 2:151919383-151919405 CACCGCGCCCAGCCTGTATGAGG + Intronic
940343470 2:152604882-152604904 CACCGTGCCCAGCCTGTATTGGG + Intronic
940450805 2:153834216-153834238 CATGGTGTCCAGCCTGTGGTAGG - Intergenic
940929234 2:159407181-159407203 CACTGTGCCCAGCCAGTTGTGGG - Intronic
940943028 2:159584406-159584428 CACTGTGCCCAGCCTGATTTAGG + Intronic
940997372 2:160164401-160164423 CACTGTGCCCAGCCTAAAATGGG - Intronic
941008175 2:160269039-160269061 CACTGTGCCCAGCCTCTCCTTGG + Intronic
941123392 2:161558117-161558139 CACAGTGCCCAGCATATAATAGG + Intronic
941798207 2:169624876-169624898 CACCGCGCCCAGCCGGAAGTAGG + Intronic
941981349 2:171460822-171460844 CACTGTGCCCAGCTGATAGTGGG + Intronic
942680204 2:178470658-178470680 CACTGTGCCCAGCCTGTTACTGG - Intronic
943423946 2:187705947-187705969 CACTGTGGCCCGCCTGTTTTTGG - Intergenic
943546167 2:189281893-189281915 CAGTGCGCCCAGCCTATAATGGG - Intergenic
943974226 2:194450307-194450329 CACTGCGCCCAGCCTTGAGATGG - Intergenic
944552448 2:200857047-200857069 CACTGCACCCGGCCTGTTGTGGG - Intronic
944791193 2:203128882-203128904 CACCATGCCCAGCCATTAGTAGG + Intronic
944805594 2:203277800-203277822 CACTGCGCCCAGCCTCTTTTAGG + Intronic
944824410 2:203467300-203467322 CACCATGCCCAGCCTGTATAGGG - Intronic
945284846 2:208071774-208071796 CACTGTACCCAGCCTGCAGTGGG + Intergenic
945299344 2:208201101-208201123 CACTGTGCCCGGCCTCTGGGTGG + Intergenic
945452927 2:210014375-210014397 CACCGCGCCCGGCCTGGAGTAGG + Intronic
945799269 2:214405505-214405527 CACTGTGCCCAGCCTTGATTTGG - Intronic
945995447 2:216432386-216432408 CCCTGTGCCCTGCCTACAGTGGG + Intronic
946383559 2:219366726-219366748 CACTGTGCCTAGCCAGCCGTGGG + Intergenic
946401492 2:219470885-219470907 CTCTGTGCCCAGCCTATACCAGG - Intronic
946785089 2:223235142-223235164 CACCATGCCCAGCCTGAAGGGGG - Intergenic
946824574 2:223663946-223663968 CACTGTGCCCAGCCTGTATTTGG - Intergenic
946839854 2:223809354-223809376 CACCATGCCCAGCCAGAAGTGGG - Intronic
947229714 2:227872586-227872608 AACTGTGCCCTGCCAGTAGAAGG + Intronic
947244123 2:228027924-228027946 CACTGTCGCCAGGCTGGAGTGGG - Intronic
947599269 2:231435493-231435515 CACTGTGCCCGGCCAATAGTTGG + Intergenic
947628489 2:231636382-231636404 CACTGTGCCCAGCCTAGAAGGGG - Intergenic
947661886 2:231875724-231875746 CACTATGCCCAGCCTACATTTGG + Intergenic
947789410 2:232855346-232855368 CAGTGTGCCCAGCCAGCATTAGG + Intronic
948290367 2:236819882-236819904 CACTGCGCCCAGCCCGTAGGTGG - Intergenic
948588797 2:239036745-239036767 CCCTGTGCCAAACCTGCAGTCGG - Intergenic
948706234 2:239794829-239794851 CACTGTGCCCGGCCAGTACAAGG - Intronic
949084551 2:242140497-242140519 CACTGCGTCCAGCCAGTGGTGGG + Intergenic
1168758856 20:334834-334856 CACTGTGCCCAGCCTCCAAGGGG + Intergenic
1169022285 20:2339346-2339368 CACTGTGCCCAGCCACTTGCTGG - Intronic
1169128843 20:3152190-3152212 CACTGTGCCCAGCCAAAAATAGG - Intronic
1169329364 20:4704544-4704566 CGCTGTGCCCGTCCTGTGGTCGG + Intergenic
1169661710 20:7985559-7985581 CACTGTGCCCAGCCTAAAACAGG + Intronic
1169747583 20:8958467-8958489 CACTGTGCCCGGCCTGCACCTGG - Intronic
1170052252 20:12158916-12158938 CACTGTGCTCAGCCAGCAGGTGG + Intergenic
1170201613 20:13750214-13750236 CACTGGGCCCAGCCTGGATAGGG - Intronic
1170305998 20:14938490-14938512 CACTGTGCCCAGCCTGGTTTAGG - Intronic
1170438878 20:16357899-16357921 CACTGTGCCCAGCCTCTTGATGG - Intronic
1170847295 20:19973498-19973520 CACTGTGCCTGGCCTGGAATGGG - Intronic
1171100088 20:22374773-22374795 CACAATGCCAAGCCTGTACTGGG - Intergenic
1171116289 20:22527396-22527418 CACTGTGCCCAGCCTATTGCAGG - Intergenic
1171501019 20:25593387-25593409 CACTGTGCCCAGCCCTTGGGAGG - Intergenic
1171959965 20:31486168-31486190 CACTGTGCCCGGCACTTAGTAGG - Intergenic
1171992098 20:31704386-31704408 CACCGCGCCCAGCCTGAACTTGG + Intronic
1172052644 20:32130600-32130622 TGCTGTACCCAGCCTGCAGTTGG + Intronic
1172112040 20:32552712-32552734 CACTGTGCCCAGCCAGAAAAAGG - Intronic
1172246467 20:33448580-33448602 CACTGCACCCAGCCTGAAGGTGG + Intergenic
1172457659 20:35090660-35090682 CACTGTGCCCAGCCTCTGGTGGG + Intronic
1172476655 20:35243468-35243490 CACAGTGCCTAGCCTGTAGTAGG + Intronic
1172522615 20:35578049-35578071 CACTGTGCCCAGCCTTGAAATGG + Intergenic
1172527101 20:35606468-35606490 CACTGTGCCCAGCCAAGAATGGG - Intergenic
1172550782 20:35797936-35797958 CACTGCGCCTAGCCTGGAATGGG + Intronic
1172678162 20:36690006-36690028 CACCGCGCCCAGCCTGTAATTGG + Intronic
1172801969 20:37582162-37582184 CCCTGTGCCCAGCATGGTGTGGG - Intergenic
1172808781 20:37632408-37632430 AACAGTGCCCAGCACGTAGTAGG + Intergenic
1172833370 20:37855946-37855968 CGCTGTGCCCAGCCCTTAGTAGG - Intronic
1172941472 20:38657379-38657401 CACCGTGCCCAGCCCAGAGTGGG - Intergenic
1173464536 20:43270576-43270598 CACTGTGCCCAGCTCATAGTAGG + Intergenic
1173509885 20:43618769-43618791 CACTGCGCCTGGCCTATAGTTGG + Intronic
1173579468 20:44137086-44137108 CATTGTGCCCAGCACATAGTAGG + Intronic
1173674901 20:44825186-44825208 CACTGCACCCAGCCTGGACTGGG + Intergenic
1173757842 20:45533905-45533927 CACCGTGCCCAGCCTGTGCTTGG + Intergenic
1174399289 20:50267372-50267394 CAGAGTGCCCAGCATGTGGTAGG - Intergenic
1174529991 20:51203936-51203958 CACTGTGCCCAGCCAGGACATGG + Intergenic
1174538360 20:51270330-51270352 CTCAGTGCCCAGCATGTAGGAGG + Intergenic
1174608269 20:51777383-51777405 CACCGCGCCCGGCCTGTTGTGGG - Intergenic
1175038288 20:56021037-56021059 CACTGTGCCCGGCCTCGAGGTGG + Intergenic
1175436937 20:58959525-58959547 TACTGTGCCCAGCCCGTGGCTGG + Intergenic
1175463080 20:59169475-59169497 CACTGTGCCCAGCCTAAAATTGG - Intergenic
1176207894 20:63900175-63900197 CACTGAGCCCAGCCCCAAGTTGG + Intronic
1176281130 20:64312991-64313013 CACTGCGTCCAGCCAGTGGTGGG + Intergenic
1176613452 21:9007985-9008007 CACCATGCCCAGGCTGTAGCGGG + Intergenic
1176641664 21:9310377-9310399 CACCGTGCCCGGCCTGTAAAGGG - Intergenic
1176711743 21:10155897-10155919 CACCATGCCCAGGCTGTAGTGGG - Intergenic
1177168711 21:17632098-17632120 CACTGCACCCAGCCTGAATTTGG + Intergenic
1178252616 21:31019050-31019072 CACTGTGCCCAGCCAATATATGG + Intergenic
1178271188 21:31191440-31191462 CTCTGTGTCCAGCCTGTGGCAGG + Intronic
1178319082 21:31591277-31591299 CACTGTGCCCAGCCTGTTTTGGG - Intergenic
1178376970 21:32074978-32075000 CACTGTGCCCTGCCTCAAGGAGG + Intergenic
1178539626 21:33438507-33438529 CACCGTGCCCAGCCTATAAATGG - Intronic
1178886284 21:36487269-36487291 CACTGCGCCCGGCCTGTTGTGGG + Intronic
1179059174 21:37964176-37964198 CACTGTGCCCAGCCTCATCTGGG - Intronic
1179132846 21:38654187-38654209 CACTGCGCCCAGCCAGTAAAAGG - Intronic
1179249239 21:39658951-39658973 CACTGTGCCCAGCCAAGAGCTGG - Intronic
1180260623 21:46666594-46666616 CACAGTGCCCAGCCTGTGTCAGG + Intergenic
1180350680 22:11799733-11799755 CACCGTGCCCGGCCTGTAAAGGG - Intergenic
1180628735 22:17212313-17212335 CACCGTGCCCAGCCTTTTCTTGG + Intronic
1180743950 22:18074190-18074212 CACTGTGCCCAGCCAGATGTGGG + Intergenic
1180918234 22:19504585-19504607 CACTGTGCCCGGCCTGGGCTGGG + Intronic
1180978645 22:19867820-19867842 CACTGTGCCTGGCCCGGAGTTGG + Intergenic
1180986130 22:19904764-19904786 CACAGTGCCCCTCCTGCAGTGGG - Intronic
1181086589 22:20442372-20442394 CACCGTGCCCAGCAGGGAGTGGG + Exonic
1181237256 22:21455218-21455240 CACCGTGCCCAGCCTCCAATAGG + Intergenic
1181262088 22:21605792-21605814 CACTGCGCCCAGTCTGTTTTTGG + Intronic
1181663811 22:24375664-24375686 CACTGTGCCCAGCCAACTGTGGG - Intronic
1181777196 22:25168312-25168334 CCCGGTGCCTAGCATGTAGTAGG + Intronic
1181923570 22:26339944-26339966 CACTGTGCCCGGCCGTCAGTTGG - Intronic
1181933016 22:26417886-26417908 CACTGCACCCAGCCTGAAGAGGG - Intergenic
1182000767 22:26917866-26917888 CACTGTGCTCAGCCAGCACTTGG - Intergenic
1182355415 22:29720472-29720494 CACCGTGCCCAACCTGCTGTCGG + Exonic
1182469449 22:30539086-30539108 CACCGCGCCTGGCCTGTAGTTGG - Intronic
1182592445 22:31392184-31392206 CACTGCGCTCAGCCTCTAGCTGG - Intergenic
1182810825 22:33115288-33115310 CACTGTGCCCGGCCTGGCCTTGG - Intergenic
1182909231 22:33966942-33966964 CACAATGCCCAGCATATAGTTGG - Intergenic
1182956470 22:34431230-34431252 CACTGCGCCCAGCCTTAATTTGG + Intergenic
1183123768 22:35754377-35754399 CACTGTGCCCGGCCCAAAGTAGG + Intronic
1183432073 22:37771995-37772017 CACAGTGCCCAGGATATAGTAGG - Intronic
1183450924 22:37894556-37894578 CACTGCGCCCAGCCTGGGCTTGG + Intergenic
1183868332 22:40722022-40722044 CACCATGCCCAGCCTACAGTAGG + Intergenic
1184138022 22:42560921-42560943 CACTGAGCCGGGCCTGTAGCAGG - Intronic
1184268347 22:43362862-43362884 CACTGTTCCCAGCCCCTATTAGG - Intergenic
1184461752 22:44641666-44641688 CACAGTGCCCAGCATATAGCAGG - Intergenic
1184708083 22:46229259-46229281 CACTGTGCCCGGCCTCTAGGAGG - Intronic
1185000173 22:48240702-48240724 CAATGTGCACAGCCATTAGTAGG - Intergenic
949921938 3:9009931-9009953 CTCTGTGCCAAGCCTGTGCTGGG - Intronic
949994368 3:9604555-9604577 TACTGTGCCCAGCCAGAAATTGG - Intergenic
950039793 3:9912912-9912934 CTTTGTGCCCACCCTGTAGCAGG + Intronic
950228601 3:11256510-11256532 CACCGTGCCTGGCCTGTAGAAGG - Intronic
950306676 3:11920342-11920364 CACCGCGCCCAGCCTGTAATGGG + Intergenic
950494143 3:13323820-13323842 CCCTGTGCCCATCCTGTACCTGG + Intronic
950803672 3:15577808-15577830 CACTGCGCCCAGCCGGTTTTTGG - Intronic
951647692 3:24911662-24911684 CACTGTGCCCAGCCAGGATTTGG - Intergenic
951780786 3:26360782-26360804 CACCGTGCCCAGCCTTATGTTGG + Intergenic
951902432 3:27670079-27670101 CACTGTGCCCGGCCGAAAGTGGG - Intergenic
951919919 3:27843128-27843150 CATTGTGCCTAGCATGGAGTAGG + Intergenic
951956098 3:28255532-28255554 CACTGTGCCCGGCCTGTTTCCGG + Intronic
952214666 3:31266009-31266031 TAATGTGCCTAGCATGTAGTAGG - Intergenic
952286220 3:31972098-31972120 CACTGTGCCCGGCCCAGAGTTGG - Intronic
952299701 3:32093507-32093529 CACTGTGTCCAGCCTGAACTTGG - Intergenic
952502196 3:33974167-33974189 CACTGTGCCCATCCTGTGTTTGG - Intergenic
952636501 3:35538650-35538672 CACCGCACCCGGCCTGTAGTAGG + Intergenic
952843202 3:37665741-37665763 CACCGTGCCCAGCCTGATGTGGG + Intronic
952907990 3:38155890-38155912 CACTGTGCCCGGCCTGTTTTGGG + Intergenic
953172311 3:40518440-40518462 CACTGTGCCCGGCCAATAATAGG - Exonic
953315525 3:41923208-41923230 CACTGTGCCCAGCCTGGTTCAGG - Intronic
953585312 3:44195721-44195743 CACTGCGCCCGGCCTATAATTGG - Intergenic
953623618 3:44552983-44553005 CACTGTGCCCAGCCTCTTTGTGG + Intergenic
953851976 3:46471527-46471549 CACTGGGCCAAGCCTGGAGGTGG - Intronic
953864085 3:46568887-46568909 CACTGTGCCCAGCCTGCTACTGG - Intronic
953952307 3:47200630-47200652 CACTGTGCCCAGCCTGATTTTGG - Intergenic
954307257 3:49735064-49735086 CACTGCGCCCAGTCTAGAGTGGG - Intronic
954334284 3:49907245-49907267 CACCATGCCCGGCCTGTACTAGG + Intronic
954547209 3:51447116-51447138 CACCATGCCCAGCCCATAGTAGG - Intronic
954680090 3:52340721-52340743 CACTGTGCCCGGCCTCTGGTAGG + Intronic
954782073 3:53069226-53069248 CACTGTGCCCAGACTGTGTTAGG + Intronic
954810609 3:53245013-53245035 CACTGCCCCCAGCCTGGAGGGGG - Intronic
954890006 3:53917739-53917761 CACTGCGCCCAGCCAGCTGTGGG + Intergenic
954919162 3:54174811-54174833 CACTGTGCCTGGCCTGAAGTTGG + Intronic
955306593 3:57839225-57839247 CACTGTGCCCTGCCAATAGATGG + Intronic
955361011 3:58274961-58274983 CACAGTGCCCAGCGTGTTGCAGG - Intronic
955369563 3:58339516-58339538 TACCGTGCCCAGCCAGAAGTTGG + Intronic
955372051 3:58360545-58360567 CACTGTGCCCAGCCTGGAGCTGG - Intronic
955391205 3:58523735-58523757 CACCATGCCCAGCCTGTTTTCGG + Intronic
955615078 3:60798997-60799019 CACTGTACCCAGCCTGCAATAGG + Intronic
955666690 3:61356545-61356567 CACCGCACCCAGCTTGTAGTGGG - Intergenic
955869415 3:63421169-63421191 CACTATGCCCAGCTTCTAATAGG + Intronic
956000175 3:64721578-64721600 CACAGTGCCAAGAATGTAGTAGG + Intergenic
956005596 3:64775232-64775254 CACTGCGCCCGGCCAATAGTTGG + Intergenic
956134907 3:66088987-66089009 CACTGTGCCCAGCCCAAACTAGG - Intergenic
956187843 3:66579399-66579421 CACTGCCCCCAGCCTTGAGTTGG - Intergenic
956685504 3:71823971-71823993 CACCGTGCCCAGCCTAGAATAGG - Intergenic
956746485 3:72314894-72314916 CCCTATGCCCAGCATGGAGTAGG - Intergenic
956825443 3:72993572-72993594 CACCATGCCCAGCCAGTAGGAGG + Intronic
957417567 3:79926343-79926365 CACAGTGCCTAGCATTTAGTTGG + Intergenic
957784750 3:84867741-84867763 CACCGTGCCCAGCCTTAATTTGG + Intergenic
958415112 3:93864842-93864864 CACTGTGCTCAGTCATTAGTTGG - Intergenic
958539175 3:95447965-95447987 CACTGTGCTCAGTCATTAGTTGG + Intergenic
958795738 3:98704555-98704577 CACTGTGCCCAGCCAATGGATGG - Intergenic
958937272 3:100270191-100270213 CACAGTGAGTAGCCTGTAGTAGG + Intronic
959047412 3:101489894-101489916 CACTGTGCCCGGCCTGGGCTTGG - Intronic
959732748 3:109622711-109622733 CACTGCGCCCGGCCTGTTCTGGG - Intergenic
959786341 3:110302972-110302994 CACTGTGCCAAGCCTAAACTTGG + Intergenic
960393289 3:117105341-117105363 CACTGTGCCCAGCCAGTCTGTGG + Intronic
960929371 3:122829462-122829484 CACTGTGCCAGGCCTCTTGTGGG - Intronic
961472583 3:127125384-127125406 CACTGTGCCCAGCCAGGAACAGG - Intergenic
961532526 3:127547969-127547991 CACTGTGCCCGGGCTGCACTGGG + Intergenic
961736742 3:129006602-129006624 CACTGTGCCCGGCCAAAAGTGGG + Intronic
961767120 3:129220020-129220042 GACCGTGCCCAGCCAGCAGTGGG + Intergenic
961896996 3:130176124-130176146 CACCGTGCCCAGCCTGGATGAGG - Intergenic
962099176 3:132323927-132323949 CACTGTGCCCAGCCTAAAAGTGG - Intronic
962551874 3:136501891-136501913 CACTGTGCCCGGCCTATACTGGG - Intronic
962734158 3:138309394-138309416 CACTGTGCCCAGCCAACAGTGGG - Intronic
962846409 3:139278056-139278078 CACTGTGCCCAGCCCGCAGAAGG - Intronic
963101905 3:141615827-141615849 CACTGCGCCCAGCCTCTAATGGG + Intergenic
963205803 3:142632885-142632907 CACCGTGCCCAGCCTAGAGCAGG + Intronic
963631936 3:147744225-147744247 CACAGTGCCCAGCACATAGTAGG - Intergenic
963887285 3:150596868-150596890 CACTGTGCCCAGCCTTGCTTAGG - Intronic
964148706 3:153497936-153497958 CACTGTGCTGAGCGGGTAGTGGG - Intronic
964353273 3:155824000-155824022 CACCATGCCCAGCCTGCAATAGG + Exonic
964604642 3:158547302-158547324 TACTGTGCCCAGCATGAACTAGG - Intergenic
964640396 3:158904104-158904126 CACTGTGCCTGGCCTGTATATGG - Intergenic
964667330 3:159188798-159188820 CAATGTGCCCAGCTCATAGTAGG + Intronic
965376822 3:167935330-167935352 CTCTGTGCCCAGCCAATATTAGG - Intergenic
965444044 3:168752246-168752268 CACAGCGCCCAGCCTCTAGATGG + Intergenic
965458789 3:168934961-168934983 CACTGTGCCCAGCCTATTTCAGG + Intergenic
965516890 3:169630942-169630964 GACTTTGCCCAGCCTGTAAGAGG + Intronic
965623002 3:170659257-170659279 CACTGTGCCCAGCCTGAGCAAGG + Intronic
965638957 3:170812920-170812942 CACAGGGCCCAACATGTAGTAGG + Intronic
965674410 3:171179736-171179758 CACCGTGCCCGGCCTGTACCTGG + Intronic
965961044 3:174428988-174429010 CTCTGTGCCCATTATGTAGTAGG - Intergenic
965984452 3:174735283-174735305 CACATTGCCCAGCATGTATTAGG - Intronic
966162258 3:176981074-176981096 CACCGTGCCCAGCCTCTATGAGG - Intergenic
966180036 3:177179949-177179971 GACTGCACCCAGCCTGTAGTGGG - Intronic
966922995 3:184626657-184626679 CACCGCGCCCAGCCTGTGATGGG - Intronic
967579316 3:191133728-191133750 CACTGTGCCCAGCCTCTTCTAGG + Intergenic
967713490 3:192736712-192736734 CATTGTGCCCAGCATATAGCAGG + Intronic
967791355 3:193552258-193552280 CACCATGCCCAGCCTGTTTTTGG + Intronic
967925407 3:194641832-194641854 CACTGTGCCCGGCCAGGAGTAGG + Exonic
968238134 3:197050077-197050099 CACCGTGCCCGGCCTGTTTTTGG - Intronic
1202745230 3_GL000221v1_random:94641-94663 CACCGTGCCCGGCCTGTAAAGGG + Intergenic
968585338 4:1413755-1413777 CACAGTGCCCACCCTGTCGGAGG - Intergenic
968592997 4:1468923-1468945 CACAGTGCCCAGCCCTTAGTGGG - Intergenic
968680901 4:1918857-1918879 CACTGTGCCTGGCCTGTTCTCGG - Intronic
968728680 4:2259854-2259876 CACTGGGGCCAGCCTGCAGGGGG - Intronic
969155714 4:5208091-5208113 CAGTGTGTCCAGCCTGGACTGGG + Intronic
969183205 4:5457501-5457523 CACCGTGCCCAGCCTGCATGTGG + Intronic
969391033 4:6891489-6891511 CACCGTGCCCAGCCTAAAGCAGG + Intergenic
969435778 4:7188581-7188603 CCCAGTGCCCAGCCTGGAGCTGG + Intergenic
969461905 4:7333477-7333499 CACAGGGCCCAGCCTGCAGGAGG + Intronic
969686025 4:8674737-8674759 CAGTGAGCCCAGCCTGAAGGAGG + Intergenic
969724960 4:8913240-8913262 GGCTGTGCCTGGCCTGTAGTAGG - Intergenic
970722647 4:19006012-19006034 CACTGTGCCTGGCCTGTAAAGGG + Intergenic
971050626 4:22857972-22857994 CAATATGCCCAGCATGTAGTAGG + Intergenic
971192165 4:24437963-24437985 CACTGTGCCCGGCCTACAGCAGG + Intergenic
971389577 4:26173422-26173444 CACTGCGCCCGGCTTGCAGTAGG + Intronic
971874960 4:32296765-32296787 CACTGTGCCCAGCCTGACTATGG - Intergenic
972354056 4:38264019-38264041 CACGGTGCCCAGCCTGTACCTGG + Intergenic
972679047 4:41288103-41288125 CTCTGTGCCCAGCCTGTGGCTGG + Intergenic
972692991 4:41417810-41417832 CACTGTGCCCAGCCTCTAGAGGG + Intronic
972774645 4:42229791-42229813 CACCACGCCCAGCCTGTATTGGG - Intergenic
972799512 4:42460077-42460099 CACTGCGCCTGGCCTGTATTAGG + Intronic
972808567 4:42557752-42557774 CATGGTGCCCAGCCTGTTTTGGG - Intronic
973217641 4:47688309-47688331 CACTGTGCCCAGCCTAAATATGG - Intronic
973280437 4:48354750-48354772 CAGTGTGCCCAGCCTGTTATGGG + Intronic
973295257 4:48511985-48512007 CACAGTGCCTAGCAAGTAGTGGG + Intronic
973740799 4:53917464-53917486 AATGGTGCCCAGCATGTAGTAGG + Intronic
973758129 4:54094796-54094818 CTCTGTGCCCAGCGTGTGCTAGG - Intronic
974161582 4:58148697-58148719 CACTGTGCCCGGCCTCTTGATGG - Intergenic
974405698 4:61465831-61465853 CACTGCGCCCAGCCATGAGTTGG - Intronic
974609326 4:64195106-64195128 CACTGTGCCCAGCCTAATATGGG + Intergenic
974654205 4:64798708-64798730 CACCGTGCCCAGCCTGGTCTAGG - Intergenic
974831411 4:67193856-67193878 CACTGTGCTCAGCATATAGTAGG + Intergenic
974861505 4:67527534-67527556 CTCTGTACCCAGGCTGGAGTGGG + Intronic
974933543 4:68387396-68387418 CACTGTGCCCGGCCCGTTCTAGG - Intergenic
975873818 4:78812255-78812277 CACTGTGCCTGGCCTTTAATGGG + Intronic
976182349 4:82410818-82410840 CACTGCACCCAGCCAGTTGTGGG + Intergenic
976429597 4:84947222-84947244 CACTGTGCCCGGCCCCTAGCAGG - Intronic
976542642 4:86295885-86295907 CACTGTGCCCGGCCTCTGCTAGG - Intronic
976573951 4:86646584-86646606 CACTGTGCCCAGCCAGCAACTGG + Intronic
976828123 4:89283249-89283271 CAATGTGCCAGGCCTGTGGTGGG + Intronic
977303515 4:95295794-95295816 CACTGTGCCCAGCCACTTATGGG - Intronic
978450699 4:108829943-108829965 CACTGTGCCCAGCTTGTCCGTGG + Intronic
978486673 4:109262223-109262245 CACTGCGCCTGGCCTGTAGAAGG - Intronic
978514007 4:109552231-109552253 CACTGTGCCCAGCCTAAGGGCGG + Intergenic
978740769 4:112135593-112135615 CAAAGTGCCCAGTATGTAGTTGG - Intergenic
978774688 4:112493761-112493783 CACCGCGCCCGGCCTGTATTTGG - Intergenic
979003148 4:115253392-115253414 CACTGTGCCCAGCCTGTTGATGG - Intergenic
979261982 4:118658731-118658753 CACTGCGTCCAGCCAGTGGTGGG + Intergenic
979512992 4:121575269-121575291 CACCATGCCCAGCCTGTTTTTGG - Intergenic
979540534 4:121876185-121876207 CACTGTGCCCAGCCTGATTTTGG + Intergenic
980123410 4:128750689-128750711 CACCATGCCCAGCCTACAGTAGG + Intergenic
980141283 4:128920570-128920592 CACTGTGCCCAGCCTAGAAAAGG + Intronic
980468352 4:133216464-133216486 TACTGTGCCCAGCTTGTATATGG - Intergenic
980525168 4:133980867-133980889 CACTGTGCCCGGCCTTTTGGTGG - Intergenic
980938750 4:139252120-139252142 CACTGTGCCCAGCCTAATTTAGG + Intergenic
981425922 4:144603063-144603085 CACTGCGCCTAGCCAGTAGCAGG - Intergenic
981502469 4:145467115-145467137 AACTGTGCCCAGCATGCAGCAGG + Intergenic
981612999 4:146616163-146616185 AAGTGTGCCCAGTCTATAGTGGG + Intergenic
981999420 4:151008684-151008706 CACTGCGCCCAGCCTAGAGGTGG - Intronic
982183515 4:152773006-152773028 CACTGTGCCCGGCCTAAAGTAGG + Intronic
982340539 4:154293468-154293490 CACTGCGCCCGGCCGGTATTAGG + Intronic
983149851 4:164264629-164264651 CACTGCGTCCAGCCAGTGGTGGG - Intronic
983460748 4:168023142-168023164 CTCTGTCCCCAGCCTGTGATGGG + Intergenic
984556505 4:181220012-181220034 CACTGCACCCAGCCTGTAATAGG + Intergenic
984685660 4:182665605-182665627 CACCGTGCCCAGCCTCCAGGAGG - Intronic
985061154 4:186080878-186080900 CACCGCGCCCAGCCTGGAGGGGG + Intronic
985654936 5:1126117-1126139 CACTGCATCCAGCCTGGAGTGGG - Intergenic
986019608 5:3789144-3789166 CACTGGGCCCAGCCTGTGTAAGG - Intergenic
986333849 5:6738195-6738217 CACTGAGCCCAGTCAGCAGTAGG - Intronic
987486511 5:18533406-18533428 CACTGTGCTCAACCCGTTGTGGG - Intergenic
987523771 5:19021788-19021810 CACTGTGCCCAGCCAGTGATGGG + Intergenic
988141606 5:27249828-27249850 CACCGCGCCCGGCCTGTTGTTGG - Intergenic
988502449 5:31794693-31794715 CACTACGCCCAGCCCATAGTTGG + Intronic
989054143 5:37350512-37350534 CACTGTGCCCAGCCCATAACTGG - Intronic
989219729 5:38943523-38943545 CACCGTGCCCAGCCAGCTGTAGG - Intronic
989745111 5:44819978-44820000 CACTGTGCCAGGCCTGAGGTTGG + Intronic
990208995 5:53461201-53461223 CACCGTGCCCAGCCTAATGTAGG + Intergenic
990298925 5:54431409-54431431 CACTGTGCCCAGCCTGGACTGGG - Intergenic
991078122 5:62565194-62565216 CACTGTGCCTGGCCTGAATTTGG - Intronic
991091787 5:62700648-62700670 CACAGTGTCCAGCGTGGAGTAGG + Intergenic
991165599 5:63563113-63563135 CTCTGTGTCCAGCCTGTGGCTGG - Intergenic
991467154 5:66925705-66925727 CACTGTGCCTAGCATGTAACAGG + Intronic
991617880 5:68516191-68516213 CACTGTGCTCAGCCAATGGTAGG - Intergenic
992245885 5:74822067-74822089 CACTGTGCTCAGCCTTAAGAAGG - Intronic
992432945 5:76727383-76727405 CCCTGTGCCCTGCATGTGGTAGG - Intronic
992561150 5:77954200-77954222 CACTGTGCCCGGCCTATAAAGGG + Intergenic
992697365 5:79303349-79303371 CACTGTGCCCAGCCTGAGGAGGG + Intronic
992747779 5:79836078-79836100 CACCGTGCCTGGCCTGAAGTAGG + Intergenic
992773971 5:80073670-80073692 CACTGTGCCCAGCCCGGAGAGGG + Intronic
993118926 5:83751367-83751389 CACTGTGCCCGGACTATAGTAGG + Intergenic
993997491 5:94739954-94739976 CACTGTGCCCGGCCTGTTTAAGG + Intronic
994042751 5:95276543-95276565 CACTGCGCCCAGCCAATATTGGG + Intronic
994468930 5:100177457-100177479 CACTGCGCCCGGCCTATTGTGGG - Intergenic
995049132 5:107682544-107682566 CATTGTGCACAGCATGTAGTAGG + Intergenic
995151030 5:108845468-108845490 CACCGTGCCTGGCCTCTAGTTGG + Intronic
995153023 5:108873431-108873453 CACTGTGCCCAGCCAGGTTTTGG + Intronic
995198670 5:109401304-109401326 CACTGTGCCCAGGCTGTCATTGG - Intronic
995283844 5:110364527-110364549 CACTTTCCCCATCCTGTATTTGG + Intronic
996081371 5:119261700-119261722 CACTGTGCCCGGCCTCTACTAGG + Intergenic
996127032 5:119737809-119737831 CACCGTGCCCAGCCAATACTTGG + Intergenic
996942260 5:129022311-129022333 CACAGTGTCCAGCATATAGTTGG + Intronic
997172660 5:131739252-131739274 CACTGTGCCCAGCCTTAATTTGG - Intronic
997251375 5:132391259-132391281 CACAGTGCCCAGCCCATGGTAGG - Intronic
997314477 5:132920837-132920859 CACTGCGCCCGGCCTGAAATGGG - Intronic
997418486 5:133747906-133747928 CACTGTTCCCAGCCTGGGTTTGG - Intergenic
997441195 5:133909677-133909699 CACTGGGCTCAGCCTGCAGGGGG - Intergenic
997461705 5:134057189-134057211 CACCGTGCCCAGCCTTCACTTGG - Intergenic
997560257 5:134840269-134840291 CTCTGTCGCCAGGCTGTAGTGGG - Intronic
997930636 5:138069889-138069911 CACTGTGCCCAGCCGAGAGATGG - Intergenic
998122597 5:139591083-139591105 CACTGTGCCCAACCTATGGTGGG + Intronic
998191222 5:140026445-140026467 CACTGTGCCTGGCTTCTAGTTGG - Intronic
998254380 5:140573590-140573612 CACTGGGCCCAGCATACAGTGGG + Intronic
998510086 5:142705969-142705991 CACTGCGCCCAGCCTATACATGG - Intergenic
998563083 5:143189883-143189905 AACTGTGCCTAGCATGTACTAGG + Intronic
999283278 5:150379102-150379124 CACTGAGCCCAGCCAGGAGAAGG + Intronic
999343932 5:150798040-150798062 CACGGTGCCCGGCCTATAGATGG + Intergenic
999512289 5:152264838-152264860 AACGATGCCCAGCCTGAAGTTGG + Intergenic
1000406287 5:160891724-160891746 CACTGTGCCCAGCCAGAAACAGG + Intergenic
1000624592 5:163524801-163524823 CACTGTGCTCAGCTTGTGGCCGG + Intergenic
1000634924 5:163633063-163633085 CACTGCACCCAGCCTGTATGAGG + Intergenic
1000901031 5:166912147-166912169 CACTGTGCCCAGCCTGAATTAGG - Intergenic
1001043081 5:168350855-168350877 CACCGCGCCCAGCCTCTAGCTGG - Intronic
1001321974 5:170690093-170690115 CACGGTGCCCAGCACATAGTAGG + Intronic
1001335178 5:170790785-170790807 CACTGTGTTCAGTCTGTGGTTGG + Intronic
1001368116 5:171165464-171165486 CACCGCGCCCAGCCTAAAGTAGG + Intronic
1001549196 5:172590102-172590124 CACTCTTCCCAGCATGAAGTAGG + Intergenic
1001590942 5:172864766-172864788 CACTGTGCCCAGCATATAATAGG - Intronic
1001817484 5:174682291-174682313 CACTGTGCCCGGCCTGCTATGGG - Intergenic
1002137784 5:177118777-177118799 CACCATGCCCAGCCTAAAGTGGG - Intergenic
1002205267 5:177558632-177558654 CACTGCGCCCAGCCTGTACTGGG - Intergenic
1002433074 5:179215158-179215180 CACTGCACCCAGCCTGTTTTTGG - Intronic
1002732551 5:181351848-181351870 CACTGCGTCCAGCCAGTGGTGGG + Intergenic
1002751988 6:122260-122282 CACTGCGTCCAGCCAGTGGTGGG - Intergenic
1003080624 6:3018000-3018022 CAATGTGCACTGCCTGTAGAAGG - Intronic
1003269826 6:4598223-4598245 CACCATGCCCAGCCTGTTGTTGG + Intergenic
1003559333 6:7167970-7167992 CACCGTGCCCAGCCTGACATGGG - Intronic
1003609861 6:7602139-7602161 CACTGTACCCGGCCTGTATTAGG + Intronic
1003724915 6:8750285-8750307 TACTGCACCCAGCCTGCAGTAGG + Intergenic
1004139025 6:12998327-12998349 CACTGTGCCTAGCCTATTTTTGG - Intronic
1004196083 6:13506615-13506637 CACGGTGCCCAGCCCATACTAGG - Intergenic
1004342649 6:14821017-14821039 CACTGTGCCCAGCTCCCAGTGGG - Intergenic
1004385442 6:15168853-15168875 CACTGTGCCCAGCCTCAAAGTGG - Intergenic
1004459190 6:15819935-15819957 CACTGTGCCCAGCCGCTTGCTGG + Intergenic
1005013645 6:21358297-21358319 CACTGTGCCCGGCCTGCAGTTGG - Intergenic
1005088577 6:22032677-22032699 CACTGTGTCCGGCCTATTGTTGG + Intergenic
1005627338 6:27675421-27675443 CACTGTGCCTGGCCTTTTGTAGG + Intergenic
1005845468 6:29773612-29773634 CACCATGCCCAGCCTATAGCAGG - Intergenic
1006017713 6:31095525-31095547 CACTGTGCCTGGCCCATAGTTGG - Intergenic
1006200945 6:32290061-32290083 CACTGTGCCCAGCCACTACTAGG - Intronic
1006590951 6:35157234-35157256 CACCGTGCCCAGCCAGTTCTGGG + Intergenic
1006662149 6:35656599-35656621 CACTTTGCCCAGCCTGTTTGTGG - Intronic
1006666004 6:35693807-35693829 CACTGTGCCTGGCCTCTATTTGG + Intronic
1006933640 6:37702524-37702546 CCCTGTGCCTGGCCAGTAGTAGG + Intergenic
1006943165 6:37766131-37766153 CATTGGGCCCAGCCAGTTGTTGG - Intergenic
1007374520 6:41447226-41447248 AACAGTGCCCAGCCCATAGTAGG + Intergenic
1007388902 6:41538505-41538527 GACTGAGCCCATCCTGTAGCTGG - Intergenic
1007448702 6:41926804-41926826 CACTGTTCCCGGCCTGTAGAAGG - Intronic
1007462417 6:42028121-42028143 CACTGTGCCTAGCATGTGGTAGG + Intronic
1007539542 6:42628431-42628453 CACTGTGCCTGGCCAGTACTGGG - Intronic
1007626999 6:43252335-43252357 CACTGTGCCCGGCCAGAAGGGGG - Intronic
1007649556 6:43410301-43410323 CACTGCACCCAGCCTGAAGTTGG - Intergenic
1008253472 6:49268872-49268894 CACCGTGCCCAGCCAATAGGAGG - Intergenic
1008508794 6:52256797-52256819 CACCGCACCCAGCCTGTATTAGG + Intergenic
1008726670 6:54429894-54429916 AACAGTTCCTAGCCTGTAGTTGG + Intergenic
1008946917 6:57108125-57108147 CACAGTGCCCGGCCTGTATTTGG + Intronic
1009821027 6:68801397-68801419 CACTGCGCCCAGCCTGGATATGG - Intronic
1009866348 6:69402323-69402345 CGCTGCGCCCAGCCTGTTTTAGG - Intergenic
1010725587 6:79328962-79328984 CACTGTGCCCAGCCCTTAGCAGG + Intergenic
1011074187 6:83420354-83420376 CACTGCGCCCAGTCTGTAGGTGG + Intronic
1011273326 6:85602588-85602610 CACTGTGCCCAGCCTAATTTTGG - Intronic
1011609450 6:89136387-89136409 CACTGCGCCCGGCCTCTGGTTGG - Intergenic
1011787582 6:90864275-90864297 GACAGTGCCAAGCTTGTAGTAGG + Intergenic
1012055461 6:94402385-94402407 AACAGTGCCTAGCATGTAGTAGG - Intergenic
1012291466 6:97460545-97460567 CACAGTGCCTGGCATGTAGTAGG + Intergenic
1012921861 6:105228291-105228313 CACTGTGCCCAGCCAATAGAAGG - Intergenic
1013248019 6:108306190-108306212 CACTGTGCCCAGCCTCAAGATGG + Intronic
1013419253 6:109951207-109951229 CTGTGTGCCCAGCCTGTGCTGGG + Intergenic
1013537566 6:111077344-111077366 CACCGTGCCCAGCCAGCATTGGG - Intergenic
1013792024 6:113848154-113848176 CACCGAGCCCGGCCTGTAGTTGG + Intergenic
1013792230 6:113850738-113850760 CACTGCCCCCAGCCTGTAGTAGG - Intergenic
1014226559 6:118854639-118854661 CATTGTGCCCAGCCTCATGTAGG + Intronic
1014260585 6:119212126-119212148 CACTGTGCCCGGCCAATAGTAGG + Intronic
1014582212 6:123152799-123152821 CACTGCGCCCAGCCTATACATGG - Intergenic
1014637668 6:123868154-123868176 CACTGTGCCCAGCCTGTACTGGG + Intronic
1015125262 6:129747348-129747370 CACTGTGTCCAGCTTGGAGCTGG - Intergenic
1015301851 6:131661576-131661598 CACTGTGCCCAGCCTCATTTTGG + Intronic
1015511784 6:134044780-134044802 CACTGTGCCTCTCATGTAGTAGG + Intronic
1015595419 6:134861562-134861584 CACCACGCCCAGCCTGTAGTAGG - Intergenic
1015661876 6:135584713-135584735 CACTGCACCCAGCCTACAGTAGG - Intergenic
1015764295 6:136699563-136699585 CAGTGAGCCCAGGCTGTAGTGGG - Intronic
1015769304 6:136752698-136752720 CACTGGGCCCAGCCTTTAGCTGG + Intronic
1015996447 6:138999592-138999614 CACTTTGCCCAGGCTGCATTTGG + Intergenic
1016205700 6:141466313-141466335 CACTGTGCTCAGCCCCTTGTGGG + Intergenic
1016423560 6:143911039-143911061 CACTGCGCCCAGCCCTTTGTTGG + Intronic
1016544314 6:145203397-145203419 CACCATGCCCAGCCTGTACCCGG - Intergenic
1016740663 6:147525382-147525404 CAATTTGGCCAGCCTGGAGTGGG + Intronic
1016977937 6:149827238-149827260 CACCATGCCCAGCCTTAAGTGGG + Intronic
1017028206 6:150198887-150198909 CACAGTGCCCTGCCTGCAGTAGG + Intronic
1017035413 6:150262813-150262835 CACCGTGTCCAGCCTGTAGAAGG - Intergenic
1017046952 6:150355991-150356013 CACTGTGCTCAGCCCCTTGTGGG + Intergenic
1017166579 6:151413526-151413548 CACCGTGCCCAGCCAGTAAGTGG + Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017426007 6:154322226-154322248 CACCTTGCCCAGCCTGTAGGTGG - Intronic
1017559035 6:155606974-155606996 CACTACTCCCAGCCTGGAGTTGG - Intergenic
1017831674 6:158136096-158136118 CACTGCGCCCAGCCAGTAATTGG + Intronic
1017839634 6:158210691-158210713 TACTGTGCCCAGCCTTTCTTGGG + Intergenic
1018206875 6:161444637-161444659 CACTGTGCTCAGCCTGTCTGCGG + Intronic
1018587373 6:165376624-165376646 CGCTGTGCCCAGCCTGGATGTGG - Intronic
1018830639 6:167440564-167440586 CACTGCGCCCAGCCAGTAAAAGG - Intergenic
1018884893 6:167926876-167926898 CACAGTCCCCAGCATATAGTAGG + Intronic
1019236803 6:170624167-170624189 CACTGTGTCCAGCCAGTGGTGGG + Intergenic
1019525122 7:1477312-1477334 CACTGTGACCAGCCAGATGTGGG - Intronic
1019960649 7:4456625-4456647 CACTGTGCCCGGCCTGAAGTGGG + Intergenic
1020127757 7:5542368-5542390 CACTGCGCCCGGCCTCTAGGCGG + Intronic
1020327678 7:6987796-6987818 CACCGTGCCCAGCCTGGATGAGG - Intergenic
1020334560 7:7052681-7052703 CACTGCGCCCAGCCTTTTATTGG - Intergenic
1020397049 7:7728355-7728377 CACTGTGCCCGGCCTGAGATAGG - Intronic
1020413339 7:7917260-7917282 CACCGTGCCCAGCCTGAATATGG - Intronic
1020819410 7:12946955-12946977 CACTGTGCCCGGCCTCTTGCAGG + Intergenic
1021221355 7:17978526-17978548 CACCGTGCCCAGCCCCCAGTAGG - Intergenic
1021462939 7:20909584-20909606 GAATGTGCTCAGCCTGTAGAAGG - Intergenic
1021478459 7:21089294-21089316 CACAGTGCCCAGCATGTGGTTGG + Intergenic
1021706256 7:23370965-23370987 CACTGCGCCCAGCCAGTTCTAGG + Intronic
1021852166 7:24818964-24818986 CACTGCGCCCAGCCAAAAGTTGG - Intronic
1022155677 7:27660373-27660395 CACTGTGCCCGGCCTTTCTTTGG - Intronic
1022165225 7:27753009-27753031 CACTGTGCCCAGCCTGCATCAGG - Intronic
1022213884 7:28239023-28239045 CACCGTGCCCAGCCTCTGGGAGG - Intergenic
1022251337 7:28611361-28611383 CACTGTGCCCGGCCTCTACCTGG - Intronic
1023027061 7:36060389-36060411 CACTGCGCCCGGCCAATAGTAGG - Intergenic
1023196764 7:37648860-37648882 CACTGTGCCCGGCCAGCATTAGG + Intergenic
1023518987 7:41031966-41031988 CCCTGTGCCCAGTATCTAGTAGG + Intergenic
1023529972 7:41142723-41142745 CACTGTGCCCAGCCTGGGATTGG + Intergenic
1023613364 7:41993633-41993655 AACAATGCCCAGCCTATAGTAGG + Intronic
1023678352 7:42654884-42654906 CACTATGCCCAGCCTAAAATAGG + Intergenic
1023719859 7:43081621-43081643 CACCGTGCCCAGCCTTTTGATGG + Intergenic
1023782722 7:43672481-43672503 CACTGTGCCTGGCCTGTTGAGGG - Intronic
1023862070 7:44222730-44222752 CACTGTGCCCAGCCAGAAGAGGG + Intronic
1023970634 7:44988258-44988280 CACCGCGCCCAGCCTGTTGTAGG - Intergenic
1024035114 7:45501377-45501399 CACCGTGCCCAGCCTGTACTGGG - Intergenic
1024200636 7:47102792-47102814 CACTGTGCCCAGCCAGAAATAGG - Intergenic
1024264458 7:47596173-47596195 CACTGTGCCCGGCCGGTCTTAGG - Intergenic
1024289144 7:47787997-47788019 CACTGTGTCCGGCCTGTTGTAGG + Intronic
1024504123 7:50146857-50146879 CACAGTGCCCAGCATGCAGCAGG - Intronic
1025092711 7:56076931-56076953 CACAGTGCCCAGCCTCCAGCAGG - Intronic
1026231267 7:68486040-68486062 CACGGTGCCCAGCATGGTGTTGG - Intergenic
1026243083 7:68594221-68594243 CACTGAGCCCGGCCTGTTCTAGG + Intergenic
1026332007 7:69360280-69360302 CACCGTGCCCAGCCTGGATTTGG + Intergenic
1026401972 7:70023131-70023153 CACTGTGCCCAGCCTCTAATTGG + Intronic
1026513843 7:71049742-71049764 CACAGGGCCCAGCCTGGAGCTGG - Intergenic
1026578509 7:71594576-71594598 CACTGTGCCCAGCCAGAACCAGG + Intronic
1026628420 7:72016862-72016884 CACCGTGCCCAGCCTGGTCTAGG - Intronic
1026798427 7:73380875-73380897 CACCGTGCCCAGCCTTTTATGGG - Intergenic
1026960225 7:74403280-74403302 CACTGCGCCCAGCCAGAAGCAGG - Intronic
1026963471 7:74424537-74424559 CACTGTGCCCTGCCCGAAGCAGG + Intergenic
1027178136 7:75917873-75917895 CACTGTTCCCAGCCTAGAATTGG - Intronic
1027183417 7:75955128-75955150 CACTGTACCCAGCCTAGAATTGG + Intronic
1027219272 7:76203630-76203652 CATTGTGCCCAGCATGGAGCTGG - Intronic
1027300746 7:76831034-76831056 CACTGTGTCCAGTATGCAGTTGG - Intergenic
1027980560 7:85214782-85214804 CACCGTGCCCGGCCTGTTTTTGG + Intergenic
1027997768 7:85447725-85447747 CTCTGGCCCCAGCCTGTAGCTGG + Intergenic
1028149766 7:87358187-87358209 CACTGCGCACGGCCTGTACTTGG - Intronic
1028421928 7:90642666-90642688 CACTGTGCCTAGCATGAATTGGG + Intronic
1029009531 7:97243922-97243944 CACTGTGCCCAGCCAAGAGTTGG + Intergenic
1029136714 7:98378020-98378042 CACAGTTCTCAGCCTGTAGCTGG - Intronic
1029597717 7:101546562-101546584 CACTGTGCCCAGCCTGGGGAAGG + Intronic
1029598820 7:101551873-101551895 CACTGTGGCCAGCACATAGTAGG - Intronic
1029615235 7:101652314-101652336 CACTGCACCCAGCCTACAGTTGG - Intergenic
1029629731 7:101742865-101742887 CACTGCGCCCAGCCTCCAGTGGG - Intergenic
1029636274 7:101786439-101786461 CACCGTGCCCAGCCTGAACTTGG - Intergenic
1030029733 7:105357934-105357956 CACTGTGCCTGGCCTGTATGTGG - Intronic
1030628574 7:111870608-111870630 CACTGTGCCCAGCCAGTTCTTGG + Intronic
1031000115 7:116405267-116405289 CACCGTGCCCAGCCTGATTTAGG + Intronic
1031596958 7:123659634-123659656 CACAGTGCTTAGCATGTAGTAGG - Intronic
1031958739 7:127969435-127969457 CACTGCGCCCAGCCTAAAGCTGG - Intronic
1032403497 7:131639655-131639677 CACTGTGCCTGGCCTATTGTAGG - Intergenic
1032586347 7:133150642-133150664 TACTGTGCTCAACCCGTAGTAGG + Intergenic
1032673515 7:134107231-134107253 CACTGTGGCCAGCCGGTTCTTGG + Intergenic
1033058053 7:138078248-138078270 CACTATGCTCAGCCAGGAGTTGG + Intronic
1033103457 7:138497681-138497703 CACCGCGCCCAGCCTGTTGTTGG + Intronic
1033568691 7:142605604-142605626 CACTGTGCTCAGCCTCAGGTAGG - Intergenic
1033623132 7:143080459-143080481 CACTGTGGCCAGCCAGGAGCAGG - Intergenic
1033834151 7:145288506-145288528 CACCGTGCCCGGCCTGTTCTGGG - Intergenic
1034057061 7:148046232-148046254 CATTGTGCCCAGCCAGTACCTGG + Intronic
1034275871 7:149823649-149823671 CACTGTGCCCCGCCTGCAGCAGG - Intergenic
1034293160 7:149948310-149948332 CCCTGTGCCCATGCTGCAGTGGG - Intergenic
1034627200 7:152502870-152502892 CACTGTGCCCGGCCTGTACTTGG - Intergenic
1034748159 7:153542511-153542533 CACTGTGCCCGGCCAGTACGTGG + Intergenic
1034812912 7:154148569-154148591 CCCTGTGCCCATGCTGCAGTGGG + Intronic
1034819373 7:154202673-154202695 CAGTGGCCCCGGCCTGTAGTAGG - Intronic
1034843524 7:154421854-154421876 CCCAGTGCCCAGCATGTTGTAGG + Intronic
1034869304 7:154669513-154669535 CACTGTACTCAGCCTGTACATGG + Intronic
1035123376 7:156588756-156588778 CACCATGCCCAGCCTGGACTGGG - Intergenic
1035224826 7:157427244-157427266 CACTGTGCCCAGCTTGCTGATGG + Intergenic
1035295633 7:157865533-157865555 GACTGTGCCGAGCCTGTCGGGGG + Intronic
1035496160 7:159328703-159328725 CACCGTGCCCAGCCTGTGTATGG - Intergenic
1035510969 8:182443-182465 CACTGCGTCCAGCCAGTGGTGGG - Intergenic
1035790080 8:2296679-2296701 CACTGAGCCCGGCCTATACTTGG - Intergenic
1035802725 8:2425026-2425048 CACTGAGCCCGGCCTATACTTGG + Intergenic
1035810892 8:2490145-2490167 CACCGTGCCCAGCCTGAAATAGG + Intergenic
1036045511 8:5135611-5135633 CTCTGTGCCCAGGCTGCAGTGGG + Intergenic
1036515587 8:9440490-9440512 CACCGCGCCCAGCCTCTTGTAGG - Intergenic
1036587886 8:10141857-10141879 CACTGTGCCTAGCTGGTAGTAGG + Intronic
1037336141 8:17794037-17794059 CACTGTGCCCGGCCTGTGTTTGG - Intronic
1037487606 8:19363363-19363385 CACTGTGCCCGGCCTTATGTTGG + Intronic
1037537024 8:19834091-19834113 CATAGTCCCCACCCTGTAGTAGG - Intronic
1037624530 8:20595531-20595553 CACTGTGCCCGGCCTACAGCTGG + Intergenic
1037818481 8:22124381-22124403 CACCGCGCCCAGCCAGGAGTGGG + Intronic
1037860505 8:22402091-22402113 TACTGCGCCCAGCCTATAATGGG - Intronic
1038291367 8:26252628-26252650 CACTGTGCCTGGCCTGTAGTGGG - Intergenic
1038611553 8:29064064-29064086 TACAGTGACCAGCCTGAAGTGGG - Intronic
1038964195 8:32552880-32552902 CACAGTGCCTGGCATGTAGTAGG - Intronic
1039917098 8:41868145-41868167 CATTGTACCCAGCCTGAAGCAGG + Intronic
1040002985 8:42594952-42594974 CACTGTGCCCCGCCTATTATCGG + Intergenic
1040035454 8:42865693-42865715 CACTGTGCCCGGCCTTAACTTGG - Intronic
1040475158 8:47769862-47769884 CACTGTGCCCGGCCAGCTGTGGG - Intergenic
1040549347 8:48426696-48426718 CACTGTCCCCAGCCTGGGATGGG - Intergenic
1040967018 8:53093024-53093046 CACAGTGCCCGGCCTGTGGATGG + Intergenic
1041053134 8:53956857-53956879 CACTGTGCCCGGCCTGTTTTTGG - Intronic
1041058984 8:54017630-54017652 CACTGAGCCCAGCCTTTTTTGGG - Intronic
1041265103 8:56057068-56057090 CACTGTGCCCAGCCTCTTCTGGG - Intergenic
1041718797 8:60957470-60957492 CACCGCGCCCAGCCTGGACTTGG + Intergenic
1041987813 8:63946997-63947019 CACTGTGCCCAGCTTGTGAAAGG + Intergenic
1042351453 8:67781516-67781538 CACTGTGCCTAGCCTAGAGATGG + Intergenic
1042491118 8:69398987-69399009 CACAGTGGCCAGCTTTTAGTAGG - Intergenic
1042727164 8:71890523-71890545 CACCGTGCCCAGCCTGGTTTTGG - Intronic
1042904460 8:73758865-73758887 CACTGTGCCCAGCCAGTCTAAGG + Intronic
1043843979 8:85143034-85143056 CACTGCACCCAGCCTGCATTTGG - Intronic
1044448521 8:92306372-92306394 CACAGTGCCTAGCACGTAGTAGG - Intergenic
1044961397 8:97534476-97534498 CACTGTGCCCAGCCTGATGATGG - Intergenic
1045008334 8:97935774-97935796 CACTGTGCCTGGCCTGTAAGTGG + Intronic
1045136356 8:99223114-99223136 CACTGTACCCAGCCTGATATAGG + Intronic
1045972199 8:108091718-108091740 CACTGCACTCAGCCTGTAGCTGG - Intergenic
1046279499 8:112007171-112007193 CACGACGCCCAGCCTGTAATTGG + Intergenic
1046434749 8:114173118-114173140 CACCGTGCCCAGCCTGTAATTGG - Intergenic
1046684241 8:117206903-117206925 CACTGTGCCCAGCCCCTAAATGG - Intergenic
1046806190 8:118481366-118481388 CAGTGTTCTCAGCGTGTAGTAGG + Intronic
1047094579 8:121610121-121610143 CACAGTGCCCAGCCTATAACAGG + Intergenic
1047105725 8:121728401-121728423 CACTGTACCCAGCCGCTAGAAGG - Intergenic
1047179621 8:122574462-122574484 CACTGTGCCCAGCCAGCAGCTGG + Intergenic
1047243697 8:123119012-123119034 CACTGTGCCCAGCCTAGAAATGG + Intronic
1047320034 8:123770237-123770259 CACAGTGCCCAGCCAGTATGAGG + Intronic
1047339002 8:123962175-123962197 CACTGTGCCCAGCCTGTCTGTGG + Intronic
1047406786 8:124592072-124592094 CACCATGCCCAGCCAGTAATAGG + Intronic
1047412264 8:124633479-124633501 CACTGTGCCCGGCCTATGATAGG - Intronic
1047629757 8:126694175-126694197 CACTGCGCCCAGCCTGCACAGGG + Intergenic
1047800189 8:128301221-128301243 CAGTGTAGCCAGACTGTAGTTGG + Intergenic
1048212546 8:132467435-132467457 CACTGAGCTCAGCCTTGAGTTGG - Intronic
1048240924 8:132741074-132741096 CACTGTGCCCAGCCCTGAGTGGG - Intronic
1048293240 8:133196159-133196181 CACTGTGCCCAGAGTAGAGTGGG - Intronic
1048454388 8:134564880-134564902 CACAGTGCCCAGCATGTTGCAGG - Intronic
1048703400 8:137120718-137120740 AGCTGTGTCCAGCATGTAGTTGG + Intergenic
1049371405 8:142269615-142269637 CACTGTGCCCAGGCCATGGTGGG + Intronic
1049474640 8:142791006-142791028 AACTGTGTCCAGCCTGTGGTAGG + Intergenic
1049672930 8:143877781-143877803 CACTGTGCCAAGCTTGTTATTGG - Intronic
1049748195 8:144271841-144271863 CTGTGTGCCCAGCCTCTAGAAGG - Intronic
1050104489 9:2151441-2151463 CACTGTGCCCAGCCTCAATCTGG - Intronic
1050247694 9:3708311-3708333 CACTGTGCCCCGCCTCCAGAGGG - Intergenic
1050278502 9:4025421-4025443 CTCTGTGGCCAGGCTGGAGTGGG + Intronic
1050373087 9:4942359-4942381 CACTGTTCCCGGCCTGTAGGTGG + Intergenic
1050633955 9:7590303-7590325 CACAGTGGCCAGCATATAGTAGG - Intergenic
1050966450 9:11809957-11809979 CACTGCGCTCAGCCAGTATTTGG + Intergenic
1051172188 9:14329833-14329855 CACTGTGCCCGGCCTGTTACTGG - Intronic
1051288019 9:15515668-15515690 CACTGTGCCCAACGTCCAGTGGG + Intergenic
1051881480 9:21844744-21844766 CACCGTGCCCAGCCCATAGATGG - Intronic
1052182501 9:25546827-25546849 CACCGTGCCCAGCCTGTGCATGG + Intergenic
1052514359 9:29460969-29460991 AACTGTGCCCAGCCAATAGTAGG + Intergenic
1052548949 9:29922210-29922232 CACTGTGCCCGGCCTATACATGG + Intergenic
1052638326 9:31131207-31131229 CACCGTGCCCAGCGTGTACAAGG + Intergenic
1052950681 9:34208352-34208374 CACTGTGCCCGGCCTCCAGTGGG - Intronic
1053206033 9:36187315-36187337 CACTGTGCCTGGCCTGGATTAGG + Intergenic
1053266790 9:36721077-36721099 CACCATGCCCAGCCTTGAGTGGG - Intergenic
1053518695 9:38754609-38754631 CACTGTGCCCAGCCTAGAGATGG + Intergenic
1053550008 9:39067682-39067704 CACTGTGCCCGGCCTGGTGTTGG + Intergenic
1053648734 9:40141588-40141610 CACCGTGCCCAGGCTGTAGCGGG - Intergenic
1053674698 9:40412295-40412317 CACCGCGCCCAGCCATTAGTAGG - Intergenic
1053757010 9:41322254-41322276 CACCGTGCCCAGGCTGTAGCGGG + Intergenic
1053814121 9:41887775-41887797 CACCGTGCCCGGCCTGGTGTTGG + Intergenic
1053819338 9:41951040-41951062 CACCGTGCCCAGCCAATAGGAGG + Intronic
1054329714 9:63739529-63739551 CACCATGCCCAGGCTGTAGCGGG - Intergenic
1054385802 9:64552362-64552384 CACCGCGCCCAGCCATTAGTAGG - Intergenic
1054509922 9:65963999-65964021 CACCGCGCCCAGCCATTAGTAGG + Intergenic
1054535847 9:66234582-66234604 CACCGTGCCCAGGCTGTAGCGGG + Intergenic
1054616475 9:67299665-67299687 CACCGTGCCCGGCCTGGTGTTGG - Intergenic
1054978152 9:71172188-71172210 CACTGTGCCCAGCGCATAGAAGG + Intronic
1055013362 9:71590967-71590989 CACTGTGCCCAGCCCTGAATTGG + Intergenic
1055116934 9:72614966-72614988 CACTGAGCCCAGCCAGTTATAGG + Intronic
1055624881 9:78166009-78166031 CACCGTGCCCAGCCTGGATTAGG + Intergenic
1055684991 9:78763070-78763092 CTCTGTGCCTAGCTTGTAGATGG - Intergenic
1055799738 9:80021962-80021984 CACTGTGCCCAGCCTATTCTTGG + Intergenic
1055933425 9:81582933-81582955 TACTGAGGCCAGCATGTAGTGGG + Intergenic
1056160597 9:83887991-83888013 CACTGTGCCCAGCCGGTAGTAGG - Intronic
1056370155 9:85945805-85945827 CACTGTGCCCAGCCTGACTCTGG + Intronic
1056772239 9:89486615-89486637 CACTGTGCCCAGCCTGTCTGGGG - Intronic
1056956183 9:91083351-91083373 CACTGTGCCCAGCCCCTTGCGGG + Intergenic
1057021797 9:91704671-91704693 CACTGTGCCCAGCCAGTCTTAGG + Intronic
1057028481 9:91755499-91755521 CACTGTGGCCAGGCTGTCTTGGG - Intronic
1057074019 9:92125533-92125555 CACTGTGCCCAGCCTACAATAGG - Intergenic
1057085370 9:92205023-92205045 CACTGTGCCCAGCCTACAATAGG + Intergenic
1057722715 9:97545855-97545877 CTCTGTGCTCAGACTGGAGTCGG + Intronic
1058014114 9:100010611-100010633 CACCGTGCCCAGCCTGTCCCTGG - Intronic
1058034836 9:100239682-100239704 CACTGTGCCCAGCCTGGCACAGG - Intronic
1058090056 9:100795657-100795679 CACTGTGCCTAGCCTATAGTTGG + Intergenic
1058445743 9:105053432-105053454 CACTGAGCCCAGCCTGGGCTGGG - Intergenic
1058456016 9:105138934-105138956 CACTGCACCCTGCCTGGAGTTGG - Intergenic
1058721636 9:107769588-107769610 CACAGTGCCCAGCATCCAGTAGG - Intergenic
1058768749 9:108209500-108209522 CACAGGGCCCAGTCTGTAGTAGG + Intergenic
1059115216 9:111595141-111595163 CACCATGCCCAGCCTGTTTTTGG + Intronic
1059226533 9:112678090-112678112 CACTGTGCCCAGCCTAAAATTGG - Intergenic
1059511789 9:114855170-114855192 CACCGTGCCCAGCCTGTTACTGG + Intergenic
1059676931 9:116548760-116548782 CACTGTGCCCGGCCTGGGGAAGG + Intronic
1059931864 9:119268777-119268799 AACTGTGCCCAGCACTTAGTAGG + Intronic
1059960768 9:119562408-119562430 CAGTGAGCTCAGCCTGTGGTAGG + Intergenic
1059983256 9:119796394-119796416 CACTGTACCCAGCTAGTACTAGG + Intergenic
1060014287 9:120073016-120073038 AACTGTGCCTGGCATGTAGTGGG - Intergenic
1060181119 9:121534452-121534474 CACTGTGCCCAGCCTGAGATTGG + Intergenic
1060230730 9:121823255-121823277 CACTGCGCCCAGCCAGGAGCTGG - Intronic
1060317709 9:122528306-122528328 CACTGTGCCCAGCCGGGATCAGG - Intergenic
1060367111 9:123028274-123028296 CCCTGTGCCAACCCTGTGGTAGG + Intronic
1060459258 9:123833770-123833792 CTCTGTGCCCGGCCTGAAGCTGG - Intronic
1060519269 9:124284817-124284839 CACTGGTGCCAGCCTGGAGTTGG - Intronic
1060594375 9:124839630-124839652 CACTGCACCCAGCCTCAAGTGGG + Intergenic
1060835434 9:126752109-126752131 CACCATGCCCAGCCTGTTTTGGG + Intergenic
1060998577 9:127889058-127889080 CACCGTGCCCAGCCTGTTCTAGG - Intronic
1061205432 9:129160427-129160449 CACTGTGCCCGACCAGAAGTGGG + Intergenic
1061241059 9:129372749-129372771 CACTGTGCCCTGCCTACACTGGG + Intergenic
1061257832 9:129463073-129463095 CACTGTGCCCAGCCAGCATGAGG + Intergenic
1061300090 9:129699132-129699154 CACTGCGCCCAGCCTATTGATGG - Intronic
1061465098 9:130772040-130772062 CACTGCGCCCAGCCAAAAGTTGG + Intronic
1061786570 9:133032214-133032236 CACCGTGCCCAGCCTGGAATGGG + Intronic
1061851598 9:133419126-133419148 CACCGTGCCCGGCCGGGAGTGGG + Intronic
1062298236 9:135847057-135847079 CACCGTGCCCGGCCTATAGTAGG - Intronic
1062575086 9:137202600-137202622 CACTGTGTCCAGCCTGGGATTGG - Intronic
1062756953 9:138304173-138304195 CACTGCGTCCAGCCAGTCGTGGG + Intergenic
1202796498 9_KI270719v1_random:124886-124908 CACCATGCCCAGGCTGTAGTGGG - Intergenic
1203713854 Un_KI270742v1:124592-124614 CACTGTGCCCGGCCTGTAAAGGG + Intergenic
1185520141 X:732507-732529 CACTGTGCCCAGCCTGCTCCAGG - Intergenic
1185558208 X:1037932-1037954 CACCGTGCCCAGCCTATATATGG - Intergenic
1185586575 X:1245677-1245699 CACTGCGCCCAGCCTATAAACGG + Intergenic
1185691722 X:2160604-2160626 CACCGTGCCCAGCCTTTTGATGG - Intergenic
1185802942 X:3029817-3029839 CACCGTGCCTGGCCTGCAGTAGG + Intronic
1186106377 X:6211955-6211977 CACTGTGCCCAGCCTCAAGGAGG - Intronic
1186245833 X:7616094-7616116 CACTGTGCCCAGCCAGCCCTGGG - Intergenic
1186284704 X:8031106-8031128 CACTGTGCACAGACTAAAGTGGG + Intergenic
1186284707 X:8031140-8031162 CACTGTGCACAGACTAAAGTGGG + Intergenic
1186293931 X:8128305-8128327 CACTGTGCCCGGCCCTTAGCTGG + Intergenic
1186362716 X:8859285-8859307 CACTGTGCCCAGCCTATCTTTGG + Intergenic
1186367523 X:8911023-8911045 CACTGTGCCAGGCTTGTCGTGGG - Intergenic
1187074556 X:15921214-15921236 CACCGCGCCCAGCCTTTTGTGGG + Intergenic
1187284367 X:17889945-17889967 CACTGTGCCCAGCCTAATATTGG - Intergenic
1187463532 X:19508458-19508480 CACCGTGCCCGGCCTGGAGATGG + Intronic
1187792103 X:22962448-22962470 CACCGCGCCCAGCCTTTTGTTGG - Intergenic
1188309135 X:28596090-28596112 CATTGTGCACAGCATATAGTAGG + Intronic
1189282920 X:39831869-39831891 CATTGTGCCCTGCCTGTAGTAGG - Intergenic
1189360432 X:40345872-40345894 CACTGTGCCCGGCCTTCTGTAGG + Intergenic
1189495419 X:41504075-41504097 CACTGTGCCCCACCTATATTTGG + Intergenic
1189818933 X:44851097-44851119 CACTGTGCCCAGCCAGATATGGG + Intergenic
1190041350 X:47074829-47074851 CACTGTGCCTGGCCTATAGTAGG + Intergenic
1190106570 X:47565138-47565160 CAGTGAGCCCAGCCTGGGGTGGG + Exonic
1190337916 X:49273945-49273967 CACTGTGCCCAGCACACAGTAGG - Intronic
1190618288 X:52261335-52261357 CACTGTCCCCAGGTTGTACTGGG - Intergenic
1190794589 X:53729152-53729174 CACTGTGCCCAGCCAGTGTCAGG + Intergenic
1190848297 X:54214722-54214744 CACCGCGCCCAGCCTGGAGATGG - Intronic
1190877808 X:54471987-54472009 CACTGTGCCCAGCCAGAAGTTGG - Intronic
1192095153 X:68202781-68202803 CACTGTGTCCAGCCTATGCTAGG + Intronic
1192110547 X:68359566-68359588 CACTGCACCCGGCCTGTACTAGG - Intronic
1192131178 X:68552600-68552622 CACTATGCCCAGCCTGATGATGG - Intergenic
1192205006 X:69089761-69089783 CACAGTGCCCAGCCTGTCTGTGG - Intergenic
1192531377 X:71889771-71889793 CACTGTGCCCAGCCAGTTTTTGG + Intergenic
1193071666 X:77312643-77312665 CACTGTGCCCAGCCTGATGTAGG - Intergenic
1193166324 X:78284971-78284993 AACTTTACCCAGACTGTAGTAGG - Intronic
1193494783 X:82197712-82197734 CACTGCGCCCAGCCCTTAGTGGG + Intergenic
1194583533 X:95705411-95705433 CACTGCGCCCGGCCAGTACTGGG - Intergenic
1194724051 X:97373888-97373910 CACTGTGCCCGGCCTGAGGGAGG + Intronic
1195265464 X:103175304-103175326 CACTGTGCCCAGCCAGAGTTGGG - Intergenic
1195674895 X:107500503-107500525 CACGGCGCCCAGCCTGAAGTAGG - Intergenic
1195776728 X:108414489-108414511 CACTGTGTCCAGCCAGGGGTAGG - Intronic
1197193511 X:123675350-123675372 CACTGTGCCCAGCCTAGATAAGG - Intronic
1197776863 X:130123944-130123966 CACTGTGCCCAGCCTATTCTAGG - Intergenic
1198047360 X:132916019-132916041 CACTGGGCCCAGCCTATCATTGG + Intronic
1198065724 X:133094804-133094826 CACTGTGCCCAGCCCGTTTGTGG - Intronic
1198205163 X:134459013-134459035 CACAGTGCCCAGCACATAGTTGG - Intergenic
1198211823 X:134523359-134523381 CACCATGCCCAGCCTACAGTTGG + Intergenic
1198398111 X:136243414-136243436 CACTGTGCCCAGCCTATTATAGG - Intronic
1198673991 X:139112308-139112330 CACAGTGCCCAACATATAGTAGG + Intronic
1198699681 X:139383184-139383206 TACTGTGCCCAGCATGTAACAGG + Intergenic
1199777565 X:151028817-151028839 CACTGCGCCCAGCCATCAGTAGG - Intergenic
1200224100 X:154407525-154407547 CACTGCGCCCAGCCAGTGCTGGG + Intronic
1202060549 Y:20883293-20883315 CACTGAGCCCAGCCAGTAAAAGG - Intergenic
1202305008 Y:23459885-23459907 CACTGTGCCCAGCCTAAAAAAGG - Intergenic
1202384068 Y:24307208-24307230 CACTGCGTCCAGCCAGTGGTGGG + Intergenic
1202486715 Y:25362912-25362934 CACTGCGTCCAGCCAGTGGTGGG - Intergenic
1202565802 Y:26210705-26210727 CACTGTGCCCAGCCTAAAAAAGG + Intergenic