ID: 1100878944

View in Genome Browser
Species Human (GRCh38)
Location 12:98995006-98995028
Sequence TCTGAGTGAATGAGTTAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 241}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100878944 Original CRISPR TCTGAGTGAATGAGTTAAAG AGG Intronic
901744341 1:11362704-11362726 TCTGAGTGAAGAAGTGAATGAGG + Intergenic
905207742 1:36352566-36352588 GCTGAGTGAGTGAGTTGAGGAGG - Intronic
906962291 1:50425992-50426014 TGTGAGTGAATGTGTTATGGAGG + Intergenic
907014700 1:51000540-51000562 TCTGAATGAATGCATTAAGGAGG + Intergenic
907853306 1:58277571-58277593 TCTGACTGAGTGAATGAAAGAGG - Intronic
909118854 1:71575085-71575107 ACTGAGTTTATGAGTGAAAGTGG - Intronic
910021678 1:82597927-82597949 TCTGAGTGAGTGTGATGAAGGGG - Intergenic
915012800 1:152704850-152704872 TCCTAGTCTATGAGTTAAAGAGG - Intergenic
915694965 1:157730769-157730791 TCTTAGTGACTGACTTGAAGGGG + Intergenic
916308263 1:163364245-163364267 TCTGAGTAAAAGAGCTAAACTGG - Intergenic
917228502 1:172810513-172810535 CCTCAGAGAATGAGTTAGAGAGG + Intergenic
918677718 1:187309006-187309028 GATTTGTGAATGAGTTAAAGCGG + Intergenic
919533769 1:198760481-198760503 CCTCACTGAATGAGTTAAAAAGG + Intergenic
921317176 1:213903600-213903622 TCTGTGTGTGTGAGTTAATGAGG - Intergenic
921753904 1:218830096-218830118 GATGAGTAAATGAGTTAAAATGG + Intergenic
923001490 1:230009727-230009749 TCTGAGTGAAGTAGTTTATGTGG + Intergenic
923206489 1:231763897-231763919 TCTGAATGAATGAATGAAATGGG + Intronic
1063114044 10:3060795-3060817 AATGAGTGATTGAGTAAAAGGGG - Intergenic
1063681455 10:8191761-8191783 AATGAGTGAATGAGTGAATGAGG - Intergenic
1064880223 10:20043841-20043863 TTTCAGTGAATGATATAAAGTGG + Intronic
1069963402 10:72092936-72092958 CGTGAGAGAATGAGTTAAAAAGG + Intergenic
1072917471 10:99547772-99547794 TCAGACTGAATGTGTTAGAGAGG + Intergenic
1073745195 10:106460611-106460633 TTTTATAGAATGAGTTAAAGAGG + Intergenic
1075175041 10:120152095-120152117 CCTTAGTAAATGAGTTAAAGAGG + Intergenic
1075213704 10:120513351-120513373 TCAGACTTAATGAGTTAAACTGG - Intronic
1076005240 10:126943770-126943792 TATGAGTTAATGAGATGAAGAGG + Intronic
1076897507 10:133320093-133320115 TCTGAGCCAATGAGTGAATGGGG - Intronic
1078572313 11:12469790-12469812 TCTCTGTGAGTGAATTAAAGAGG + Intronic
1078702491 11:13700403-13700425 TCTCAGTGAAGAAGATAAAGAGG + Exonic
1079939969 11:26668237-26668259 TCATACAGAATGAGTTAAAGAGG + Exonic
1081514173 11:43808972-43808994 TCTAATTGAATGAAATAAAGAGG + Intronic
1082775720 11:57242977-57242999 TCTGAGTGAATGAATTAGGATGG - Intergenic
1085234164 11:74999383-74999405 AAAGAGAGAATGAGTTAAAGTGG - Intronic
1085259933 11:75198799-75198821 TATGAGTGCATGAGTGAATGAGG + Intronic
1085259935 11:75198807-75198829 CATGAGTGAATGAGGTAAGGTGG + Intronic
1085560000 11:77462905-77462927 TTTGATTGAGTGAGTGAAAGTGG - Intronic
1086094821 11:83039903-83039925 ACTGGATGAATGGGTTAAAGAGG + Intronic
1087717701 11:101627564-101627586 TGTGAGTGATGAAGTTAAAGAGG + Intronic
1087723109 11:101688915-101688937 GCAGAGTGAGTGAGTTAGAGTGG - Intronic
1087820004 11:102701153-102701175 TCTGAGGGACTGAAATAAAGTGG + Intronic
1089042648 11:115467743-115467765 TCTGAGTGAATGAGTTTACAGGG + Intronic
1089110321 11:116050694-116050716 TCAGAGCAGATGAGTTAAAGAGG - Intergenic
1090806260 11:130204210-130204232 GTTGAGTGAATGAGTTGATGGGG + Intronic
1093256897 12:16879791-16879813 TCTGAGAAAATGAATTAAAAGGG + Intergenic
1093862280 12:24180605-24180627 ACTGAGAGAATGAAGTAAAGTGG - Intergenic
1095333881 12:41003454-41003476 TCTCATAGAATGAGTTAAGGTGG + Intronic
1097809711 12:64005103-64005125 TGTGAGTGAAGCAGTTAAATAGG + Intronic
1099284309 12:80697055-80697077 TGTGAGTGATTGAGTGAAAGTGG - Intergenic
1099716544 12:86301116-86301138 TGGGCGTGAATGAGTTAAAGAGG - Intronic
1100878944 12:98995006-98995028 TCTGAGTGAATGAGTTAAAGAGG + Intronic
1101247079 12:102893831-102893853 TCTGAGTGAATGACTAATATAGG - Intronic
1101840274 12:108322980-108323002 TCTGAGAGAATGAGGTATGGAGG - Intronic
1104090779 12:125515377-125515399 TGTGAGAGAATGTGTGAAAGAGG - Intronic
1105938383 13:25123528-25123550 TCTGTCTGAATGATCTAAAGTGG - Intergenic
1106522509 13:30510238-30510260 TATGAGTGAATGAGTGAGTGGGG + Intronic
1106657556 13:31762445-31762467 TCTGAGTGCATGAGGTGGAGGGG + Intronic
1106997069 13:35497172-35497194 CCTGAGTGAATCACTTTAAGTGG - Intronic
1108246266 13:48517367-48517389 TCCGTGTGAAGGAGTTACAGAGG - Intronic
1109239891 13:59873071-59873093 TGTTAATGAATGAGTCAAAGGGG + Intronic
1111969758 13:94899758-94899780 TCTGAGACAATGAGGTATAGTGG - Intergenic
1112624072 13:101082506-101082528 TTTGAGTCAATGAATTATAGTGG + Intronic
1112993510 13:105543588-105543610 TCTGTGTGAATTTTTTAAAGTGG + Intergenic
1114677880 14:24457295-24457317 TGTGAGTCACTGAGTTGAAGGGG + Intergenic
1116993491 14:51299669-51299691 TCTGACTTAATGAATAAAAGAGG + Intergenic
1117445826 14:55803086-55803108 ACTGAATGAATGAGTGAATGTGG - Intergenic
1117941214 14:60967282-60967304 TTTGAATGAATGAGTGAAAAAGG + Intronic
1118064232 14:62173334-62173356 TCAGGGTGAATGTGATAAAGTGG + Intergenic
1118215701 14:63806481-63806503 TCTCAAAGAATGAGTTAGAGAGG + Intergenic
1122001854 14:98665037-98665059 TCTAAGTTAAAGAGTTAAACAGG - Intergenic
1124256176 15:28144746-28144768 TCCCAGGGGATGAGTTAAAGTGG - Exonic
1125210319 15:37207203-37207225 TATGAGAGAAAGAGTTGAAGAGG - Intergenic
1125972293 15:43921718-43921740 TCTGAGTGAATGGGCCAATGTGG + Intronic
1126227360 15:46286679-46286701 TCTCAATGAATGAGTTAGGGAGG + Intergenic
1126426643 15:48534650-48534672 ACTGAGTGATTTAGTTAAAACGG + Intronic
1127062547 15:55201816-55201838 ACTGAGTAAAGGACTTAAAGAGG - Intergenic
1127806228 15:62523209-62523231 CCAGAGAGAATGAGTTAAACTGG + Intronic
1128198484 15:65782385-65782407 TCTGAGAGAATGAACGAAAGAGG - Intronic
1128906401 15:71471540-71471562 TCTGACTGAGTGACATAAAGTGG - Intronic
1130753693 15:86740452-86740474 TCTGAGGGAAGGAGTAAAATTGG + Intronic
1131459877 15:92610494-92610516 TCAGACTGAAAGAGTGAAAGGGG + Intergenic
1137414468 16:48261566-48261588 TCTGTGTCAAAGAGATAAAGAGG + Exonic
1138192931 16:55031435-55031457 GCTGAATGAATGAATGAAAGAGG - Intergenic
1139703194 16:68722299-68722321 AGTGAGTGAGTGAGTTAATGTGG + Intronic
1140870437 16:79101513-79101535 CCTAAGGGAATGAGTTTAAGTGG + Intronic
1143363515 17:6390182-6390204 TCTGGGTGAAGGAGTTTAAGTGG - Intergenic
1143764822 17:9130556-9130578 TCTGAGTGGATGAGTTTAAGGGG - Intronic
1145208892 17:20998707-20998729 TCTGAGTGAAGGTGTGAAAGTGG + Intergenic
1145285332 17:21501562-21501584 TATGAGTGAATGAGTGACAGTGG - Intergenic
1145392189 17:22464178-22464200 TGTGAGTGAATGAGTGACCGTGG + Intergenic
1146663629 17:34682119-34682141 TCTGAGTGGAGGGGTTGAAGTGG + Intergenic
1147166741 17:38597418-38597440 TCTGACTGAATGATTGAATGGGG - Intronic
1149011492 17:51861345-51861367 TCTAAATGCATGAGTTAAAATGG + Intronic
1149856669 17:60088716-60088738 TGTGAGTGACTGAGAAAAAGGGG + Intergenic
1153168282 18:2286467-2286489 TTTGAGTGAATGAGTAAATCTGG - Intergenic
1156860211 18:41827435-41827457 TCTCAGTGAAAAAGTTAAAAAGG + Intergenic
1157064641 18:44333799-44333821 CTTCAGAGAATGAGTTAAAGAGG + Intergenic
1157199803 18:45650503-45650525 TCTGGATGAATGAGTGAATGAGG - Intronic
1161498762 19:4601674-4601696 TCTGAGTGAATGAGTGCATGAGG + Intergenic
1161519666 19:4716779-4716801 GCCGAGTGAATGAGCAAAAGGGG + Intronic
1161752701 19:6109732-6109754 TTTGAGGGTATGAGTAAAAGAGG + Intronic
1161837983 19:6660657-6660679 TGTGAGTGAGTGAGTGAATGTGG - Intergenic
1161963203 19:7534148-7534170 TAGGAGTGAATAATTTAAAGGGG + Exonic
1163100712 19:15094554-15094576 TCTGAATGAATGAATGAATGAGG + Intergenic
1163549806 19:17959758-17959780 CCCGAGTGAAAGAGTTCAAGAGG + Intronic
1165272477 19:34723004-34723026 TATGAGTGAGTGAGTGAATGTGG + Intergenic
1166619714 19:44285273-44285295 GCTGAGTGAAGGAGTTTAAGAGG - Intronic
925210799 2:2044062-2044084 TCTGGGTGAATGTTTTACAGTGG + Intronic
925890779 2:8432861-8432883 ACTGAGTGAGTGAGTGAATGTGG + Intergenic
926119331 2:10233330-10233352 TGTGAGTGAATGAGTGCATGTGG + Intergenic
926375984 2:12227948-12227970 TTTGAGTGAATTAATAAAAGGGG + Intergenic
928852295 2:35763554-35763576 GTTGAGTGAAATAGTTAAAGAGG + Intergenic
930916270 2:56692603-56692625 CCTGATAGAATGAGTTAGAGAGG + Intergenic
931743147 2:65266946-65266968 TCTGATAGAATGAGTTTCAGTGG + Intronic
932513911 2:72325431-72325453 CCAGAATGAATGAGTTAAAGAGG - Intronic
932736534 2:74258492-74258514 TCTGTATGCATGAGTAAAAGTGG + Intronic
933537585 2:83596047-83596069 TCTGCTTCAATGAGTTAAGGAGG + Intergenic
933557918 2:83853403-83853425 GCTGAGTGAATGATTTTTAGTGG - Intergenic
933987399 2:87603312-87603334 TCTGAGTGGATGAGGGAAGGGGG + Intergenic
934523979 2:95039599-95039621 ACTGAGTGAGTGAGTGACAGTGG + Intronic
935415845 2:102817903-102817925 ATTGAGTGAAACAGTTAAAGTGG - Intronic
935491604 2:103727753-103727775 TCTCAAAGAATGAGTTAGAGAGG + Intergenic
936306440 2:111347496-111347518 TCTGAGTGGATGAGGGAAGGGGG - Intergenic
936732836 2:115405005-115405027 TGTGAGTACATGAGTTATAGGGG - Intronic
937692018 2:124767381-124767403 TCTTAGTGAATGTGTTTTAGTGG + Intronic
937831610 2:126430586-126430608 TCTGAGTTAATGAATTAAGGTGG + Intergenic
939434746 2:142160836-142160858 TCTCATTGAATGAGTTAGAGAGG - Intergenic
940541245 2:155022083-155022105 TCTGAGTCCATCACTTAAAGAGG - Intergenic
940897714 2:159096647-159096669 TCTGACTGACTGTTTTAAAGAGG + Intronic
941865828 2:170333346-170333368 ATGGAGTGAATGAGATAAAGAGG + Intronic
942762369 2:179414403-179414425 TTTCATTGAATGAATTAAAGAGG - Intergenic
943241840 2:185394712-185394734 TTTCAATGAATGAGTTAATGTGG - Intergenic
944714492 2:202365481-202365503 CCTGAGTGAATGAGTAAATGAGG - Intergenic
944848157 2:203689723-203689745 ACTGTGTGAATGAGTGAAAGGGG - Intergenic
948343452 2:237274847-237274869 TCTCATAGAATGAGTTGAAGAGG - Intergenic
949052346 2:241903925-241903947 TCTGAGTGAATGAGCCATGGGGG + Intergenic
1169815021 20:9647736-9647758 TTTGAGTTAAAGAGTTACAGAGG + Intronic
1173540920 20:43850340-43850362 TCTCTGGGAATGAGTTAAAATGG - Intergenic
1174934228 20:54850057-54850079 ACTGAGTGAATGAATTTCAGAGG + Intergenic
1175680948 20:60988454-60988476 ACTGAATGAATGAGTTAACCTGG - Intergenic
1177685611 21:24433990-24434012 TCTGATTGAAAGTGTTCAAGAGG - Intergenic
1178484595 21:33010637-33010659 TCTGTTTGGATGAGTTGAAGGGG - Intergenic
1181615105 22:24048943-24048965 CCTGACTGAATTAGTTAAAGTGG + Intronic
1181795854 22:25309907-25309929 CCTGAGGGAAAGAGTTAAAGAGG + Intergenic
1181836384 22:25613436-25613458 CCTGAGGGAAAGAGTTAAAGAGG + Intronic
1184183371 22:42846618-42846640 CCTGAGTGAATGATTTTTAGTGG - Intronic
1185099016 22:48827749-48827771 TCTGAGTGAATTATTTACTGCGG + Intronic
952569534 3:34697852-34697874 TCTGAGTCCCTGAATTAAAGTGG + Intergenic
952960312 3:38585238-38585260 GATGAGTGAATGAGTAAAAGTGG + Intronic
954467590 3:50665508-50665530 TCTCAGAGGATGAGTTTAAGTGG - Intergenic
957476242 3:80728003-80728025 TCTGAGTTAATGAGTTAGGGAGG + Intergenic
958077063 3:88694210-88694232 TCTCATAGAATGAGTTAAAGAGG - Intergenic
959482575 3:106891309-106891331 TCTCACAGAATGAGTTAGAGAGG - Intergenic
960191753 3:114715075-114715097 TCTGAGTGAATGACTTATTAAGG - Intronic
961567707 3:127775610-127775632 TTTGAGGGAAAGTGTTAAAGAGG - Intronic
962130483 3:132668481-132668503 TCTGAGTAAATTATTTAGAGAGG + Intronic
962168531 3:133076618-133076640 TCTGAGAGAATAATTTAAAGTGG - Intronic
962526174 3:136239567-136239589 CCTGAGTGAATGAGAGAAAGAGG - Intergenic
963345117 3:144087152-144087174 TCTGAGTCAGTGAGGTAGAGGGG - Intergenic
964524108 3:157598919-157598941 TTTGTGTGAAGGTGTTAAAGTGG + Intronic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
965514933 3:169611066-169611088 TCTGAGTCAGTGAGCTGAAGTGG + Intronic
965963345 3:174455362-174455384 TCTCATGGAATGAGTTAGAGAGG - Intronic
969442034 4:7222905-7222927 CTTGAGTGAATGAGTCAAGGTGG - Intronic
969465206 4:7352308-7352330 TTTGAATGAATGAGTGAATGAGG + Intronic
970487823 4:16542156-16542178 TCTTAGTGGATGAGTAAATGAGG - Intronic
972978788 4:44670222-44670244 ACTGAGTGAAAGAGTGAAAAGGG - Intronic
973889216 4:55352610-55352632 TTTGAATGAATGAGAAAAAGTGG + Intronic
975457357 4:74607855-74607877 TCTGTATGATTGGGTTAAAGAGG - Intergenic
975761232 4:77621846-77621868 TCTTGGTGAATGATTTAAAAAGG - Intergenic
978759151 4:112336150-112336172 TCTGAATGAATGAGTGAACAGGG + Intronic
979496199 4:121385708-121385730 TGTGAGTGGTTGAGATAAAGTGG - Intergenic
979523640 4:121696276-121696298 CATGAGTGAATGTGTAAAAGTGG - Intronic
979657862 4:123217852-123217874 TCTCAGTGAATAAATTAAAACGG - Intronic
980093243 4:128463837-128463859 TCAGAGTGAATGTGTAAAACAGG - Intergenic
980603951 4:135064823-135064845 TCTGAGTTAATTAGTGACAGCGG - Intergenic
981003314 4:139849715-139849737 TCTGAGTGGTTAAGTTACAGTGG - Intronic
981731143 4:147900267-147900289 TCTGAATGAATGAATGAAAGAGG + Intronic
981982947 4:150817948-150817970 ACTCAGTTAATGAGGTAAAGAGG + Intronic
983007954 4:162508521-162508543 TCTGAGTGAATAAGTCATAAAGG + Intergenic
983312977 4:166088899-166088921 ACTGAATGAATGAGATAAATAGG - Intronic
984276886 4:177621842-177621864 TCTGGGTGAGTCAGTGAAAGTGG - Intergenic
984356175 4:178662110-178662132 TCTTAGTGAAATAGTTGAAGTGG - Intergenic
984661755 4:182382047-182382069 TCTGATAGAATGTATTAAAGAGG + Intronic
984894444 4:184524955-184524977 TCTCATTGAATGAGTCAAGGAGG + Intergenic
984959167 4:185077811-185077833 TCTGAGAGAATGAAATGAAGCGG - Intergenic
984961550 4:185102490-185102512 TGTGAGTGAATGAGAAAAAAGGG + Intergenic
985180329 4:187253901-187253923 TCTGGATTAATGAGTAAAAGAGG + Intergenic
985210979 4:187594147-187594169 TATGAGTGAATGGGTTAATAAGG - Intergenic
988414644 5:30930767-30930789 TCCAAGAGAATGAGTGAAAGTGG - Intergenic
990280871 5:54249604-54249626 TCTAAGTGAAGGAGTTCATGAGG + Intronic
990488593 5:56282654-56282676 TTTGAATGAATGAATGAAAGAGG + Intergenic
994277528 5:97856192-97856214 ACTGAGTCATTGAGCTAAAGGGG + Intergenic
994747187 5:103692883-103692905 TCAGATTGAATGAGTTGAACAGG + Intergenic
995435969 5:112135646-112135668 TCAGAGTGAGTGAGTGAAAGAGG - Intergenic
996176475 5:120365773-120365795 TAGGAATGAGTGAGTTAAAGTGG + Intergenic
996411223 5:123161664-123161686 GCTGAGTGAGTGAGGTGAAGAGG + Intronic
996514671 5:124356690-124356712 TCTGTTTGAATGTGTTAAAATGG + Intergenic
996716407 5:126591467-126591489 TCTGAGTGAGTGATTGCAAGGGG - Intronic
998433496 5:142087036-142087058 TTTGAGTGAATGAATGAAATAGG + Intergenic
999160374 5:149491179-149491201 TATGAGGGAATGACTTTAAGAGG - Intergenic
999630226 5:153563243-153563265 TCTCAGTGACTGACTTAAAAGGG - Intronic
1000431368 5:161156578-161156600 TGTGAGTGAATGAGGCAGAGAGG + Intergenic
1002806676 6:582857-582879 CCTGAGTGAGTGAGTTAACAGGG - Intronic
1003359766 6:5413643-5413665 AAGGAGTGAAGGAGTTAAAGTGG - Intronic
1004068211 6:12272259-12272281 TCTGAAACAATGAGTTAAAAAGG - Intergenic
1004800857 6:19145580-19145602 TCTTAATGAATGAGTGGAAGGGG - Intergenic
1006308478 6:33239992-33240014 TGTGATTGAATGAATGAAAGAGG - Intergenic
1009446476 6:63748495-63748517 TCTCATAGAATGAGTTAAGGAGG + Intronic
1009761057 6:68006607-68006629 ACTAAGTGAATGAGTGAAAGAGG - Intergenic
1010792637 6:80082336-80082358 TCTGATTGCCTGAGTGAAAGAGG + Intergenic
1010957960 6:82112873-82112895 TCTGAGTGAATGAATAAATGAGG + Intergenic
1011926922 6:92656934-92656956 TCTGAATGAATGAATTTAAATGG - Intergenic
1012538028 6:100323044-100323066 CCTGATAGAATGAGTTAAGGAGG + Intergenic
1014613117 6:123568561-123568583 GCAGAGTGCAAGAGTTAAAGAGG - Intronic
1020943485 7:14570700-14570722 TCAGATTGAGTAAGTTAAAGGGG + Intronic
1021013584 7:15503084-15503106 AATGAATGAATGACTTAAAGTGG - Intronic
1022359584 7:29645124-29645146 TGTGAGTGAATGAGTGAATGTGG - Intergenic
1022870061 7:34468221-34468243 CCTCAGAGAGTGAGTTAAAGGGG + Intergenic
1023438695 7:40164696-40164718 TGTGAGTGATTGTGTTAAAGAGG + Intronic
1023709320 7:42975128-42975150 CCTCAGTGAATGAGGAAAAGTGG + Intergenic
1027567586 7:79816224-79816246 TTTTAGAGAATGAGTTAATGTGG + Intergenic
1027766400 7:82348749-82348771 GATGAGTCAATGAGATAAAGTGG - Intronic
1028279760 7:88907844-88907866 TCTGACTGAATGAATTAAGTCGG - Intronic
1028306110 7:89267164-89267186 TTTGAGGGAATGGGTTAAAAAGG - Intronic
1028748924 7:94360173-94360195 TCTGAAGGAATGAGGTAATGAGG - Intergenic
1028883370 7:95905261-95905283 TCAGAGTGGATGAAGTAAAGAGG + Intronic
1032130805 7:129225565-129225587 TCTGAGAGAGTGGGTTTAAGGGG - Intronic
1032451793 7:132037677-132037699 TCTGACTGATGGAGTTATAGGGG - Intergenic
1035340638 7:158158594-158158616 TCTGAATGAATGAGTGAACTCGG + Intronic
1035340647 7:158158662-158158684 TCTGAATGAATGAGTGAACTCGG + Intronic
1035340658 7:158158730-158158752 TCTGAATGAATGAGTGAACTCGG + Intronic
1035340667 7:158158798-158158820 CCTGAATGAATGAGTGAACGCGG + Intronic
1035340678 7:158158866-158158888 TCTGAATGAATGAGTGAACTCGG + Intronic
1035340714 7:158159070-158159092 CCTGAATGAATGAGTGAACGCGG + Intronic
1035340722 7:158159138-158159160 TCTGAATGAATGAGTGAACTTGG + Intronic
1035340731 7:158159206-158159228 TCTGAATGAATGAGTGAACTTGG + Intronic
1038993301 8:32893348-32893370 TTTTAGTGGATGAGTTTAAGTGG + Intergenic
1040011719 8:42666672-42666694 TCTGAATGAATGAGTAAGAAAGG + Intergenic
1040409605 8:47140714-47140736 TCTGAATGAATGACAAAAAGGGG - Intergenic
1040688497 8:49906571-49906593 TTTGTGTGAATGAGTCACAGTGG + Intergenic
1040884950 8:52251565-52251587 TCTTAGTGATTGAGTCAATGCGG - Intronic
1041647501 8:60268280-60268302 TCTGAGTGTATGTGATAAAGGGG - Intronic
1042459943 8:69053093-69053115 ACTGATTAAATGAGTTAAAGGGG + Intergenic
1042854235 8:73249428-73249450 TCTCATAGAATGAGTTACAGAGG + Intronic
1042854305 8:73250441-73250463 TCTGATGGAATGAGTTATAATGG - Intronic
1043277752 8:78421068-78421090 TTTGGGAGAATGAGTTGAAGTGG - Intergenic
1044534376 8:93342708-93342730 TCTAAATAAATGAGATAAAGTGG + Intergenic
1045483934 8:102615508-102615530 TCTAAGTGAAATAATTAAAGGGG + Intergenic
1046714582 8:117553721-117553743 TCTGTGTGAGTGACTTAAAAAGG - Intergenic
1047011833 8:120681047-120681069 TCAGTGTGAATGAATTAATGAGG - Intronic
1047436705 8:124840710-124840732 TCTGAATGAATGAATGAAAGAGG + Intergenic
1049314570 8:141956476-141956498 TCTGAATGAATTAGTAAATGTGG + Intergenic
1050959547 9:11710133-11710155 TCTCATTGAATGACTTAAAGTGG + Intergenic
1051946455 9:22575085-22575107 GCTCATAGAATGAGTTAAAGAGG - Intergenic
1055131624 9:72781944-72781966 TCTCATGGAATGAGTTAAAGAGG - Intronic
1058105977 9:100972511-100972533 TCTTTGTGAATGTGTTCAAGGGG - Intergenic
1058971717 9:110089295-110089317 TCTGATAGAATGTTTTAAAGTGG + Intronic
1059942971 9:119375978-119376000 TAGGAGGGAATGAGTTGAAGTGG - Intergenic
1061876649 9:133547415-133547437 TCCGAGTGAATGAATGAATGGGG - Intronic
1062695861 9:137876119-137876141 TCTGAGTGACTGAGTCGAGGGGG - Intergenic
1187663588 X:21577666-21577688 TCTGATTAAATGAGTTATGGTGG - Intronic
1188645988 X:32567941-32567963 TCTGAGTAAGTAAGTCAAAGAGG - Intronic
1189811749 X:44787547-44787569 CCTGAGTGACTGAGTGACAGAGG - Intergenic
1189941566 X:46128655-46128677 TCTGACTGGATGTGTTAATGGGG - Intergenic
1190033574 X:46998390-46998412 TCTGAGTGAATTGGTGAAAATGG - Intronic
1190933639 X:54972847-54972869 TCTCATCAAATGAGTTAAAGAGG + Intronic
1192544365 X:72001092-72001114 GCTGGGTGAATGACTGAAAGGGG - Intergenic
1194171190 X:90585212-90585234 TATGAGTGAAAGAGAGAAAGGGG + Intergenic
1194511989 X:94808152-94808174 CCTCATTGAATGAGTTAGAGAGG + Intergenic
1195207836 X:102621421-102621443 TCTGATAGAATGAGTTGAGGAGG + Intergenic
1195914591 X:109923765-109923787 GATGAGTAAATGAGTTAATGTGG + Intergenic
1199557567 X:149125565-149125587 ACTGAGTGATTGATTCAAAGTGG + Intergenic
1200517421 Y:4162960-4162982 TATGAGTGAAAGAGAGAAAGGGG + Intergenic
1202243858 Y:22796161-22796183 TCTGGATGCATGAGCTAAAGGGG + Intergenic
1202396845 Y:24429911-24429933 TCTGGATGCATGAGCTAAAGGGG + Intergenic
1202473938 Y:25240181-25240203 TCTGGATGCATGAGCTAAAGGGG - Intergenic