ID: 1100881695

View in Genome Browser
Species Human (GRCh38)
Location 12:99025598-99025620
Sequence ATTTGAAATAGGAAAGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 440}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100881687_1100881695 26 Left 1100881687 12:99025549-99025571 CCTGGGGTCACTGTAGATAAGCT 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1100881695 12:99025598-99025620 ATTTGAAATAGGAAAGGGCAAGG 0: 1
1: 0
2: 2
3: 39
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100881695 Original CRISPR ATTTGAAATAGGAAAGGGCA AGG Intronic
901830093 1:11887003-11887025 ATATGAACCAGGAAAGGGCCTGG - Intergenic
902059199 1:13627934-13627956 ATTTGAAAAAAGAAAAGGCTGGG - Intergenic
904444959 1:30563378-30563400 ATTTGAAACAGAAAAGGGAGGGG + Intergenic
904803106 1:33110700-33110722 ATATAAAATAGGAAAGGCTAAGG + Intronic
905291282 1:36923361-36923383 ATTGGAACAGGGAAAGGGCAGGG + Intronic
905411362 1:37771312-37771334 ATTGAAAATAGGCATGGGCAAGG + Intergenic
906288591 1:44604449-44604471 GTTTGAAATAGCCAAGGTCATGG + Intronic
907052292 1:51337720-51337742 ATTTTAAATAGAAAGGGGCTGGG - Intronic
907099060 1:51811189-51811211 ATTTTAAAGAGGACAGGGAAAGG - Intronic
907889313 1:58622484-58622506 ATTACAAATAGGAGAGGGTATGG + Intergenic
908879517 1:68715007-68715029 ATATGAAATAGGAAAGAAGATGG + Intergenic
908996624 1:70163417-70163439 ACTAGAAGTTGGAAAGGGCAAGG - Intronic
909000973 1:70217073-70217095 AAATGAAATAGGACAGGGGATGG - Intronic
909052908 1:70788935-70788957 ATTTGAAATGGGAAAAGAAAGGG + Intergenic
909939518 1:81594579-81594601 ATTTTAAATAGGAAAAGGAATGG - Intronic
910341977 1:86199057-86199079 ATTGGAATTAAGAAAAGGCATGG + Intergenic
911579655 1:99620097-99620119 GTTTGCCATAGGAAAGGGCTAGG - Intergenic
913028965 1:114878401-114878423 ATTTGAAAAAGGTAAGAGCATGG - Intronic
913343746 1:117787047-117787069 ACCTGAAAGAGGAAAGGGCAAGG - Intergenic
913647092 1:120868456-120868478 ATATGAGATAAGAAAGGACAAGG - Intergenic
914079551 1:144394409-144394431 ATATGAGATAAGAAAGGACAAGG + Intergenic
914174449 1:145262952-145262974 ATATGAGATAAGAAAGGACAAGG + Intergenic
914529178 1:148504436-148504458 ATGTGAGATAAGAAAGGACAAGG + Intergenic
916513820 1:165497160-165497182 GTTTGGAATTGGAAAGGGCTGGG - Intergenic
916945036 1:169717962-169717984 ATTTGGAATAGGAAAGGTCATGG + Intronic
917737761 1:177936146-177936168 AGTTGGAATAGGAAAAGGCAAGG + Intronic
921366439 1:214378967-214378989 AATTGAAATTGGATTGGGCAGGG + Intronic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
922144334 1:222923930-222923952 AGTAAAAATAGGAAAGGACATGG + Intronic
923330182 1:232916615-232916637 TTTTAAAATAGTAAATGGCAAGG - Intergenic
1063015149 10:2069595-2069617 TTTTTAAATAGGAAAGGATAAGG - Intergenic
1063642205 10:7841149-7841171 ATCTGAAATAGGAAAGCTCTAGG - Intronic
1065164667 10:22963126-22963148 CTTTTAATTAGGAAAGGGGATGG + Intronic
1066696453 10:38083027-38083049 ATGAGAATTAGGAAAGGGAAGGG + Intergenic
1066996098 10:42564709-42564731 ATGAGAATTAGGAAAGGGAAGGG - Intergenic
1070184723 10:74050101-74050123 ATATGAACTTGAAAAGGGCATGG + Intronic
1071239034 10:83683560-83683582 TTTTGAAATGGAAAAGGACAAGG - Intergenic
1071481366 10:86067562-86067584 TTTTAAAATAGGCAAGGGGAAGG + Intronic
1071836665 10:89425058-89425080 AATTTAAAAAGGAAAGGGAAGGG + Intergenic
1072357107 10:94622638-94622660 ACTTGAAAGAGGGGAGGGCATGG + Intergenic
1072539655 10:96388707-96388729 ATTTGAGTTGGAAAAGGGCAGGG - Intronic
1072656143 10:97331889-97331911 ATTAAAAAGAGAAAAGGGCAAGG + Intergenic
1073484097 10:103805726-103805748 ATTTTAAAAATAAAAGGGCAGGG + Intronic
1074454389 10:113584573-113584595 ATTGGAAAGAGGAAAGATCATGG + Intronic
1074589523 10:114799565-114799587 ATATGAATGAGGAAAGAGCAAGG - Intergenic
1078088422 11:8248623-8248645 AGTAGAAATAGGTAAGGGTAGGG + Intronic
1078356623 11:10636932-10636954 ATGTGAGATAGGAGAGGTCAGGG + Intronic
1078366839 11:10714025-10714047 ATTTTAAATGGGAAAGTTCAAGG - Intergenic
1078634367 11:13035120-13035142 ATTTGGAAAAGGAGAGGGGATGG + Intergenic
1078852740 11:15179263-15179285 TTTTAAAATAGCAAAGGGTAAGG - Intronic
1079102491 11:17550696-17550718 ACAGGAAATAGGAGAGGGCAGGG - Intronic
1079919400 11:26413683-26413705 ATTAGAAATAAGAAAACGCAAGG - Intronic
1080025391 11:27608318-27608340 TTTTGATATAGTAAAGGGTATGG + Intergenic
1080037432 11:27723340-27723362 ACTGGAAATTGGAAAGGGCTGGG - Intergenic
1080117034 11:28632802-28632824 ATTTGAAAGAGGATATGGGAGGG - Intergenic
1080140899 11:28918734-28918756 GTTTTAAACAGGAAAGAGCATGG + Intergenic
1080147149 11:29000041-29000063 ATATGAAATAAGAAAGGGTAAGG + Intergenic
1080412224 11:32036465-32036487 ATTTAAAATAAGGAAGAGCAGGG + Intronic
1081071697 11:38617865-38617887 ATATGAAATATTAAAGGGGAGGG + Intergenic
1082675507 11:56096217-56096239 CTTTGAAATAAGAAATTGCAAGG + Intergenic
1083515348 11:63252384-63252406 ATTAAAAATACAAAAGGGCATGG + Intronic
1084042391 11:66549791-66549813 CTTTGAGTTTGGAAAGGGCAGGG - Intronic
1084222948 11:67695841-67695863 TTTTTAAATAGGTAAAGGCAGGG + Intergenic
1084904653 11:72336185-72336207 ATTTGAGGTAGGCAAGGGCCAGG - Intronic
1085224626 11:74908347-74908369 ATTTGGCAGTGGAAAGGGCATGG - Intronic
1086539022 11:87885555-87885577 ATTTTACACAGGAATGGGCAGGG - Intergenic
1086549308 11:88036447-88036469 ATATGGAATAGGAAAAGGCAAGG - Intergenic
1087346185 11:96973769-96973791 ATTGGGAAGAGGAAAGGGGAAGG + Intergenic
1087456117 11:98388707-98388729 TTTGGGAATAGGAAAGGACAAGG - Intergenic
1087947362 11:104179172-104179194 ATTTGAAATAAGAAGGTACAAGG - Intergenic
1088209161 11:107434145-107434167 ATTTCAAACAGGCAAGGGTAGGG + Intronic
1088289014 11:108215664-108215686 GTTTTAAAAAGGAAAGGGCAAGG + Intronic
1091746724 12:2997521-2997543 GTGTGAAATGAGAAAGGGCAGGG + Intronic
1091890064 12:4046331-4046353 ACTGGAAATAGAAATGGGCATGG - Intergenic
1092612787 12:10189291-10189313 GTCTGAAAGGGGAAAGGGCAGGG + Intronic
1092678594 12:10951031-10951053 ATGTCAAATAGGAAAGCGCTAGG + Intronic
1092899758 12:13046965-13046987 ATCTGAAATAGTAAAGGAGATGG + Intronic
1093209981 12:16296900-16296922 ATTTTAAATGAGAAAGGGGAAGG - Intergenic
1094497584 12:30998158-30998180 ATTTGCAGCAGGAAAGGGCCTGG - Intergenic
1095174070 12:39070207-39070229 ATTTATAATAGGAAAGAACAGGG - Intergenic
1095218147 12:39574582-39574604 ACTTGAAAGAAGAAAGGGAAAGG - Intronic
1095309655 12:40683199-40683221 ATTGGAAGTAGGAAAGGGGATGG + Intergenic
1095373171 12:41494661-41494683 ATTTGAGAAAGTTAAGGGCATGG + Intronic
1095619360 12:44230491-44230513 ATCTGAACAAGGAAATGGCAGGG - Intronic
1095992393 12:48044922-48044944 CTAAGAAGTAGGAAAGGGCATGG - Exonic
1097496202 12:60339107-60339129 ATCTGAAATGGGAAAGTGAAAGG - Intergenic
1097644103 12:62215353-62215375 ACCTGAAATGGGAAAAGGCAAGG + Intronic
1097731120 12:63129798-63129820 AATTGAAATAGGATAGGATAGGG - Intergenic
1098080400 12:66778815-66778837 AGTAGACATAGGAAAGGGAAAGG + Intronic
1098367917 12:69724897-69724919 ATAATAAATAGGAAAGGGAAAGG - Intergenic
1099106267 12:78499999-78500021 ATTTTAAATAGAAAAGGTCATGG + Intergenic
1099454091 12:82843561-82843583 ATTTTAAGTATGAAAGGGTAAGG + Intronic
1099487860 12:83250091-83250113 TTTTGAAATATGAGAGGACATGG + Intergenic
1099509635 12:83517994-83518016 ATGGGAAATCGGAAAGGGGATGG - Intergenic
1100199899 12:92287324-92287346 ATCTGAAATAGGTATGGGCTGGG + Intergenic
1100881695 12:99025598-99025620 ATTTGAAATAGGAAAGGGCAAGG + Intronic
1100928048 12:99572477-99572499 ATTTGAAATATAAAATTGCATGG - Intronic
1101364900 12:104062763-104062785 AATTGAAAAAGGACTGGGCATGG - Intronic
1101469608 12:104984252-104984274 ATGGGGAATAGGAAAGGGGATGG + Intergenic
1103043249 12:117713619-117713641 ATTTAAAATAGGAAAAGTGAGGG + Intronic
1103311758 12:120015303-120015325 ATAACAAATAAGAAAGGGCATGG + Intronic
1104224394 12:126817196-126817218 CTTTGAAATAAGAAATAGCATGG + Intergenic
1104313538 12:127675986-127676008 CTTTGAGATTGGAGAGGGCAAGG - Intergenic
1104567542 12:129898854-129898876 TTATGAAATAGGAAAGGAGAGGG + Intronic
1107877164 13:44800951-44800973 ATAGGAAATAGGAAAAAGCAGGG - Intergenic
1108011824 13:46023076-46023098 ATATGAAATAGGAAGTGTCAAGG + Intronic
1109089657 13:58024816-58024838 AGTTGAAATAAGAAAGAGAAAGG - Intergenic
1109202610 13:59447818-59447840 ATGTGAACTAGGAAAGGGTGAGG + Intergenic
1109696127 13:65961115-65961137 ATTTGAATTTGGGAAGGGTATGG + Intergenic
1110583076 13:77155385-77155407 CTTTGAAGGAGGAAAGGGCTGGG + Intronic
1111175697 13:84592984-84593006 ATTTGAAAGAGAAAAGGAAATGG - Intergenic
1111429347 13:88131956-88131978 ATTTTGAATAGGAATGGGAATGG - Intergenic
1111992258 13:95128124-95128146 ATTTGATGTAGGAACAGGCATGG - Intronic
1112320516 13:98402877-98402899 ATTTGAAATAGAAAAGGCTGGGG + Intronic
1112659647 13:101492900-101492922 ATTTGAACTTGGAAAAGGAAAGG - Intronic
1113089536 13:106602706-106602728 ATTTGAAACAGTAATGGGTAAGG - Intergenic
1113140353 13:107141461-107141483 ATTTGAGCAAGGAAAGAGCAAGG - Intergenic
1113658695 13:112088495-112088517 ATTTGAAATAGGGAAAGGAAAGG + Intergenic
1114780908 14:25537069-25537091 CTTGGAAATAAGAAAGGGGAAGG - Intergenic
1115960076 14:38826029-38826051 ATTTGAAGTAGGTAAGAGGAAGG - Intergenic
1116429659 14:44831175-44831197 AAGTGACATAGCAAAGGGCATGG - Intergenic
1116673253 14:47871335-47871357 ATTTAAAATAGGGCTGGGCATGG - Intergenic
1116869359 14:50056808-50056830 AATTGATATAGGGAAGGGCCTGG + Intergenic
1117161382 14:52993929-52993951 ATTTGCTTTAGGAAAGGGGAAGG - Intergenic
1118554474 14:67000331-67000353 TTTTGAAATAGAAAATGGTATGG - Intronic
1119203419 14:72776285-72776307 ATCAGAAATAGGAAAGGCAAGGG + Intronic
1119204375 14:72783199-72783221 ATATGAGATAGCAAAGGGTAGGG - Intronic
1119682637 14:76604376-76604398 TAGTGAAAGAGGAAAGGGCATGG + Intergenic
1120723157 14:87908909-87908931 ATTTAAAAGACAAAAGGGCAGGG - Intronic
1122681024 14:103463171-103463193 ATCTGAAAGAGGAACAGGCATGG - Intronic
1123793215 15:23745050-23745072 ATTTAAAATAGAAAAGGCAAGGG - Intergenic
1124458827 15:29870133-29870155 ATTAGAAAGAGGAAAGGGACAGG - Intronic
1124801195 15:32834432-32834454 GCTTGAAATGTGAAAGGGCAAGG - Intronic
1124895938 15:33777624-33777646 AATTAAAATATGAGAGGGCAGGG + Intronic
1125191310 15:36997381-36997403 CTTTGAGTTAGGAAAGGGAAAGG + Intronic
1125340089 15:38666852-38666874 ATCAAAAATTGGAAAGGGCATGG - Intergenic
1126051610 15:44690977-44690999 ATTTGAAAAAGTAAAAAGCATGG - Intronic
1126419500 15:48456506-48456528 TCTAGAAATAGTAAAGGGCATGG - Intronic
1127657587 15:61071205-61071227 ATTTGAAAAAGGGGAGGGGAAGG + Intronic
1127726689 15:61757296-61757318 ATTGGAAATGGAAAAGAGCATGG - Intergenic
1128538292 15:68507009-68507031 AATTTAAAGGGGAAAGGGCAGGG - Intergenic
1128824547 15:70700132-70700154 ATTTGAAATCTGAAAGGGTATGG - Intronic
1129293141 15:74584028-74584050 AGTTTTAATAGGAAAGGGAAAGG - Intronic
1130345696 15:83042842-83042864 GTTTAAAATAGGAAGGGGCCAGG + Intronic
1130438473 15:83926300-83926322 AGATGAGATAGGAATGGGCAAGG + Intronic
1130690286 15:86076347-86076369 ATGTTGAATAGGAAAGAGCAAGG + Intergenic
1130833519 15:87627178-87627200 ATTGGAAATAGGAAGGCGCATGG - Intergenic
1131121434 15:89825400-89825422 GCTTGAAATTGGACAGGGCAGGG - Intergenic
1131187929 15:90291798-90291820 ATGAGAAATATGAAAGGGAAAGG - Intronic
1131329698 15:91485582-91485604 ACTTGAAACAGGAGAGGGCTGGG + Intergenic
1132024894 15:98396926-98396948 CTTTAAAATAGGAAGTGGCAAGG - Intergenic
1133166884 16:3954317-3954339 ATTGGAATTAGGGGAGGGCAGGG - Intronic
1135530309 16:23247345-23247367 AGCTGGAAGAGGAAAGGGCATGG - Intergenic
1136462000 16:30417432-30417454 CTATGAAATAGGAAAGGCCACGG - Intronic
1136710457 16:32232769-32232791 AGTTGAAACAGGAAAGATCAGGG - Intergenic
1136757454 16:32696642-32696664 AGTTGAAACAGGAAAGATCAGGG + Intergenic
1136810652 16:33173733-33173755 AGTTGAAACAGGAAAGATCAGGG - Intergenic
1136817128 16:33283813-33283835 AGTTGAAACAGGAAAGATCAGGG - Intronic
1136823693 16:33340344-33340366 AGTTGAAACAGGAAAGATCAGGG - Intergenic
1137798427 16:51241018-51241040 ATCTTAAATGGGGAAGGGCAAGG - Intergenic
1140873385 16:79127534-79127556 ATTTGCAATAGCAAAAGGCTGGG - Intronic
1141310385 16:82908158-82908180 TTTTGAAATAAGAAAGGAAAAGG + Intronic
1141758588 16:86011633-86011655 CTTTGAAAGAGGAAATGGCCAGG - Intergenic
1203059603 16_KI270728v1_random:956991-957013 AGTTGAAACAGGAAAGATCAGGG + Intergenic
1143079311 17:4369615-4369637 ATGGGATATAGGAAAGAGCAGGG + Intergenic
1143569161 17:7743918-7743940 AACTGAAATAGGAACAGGCAGGG + Intronic
1144112983 17:12056524-12056546 ATTTAAAATTTGAAAGGACATGG + Intronic
1144143789 17:12377281-12377303 ATTTGAGATGGGAATGGGCCTGG - Intergenic
1144343673 17:14331621-14331643 ATTTAAAAAAGGAAAGAGAAAGG + Intronic
1144349810 17:14384242-14384264 ATTTGGAATAGGAGATGGAAAGG + Intergenic
1144646334 17:16976617-16976639 CTTTGAAAAAGCAAAGAGCAGGG + Intergenic
1147225155 17:38970843-38970865 TATTGAAATAGGAAATGACAAGG - Intergenic
1147342111 17:39759047-39759069 ATTTGAAATAGGAATGTTAATGG - Intergenic
1148167514 17:45493597-45493619 AAGTGAAAAAGGAAAGGGTAAGG + Intergenic
1148299076 17:46530442-46530464 ATCTGGAATAGGAAAGAGGAGGG + Intronic
1148952293 17:51323921-51323943 ATTTGAAATAGAAAAGGATATGG + Intergenic
1149030064 17:52072532-52072554 ATTTGAAAAAAAAAAGGGAAGGG - Intronic
1150398695 17:64840010-64840032 AAGTGAAAAAGGAAAGGGGAAGG + Intergenic
1152450577 17:80376709-80376731 CTGTGAAATAACAAAGGGCAAGG - Intronic
1152984161 18:306951-306973 AATTTAAAGGGGAAAGGGCAGGG - Intergenic
1153640727 18:7154792-7154814 AATTGAGAGAGGAGAGGGCAGGG + Intergenic
1153739396 18:8107186-8107208 ATATGAAATAGGAAATGCAAAGG + Intronic
1154089907 18:11348280-11348302 ATTTTAAAAAGGAAAGTGAAAGG + Intergenic
1154107534 18:11535507-11535529 ATTTGCAACAGGAAAAGGAAGGG + Intergenic
1154365908 18:13708820-13708842 ATTTGAACTAGGAAAAGGACAGG - Intronic
1155203499 18:23537485-23537507 ATAGGAAGCAGGAAAGGGCAAGG + Intronic
1156444943 18:37229547-37229569 ACTAGAAATAGGAAAGAGAAGGG - Intronic
1156722470 18:40086910-40086932 ATTTGAAGTAGAGTAGGGCAAGG + Intergenic
1156868232 18:41912920-41912942 AATTGAAGTAGGAAAAGGTATGG - Intergenic
1157035112 18:43962258-43962280 ATGTGGAAGAGGAAAGGGAAGGG - Intergenic
1157149991 18:45207153-45207175 ATTTTAAGTAGACAAGGGCAGGG + Intergenic
1157683179 18:49622787-49622809 GTTTAAAATAGGGAAGGGCCTGG - Intergenic
1159712117 18:71773817-71773839 TATTTAAAGAGGAAAGGGCAAGG - Intronic
1159869300 18:73742648-73742670 TTTTCAAATAGAAAAGAGCAAGG + Intergenic
1160052175 18:75444084-75444106 AGGTGAAATAGGAAAGGGCTGGG - Intergenic
1161362962 19:3861633-3861655 AATTGAAATAGGGCTGGGCACGG + Intronic
1164074634 19:21802798-21802820 ATTTTGAATAGGAAAAGGAATGG + Intergenic
1164909450 19:31993589-31993611 GTTTAAAATGTGAAAGGGCAGGG + Intergenic
1164988057 19:32663401-32663423 CTTTGAAATTGGAAAGGACGTGG - Intronic
1164988262 19:32665193-32665215 ATTTGATATTGTAAAGGACAAGG - Intronic
1165505751 19:36227868-36227890 ATATGAAATAGGACACGGCACGG + Intronic
1167636951 19:50660798-50660820 ATTTCAAACAGAAAGGGGCAAGG + Intronic
1167717447 19:51153005-51153027 AGTGGAAATAGGATAAGGCAGGG - Intronic
1167730774 19:51252770-51252792 ATATGGAATAGGAAAGGACAGGG + Intronic
927512250 2:23651380-23651402 ATTTGCAAGAGGGGAGGGCAAGG - Intronic
927744622 2:25606188-25606210 ATTTAAAAAAAAAAAGGGCATGG + Intronic
929521944 2:42661048-42661070 CTTTGAGAAAGGAAAAGGCAAGG - Intronic
930923951 2:56792827-56792849 GTTTGGAATAGTAAAGAGCATGG + Intergenic
931555164 2:63494993-63495015 AGGTGAAGTAGGAAAGGGTAAGG + Intronic
931914678 2:66941086-66941108 ATTTGAACTAGCCAAGGGGAAGG - Intergenic
932549327 2:72751650-72751672 ATTTGAAACAAGAAATGGAAAGG + Intronic
933416933 2:81998271-81998293 AAGGGAAATAGGATAGGGCAGGG + Intergenic
937368687 2:121283433-121283455 AAGTGAAATAAAAAAGGGCAAGG + Intronic
938940564 2:136166109-136166131 ATTTGTAATAATAACGGGCATGG + Intergenic
938969252 2:136417124-136417146 AAATAAAATAGGGAAGGGCAGGG + Intergenic
939256395 2:139749471-139749493 TTTTCAAATAGGAAAAGGAAAGG - Intergenic
939794343 2:146622989-146623011 AGATGAAGTAGGAAAGGGAAGGG - Intergenic
939944120 2:148387991-148388013 ATATGAAAAAGCAAAGAGCATGG + Intronic
940128999 2:150360177-150360199 ATGAGAAATAGCTAAGGGCAGGG - Intergenic
940130711 2:150378279-150378301 ATTTGAAATTGGGAAGAGAATGG - Intergenic
941155720 2:161975737-161975759 ATTTGAACAAAGAAGGGGCAAGG + Intronic
941658394 2:168169265-168169287 ACTTGAAATAGGAGTGGCCAGGG - Intronic
941802523 2:169676128-169676150 ATTGCAAATAGGAAAGGAAAGGG - Intronic
941937979 2:171001618-171001640 ATTTGATGTAGGAAGGGACAGGG - Intronic
942166860 2:173249763-173249785 ATTTGAAATTGGAAAGTACTAGG - Intronic
942386770 2:175451142-175451164 ATAGGAAATAGGGAGGGGCAAGG - Intergenic
942432486 2:175927506-175927528 ATCTGAGGCAGGAAAGGGCATGG + Exonic
942699224 2:178685716-178685738 ATTTTAAATAGGAACAAGCAGGG - Intronic
943114888 2:183656196-183656218 ATGTGAAAAAGAAAAAGGCAAGG - Intergenic
943360904 2:186917872-186917894 AAAAAAAATAGGAAAGGGCAAGG + Intergenic
943375181 2:187067653-187067675 TCTGGACATAGGAAAGGGCAAGG + Intergenic
944159280 2:196641533-196641555 AAATGAAATAGGAAAGAACATGG - Intronic
944271698 2:197790756-197790778 GTTTGAAATAGGAGAGGTGAGGG + Intergenic
944663582 2:201940772-201940794 CTGTGAAAGATGAAAGGGCAAGG - Intergenic
946003548 2:216503719-216503741 AGTTAAAAGAGGAAAGGGCGGGG + Intronic
946379870 2:219339895-219339917 ATGTGAAATAGGGCTGGGCACGG + Intergenic
948035160 2:234852582-234852604 CTTTCAATGAGGAAAGGGCAGGG - Intergenic
1170882607 20:20310429-20310451 ACATGAACCAGGAAAGGGCAGGG + Intronic
1170916029 20:20626964-20626986 ATTTGAAATAGTCAAGGTCCTGG - Intronic
1170963855 20:21049308-21049330 ATTTGGAAATGGAACGGGCAAGG + Intergenic
1173051644 20:39568079-39568101 ATTTAAAAGAGAAAAGGGAAAGG - Intergenic
1173744858 20:45428422-45428444 ATTTGAAATAGGGTATGGCCAGG - Intergenic
1173797286 20:45870413-45870435 AATTGTATTAGGAATGGGCATGG - Intronic
1177693945 21:24547341-24547363 AATTGTCATAGGAAAGGTCAAGG + Intergenic
1178306404 21:31494361-31494383 ATTGGAAATAGGAAAAGGGAGGG - Intronic
1179161277 21:38901286-38901308 GTTTTAAATAGGAATGGTCAAGG - Intergenic
1179310003 21:40186799-40186821 AGGTGAAATAGAAAAGGTCATGG + Intronic
1179492480 21:41750339-41750361 ATTTGAAAAAGGAAGGGACTAGG + Intronic
1180239100 21:46487452-46487474 ATGTGTAATAAGAATGGGCATGG - Intronic
1182488640 22:30654852-30654874 AGATGAAACAGGGAAGGGCATGG + Intronic
1182534534 22:30990793-30990815 ATTTGAAATAAGAAGGGGACAGG - Intergenic
1183993575 22:41615796-41615818 CTTTGAAATAAGAGAGGCCATGG - Intronic
1184317743 22:43710175-43710197 ATTTCAAATTGGAAAGAACAGGG + Intronic
1184921632 22:47609522-47609544 ATTTTAAAAAGAAATGGGCAAGG + Intergenic
1185305152 22:50111279-50111301 ATTTGCAAGAGGAAAGGAAAAGG + Intronic
949310477 3:2691858-2691880 ATTTGTAATGGGAAAAAGCATGG - Intronic
949478882 3:4474501-4474523 ATTTGAAAAAGAAAAGGGGGCGG - Intergenic
950553150 3:13679712-13679734 ATTTGATCTAGGTAAGGGAAAGG - Intergenic
951184458 3:19696413-19696435 TTTTGAAATCAGAAAGTGCAAGG - Intergenic
951466013 3:23001051-23001073 AATTGAAGAAGGAAAGGGTAAGG - Intergenic
951642441 3:24851108-24851130 ATTGGAGACAGGAGAGGGCATGG + Intergenic
952566454 3:34665111-34665133 ATTTGAAGAAGGATAAGGCAGGG - Intergenic
952596001 3:35018084-35018106 ATTTAATCTAGAAAAGGGCATGG + Intergenic
953043408 3:39274582-39274604 ATTTTGAAGAGGAAAGGGAAGGG - Intronic
953215654 3:40915283-40915305 ATATGAAATATGAAGGGGAAGGG - Intergenic
953822888 3:46223477-46223499 ATATGAAAAAGGATTGGGCATGG - Intronic
954185032 3:48910434-48910456 ATTTGGAAGAGGAAAGCTCATGG + Intergenic
955556741 3:60146246-60146268 ATTTAAAAAAAAAAAGGGCAGGG + Intronic
955772368 3:62398269-62398291 AGAAGAAATAGGAAAGGGGAGGG - Intergenic
956296018 3:67714470-67714492 ATGTGAAATATGAAATGCCATGG + Intergenic
956443418 3:69302710-69302732 ATTTGAAATAGCAAAAGGGGTGG + Intronic
956981564 3:74644865-74644887 ATTTGCCATAGGCAAGGTCAGGG + Intergenic
957049782 3:75402506-75402528 TTTAGAAATGGGAAAAGGCAAGG + Intergenic
957519275 3:81297553-81297575 ATTGGAAATAGAAATGGGCAGGG - Intergenic
958636901 3:96756462-96756484 ACTTGAAGGAGGAAATGGCATGG - Intergenic
958653800 3:96975285-96975307 ATTAGATATAGCAAAGGGCTGGG - Intronic
959802664 3:110513350-110513372 AATTGAAAGATGAAAGTGCATGG - Intergenic
960188318 3:114671809-114671831 ATTTGAGAAAAGGAAGGGCATGG + Intronic
961166347 3:124766427-124766449 CCTTGAAAAAGGAAAGGGCATGG + Intronic
962543167 3:136403822-136403844 ATTTGAAACAGGTAATGGGATGG - Intronic
962686176 3:137850002-137850024 ATTTTAAATATGAAAGAACATGG + Intergenic
962937487 3:140093982-140094004 ATCTGAAATAGGAGAGCTCATGG + Intronic
963094037 3:141516746-141516768 ATGTGAAATTTAAAAGGGCAGGG + Intronic
963965260 3:151361808-151361830 ATTTGAAGTAGGAATGGCCATGG - Intronic
964118238 3:153158396-153158418 ATGTGAAATACTCAAGGGCAAGG - Intergenic
964909226 3:161757702-161757724 ACTTGGCATTGGAAAGGGCATGG - Intergenic
967127908 3:186442337-186442359 AGTGCAAATAGGAAAGTGCATGG - Intergenic
967457853 3:189710421-189710443 AATTAAAATAGAAAAGGGCAGGG + Intronic
968024411 3:195427181-195427203 CTTTGAAATTGGAGAAGGCAAGG + Intronic
969324138 4:6431257-6431279 GTTTGAAATTGGCCAGGGCAGGG - Intronic
970337314 4:15061792-15061814 ATTGGATTTAGGAAAGAGCATGG + Intronic
970787431 4:19815989-19816011 AATAGAAATAGCAAAGGGAATGG + Intergenic
970787613 4:19818019-19818041 AATTGAAGTAGCAAAGGGAATGG - Intergenic
971638475 4:29096819-29096841 TTTTGAAATAGGAGATAGCATGG + Intergenic
971847847 4:31943924-31943946 ATTTGAAATTGGTAAGGGCCAGG - Intergenic
972725465 4:41743458-41743480 ATTTTAAATAGGTGAGGGAATGG - Intergenic
973652689 4:53012300-53012322 ATTTGAAATAGGGAAAGGCTGGG + Intronic
974399810 4:61388871-61388893 ATTTTAAATGGGAATGTGCAGGG - Intronic
975084128 4:70316928-70316950 ACTTGAAAAAGGAAATGTCAGGG + Intergenic
975168465 4:71205220-71205242 CTTTGAAATAGAAAAGAGCCAGG + Intronic
976810889 4:89100236-89100258 AATTGATATAGGAAAGGTAATGG + Intronic
977275904 4:94977121-94977143 ATTTCAAAAATGTAAGGGCATGG - Intronic
977640466 4:99352899-99352921 ATCTGAAATTGGAAAAGTCAAGG - Exonic
977935929 4:102804446-102804468 ATATGAAAAAGGACTGGGCACGG - Intronic
978067174 4:104420102-104420124 AATTGAAGTAGGAAAAGGCTTGG + Intergenic
978362949 4:107950184-107950206 TTTTGAAATAGGAGAAGGGATGG + Intronic
978503870 4:109435935-109435957 TTTGGAAATATGAAAGTGCAGGG + Intronic
978842728 4:113233428-113233450 ATATGAAATAAGAAAAGGCCGGG - Intronic
978892283 4:113844418-113844440 ACCTGAAATTGCAAAGGGCATGG - Intergenic
979619521 4:122783219-122783241 GTTTCAAAAAGGAAAGGGAAAGG + Intergenic
980578881 4:134722331-134722353 ATTTGTAAAATGAAAGGGCCTGG + Intergenic
980636862 4:135517446-135517468 ATTTAAAAAAGGAAAAAGCAAGG + Intergenic
980659055 4:135832394-135832416 ATTAGAAACAGTAAAAGGCAGGG - Intergenic
982576819 4:157122496-157122518 TTTTATACTAGGAAAGGGCATGG - Intronic
982784069 4:159522692-159522714 ATTTGCAATATGAAAATGCAAGG + Intergenic
982943859 4:161593038-161593060 ATTAAAATTGGGAAAGGGCAAGG - Intronic
983395166 4:167184976-167184998 GTTTGAAATAGGGAGGGGCAGGG - Intronic
983983616 4:174030228-174030250 ATTTTAAATAGGGAAAAGCAAGG - Intergenic
984458304 4:179999787-179999809 ATTTCACATAGGAGAAGGCAGGG - Intergenic
984843607 4:184091374-184091396 ATTTGAAATCTGAAAGGGAAAGG + Exonic
985007023 4:185544241-185544263 TTTTTAAGTAGAAAAGGGCATGG - Intergenic
985322407 4:188729287-188729309 ACAGGAAATAGGAAGGGGCAAGG + Intergenic
985361578 4:189181374-189181396 ATTTGAAATATCAAAGAGAAAGG - Intergenic
986185708 5:5435054-5435076 GTTTGACAAAGGAATGGGCAAGG + Intronic
986691393 5:10316574-10316596 TTTTTGAATAGGAATGGGCAAGG - Intergenic
986903087 5:12461180-12461202 TTCTGAAATAGGTAAAGGCAAGG - Intergenic
986904526 5:12479029-12479051 ATTTGAAATTTGAAATGTCAGGG + Intergenic
986936908 5:12900427-12900449 CTTTGAGAAAGGAAAGGGAAAGG + Intergenic
987288666 5:16487274-16487296 TTTTGAACTTGGAAAGTGCATGG - Intronic
987758550 5:22128223-22128245 ATTAGAAGAAGAAAAGGGCAAGG + Intronic
987806921 5:22781346-22781368 AATTGAAATTGGAAAGTGCCTGG + Intronic
988879021 5:35480116-35480138 ATCTGAAATAGCCAAGAGCAAGG - Intergenic
989110589 5:37903375-37903397 ATTTTGAAAATGAAAGGGCAAGG + Intergenic
989198532 5:38739668-38739690 ATTTGAAGAAGGAAGGAGCATGG + Intergenic
989488438 5:42020811-42020833 ACTTGAAAAAGCAAAGGGAAAGG + Intergenic
990138045 5:52670837-52670859 ATTTTTACTGGGAAAGGGCAAGG + Intergenic
990250608 5:53910783-53910805 TTTTGAAAAACGAAAGGGCAGGG - Intronic
990579923 5:57158061-57158083 TTTTTAAATAGGTAAAGGCAAGG + Intergenic
990748726 5:58988050-58988072 ATTTTAAAAAGGAAAGAACAGGG + Intronic
990801324 5:59607335-59607357 ATAATAAATAGGAAAGGGGAGGG - Intronic
991257969 5:64636312-64636334 ATCTGAAATATGAAAGAGCTTGG - Intergenic
991592352 5:68266159-68266181 ATTAGTATTAGGAGAGGGCAGGG - Intronic
991749307 5:69782363-69782385 ATTAGAAGAAGAAAAGGGCAAGG + Intergenic
991800887 5:70362170-70362192 ATTAGAAGAAGAAAAGGGCAAGG + Intergenic
991827713 5:70647871-70647893 ATTAGAAGAAGAAAAGGGCAAGG - Intergenic
991893251 5:71361621-71361643 ATTAGAAGAAGAAAAGGGCAAGG + Intergenic
992312114 5:75511516-75511538 ATTTCAAATAGGGAAGGAAAAGG + Intronic
992363302 5:76064758-76064780 ATTTGAAAGAGGAAAGGTTAGGG - Intergenic
992796294 5:80257169-80257191 ATTTGAAAGAGCAAAGGGATTGG - Intergenic
993447437 5:88030873-88030895 ATGTCAAATTGCAAAGGGCATGG - Intergenic
993623160 5:90191900-90191922 CTTTGAGATAAGGAAGGGCAAGG + Intergenic
993775798 5:91994007-91994029 TTTTTATATAGGAAAGGGGAAGG + Intergenic
993894777 5:93521292-93521314 CCTGGACATAGGAAAGGGCAAGG + Intergenic
994071204 5:95604790-95604812 AATAGAAATAGGAAAGGCCATGG - Exonic
994998099 5:107090714-107090736 ATTTAAAATATGAAAAGGAAAGG + Intergenic
995035010 5:107523711-107523733 ATTTCAAAAAGGAAAGTGAAGGG - Intronic
995449448 5:112284535-112284557 ATTTGAAATAGGAGAGAGAGGGG - Intronic
996429183 5:123352324-123352346 GTCTTAAATAGGAAAGAGCACGG - Intronic
996563309 5:124853925-124853947 ATTGGTAACAGCAAAGGGCAAGG + Intergenic
996878510 5:128266655-128266677 AGTAGAAATAGGAAAATGCATGG - Intronic
996934745 5:128935720-128935742 AATTGACATGGGACAGGGCATGG + Intronic
997675960 5:135713714-135713736 ATTTGAAATATGATGGGGGAGGG - Intergenic
997900959 5:137763972-137763994 ATTTGAAGCTGGAAAAGGCAGGG - Intergenic
998770824 5:145543088-145543110 ATTTGACCTAGAGAAGGGCAAGG - Intronic
998916422 5:147016987-147017009 ATTTTAAATGGGAAAGAACATGG + Intronic
998922583 5:147085816-147085838 ATTTGCAATAGGAATGAGGAAGG + Intergenic
1000452497 5:161407277-161407299 CTTTGAAATAGGAATAGTCAGGG - Intronic
1000561193 5:162791562-162791584 ATTTTAAATAAAAAAGAGCATGG - Intergenic
1001002604 5:168021867-168021889 ATTTCAAAAAAGAAAGGGAAGGG + Intronic
1002361195 5:178672555-178672577 ATTGGAAATAGAACAGGGTATGG + Intergenic
1002826017 6:775197-775219 ATTTTATATAAGAAAGGTCAAGG - Intergenic
1003246734 6:4388253-4388275 CTATGAAATACTAAAGGGCAAGG + Intergenic
1004210005 6:13630659-13630681 AAATGAAAGAGAAAAGGGCAAGG - Intronic
1004836085 6:19533218-19533240 ATTTGTAGTAGGAAAGGAAAGGG - Intergenic
1007251404 6:40497614-40497636 ACTTACAATAGGAAAGGGCTCGG + Intronic
1009807519 6:68621427-68621449 CTTTGTTATAGGAAAGGGAAAGG - Intergenic
1010253229 6:73730067-73730089 ACTTGGAATAGGAAATGGCAAGG + Intronic
1011377716 6:86707590-86707612 ATTTGACAAAGCAAAGAGCAAGG - Intergenic
1011891467 6:92166671-92166693 ATTTGAGAAAAGGAAGGGCAAGG - Intergenic
1011912568 6:92460673-92460695 ACTTGAAAGAGGAAATGGGATGG - Intergenic
1012245433 6:96920806-96920828 ATTTGAGAGAGAAAAGGGGAGGG - Intergenic
1013235668 6:108195896-108195918 ATTTGAAATAAAATAGGGCTGGG - Intergenic
1014759404 6:125339624-125339646 ATTAGAAAAAGGAAAGAGAATGG + Intergenic
1014939645 6:127422820-127422842 ATTCCAAAGAGGAAAGGGGAAGG - Intergenic
1016090731 6:139975904-139975926 ATTTGAGGTAGGAAAGGAAATGG - Intergenic
1016121278 6:140344645-140344667 ATTAGAGATAGGAAATAGCATGG - Intergenic
1016449084 6:144162660-144162682 ATTTGAATTTGGATAGGGGATGG + Intronic
1016555217 6:145328676-145328698 ATTTGGAATATGATAGTGCAGGG + Intergenic
1016647344 6:146425360-146425382 ACTTGGAATGGGAAGGGGCATGG + Intronic
1017257963 6:152355468-152355490 ATTTGAAACTGGAGAGTGCAGGG + Intronic
1018140456 6:160828655-160828677 ATCTCAAATAGGAAACGGCTGGG + Intergenic
1018967190 6:168498111-168498133 ATTTAAAATAGGAAACAGAAAGG - Intronic
1019195287 6:170277889-170277911 TTTTGAAACAGGAGAGGGAAGGG - Intergenic
1019929030 7:4211257-4211279 CTTTGAAAGAGGAAATGTCAGGG + Intronic
1022391384 7:29947426-29947448 ATTTGAGATAGAAAAGGACAGGG - Intronic
1023742275 7:43291363-43291385 TTTTTAAATAGGTAAAGGCAAGG + Intronic
1024736326 7:52308808-52308830 ATAGGAACTAGGGAAGGGCAAGG - Intergenic
1024861590 7:53849065-53849087 ATTTGAAACAGCAAAGGTGACGG + Intergenic
1026050736 7:66944398-66944420 ATTTCAAAAAGGAAGGGGCCAGG - Intronic
1026427229 7:70308132-70308154 ATTTGAAACAAGAAAGGGCCAGG + Intronic
1027837919 7:83269590-83269612 ATTTGAACTCTGAAAGGGAAGGG - Intergenic
1028089504 7:86680765-86680787 ATGTGAAATGGGAAGGGGCTGGG - Intronic
1029099116 7:98113554-98113576 ATTTTAAATGAGAAAGGGCCAGG - Intronic
1029147666 7:98458344-98458366 ATTTGAATTTGGGAAAGGCATGG - Intergenic
1029251515 7:99240068-99240090 ATTTTAAATGGGTAAGGGCAGGG + Intergenic
1029490896 7:100869294-100869316 ACGTGGAATAGGTAAGGGCAGGG + Intronic
1030634399 7:111932193-111932215 ATTTGAAGTGGGAAAGGACTGGG + Intronic
1030908996 7:115223352-115223374 ATTAGAAATAGGATAGGCCTAGG + Intergenic
1031904330 7:127444164-127444186 ATTTGAAAAAGCAGAGGGCGGGG - Intergenic
1031982955 7:128141000-128141022 ATGAGAAAAAGGAAAGGGAAGGG - Intergenic
1032638028 7:133732600-133732622 GTTTGAATTGGGAAAGGGCATGG - Intronic
1032998736 7:137479228-137479250 ATTTAAAATAGAAAGGAGCATGG - Intronic
1033047399 7:137975135-137975157 CTTTAAAAGATGAAAGGGCATGG + Intronic
1033515083 7:142097424-142097446 GTTTGAAAAAGGAAAAGGGATGG + Intronic
1033982348 7:147181033-147181055 ATTTTGAAAAGGAAATGGCAGGG + Intronic
1034167297 7:149035527-149035549 ATTTGAAATAGAAAAGTTCATGG + Intergenic
1034755481 7:153614458-153614480 AATTAAAACAGGAAAAGGCAGGG + Intergenic
1035376215 7:158408041-158408063 AGTTGAAATAGGAAAGGAAAAGG + Intronic
1035408779 7:158620538-158620560 ATTGGAGCTAGGAAAGGGGAAGG + Intergenic
1035854082 8:2954821-2954843 ATTTCTAACAGGGAAGGGCAAGG + Intronic
1036175790 8:6537132-6537154 ATGTGAAATTGGAAAGAGCCGGG - Intronic
1036386853 8:8289370-8289392 CTTAGAAATAGGCAAGGGAAAGG - Intergenic
1036597796 8:10229829-10229851 ATTTGGAAGAGGAAAGGGAGAGG + Intronic
1037522601 8:19694637-19694659 TTCTAGAATAGGAAAGGGCATGG + Intronic
1037658759 8:20909392-20909414 ATTGAAGATAGGATAGGGCATGG - Intergenic
1038555796 8:28513964-28513986 ATTTGAAAGAAGAAAGAGAATGG + Intronic
1038725218 8:30076206-30076228 ATCTGGCATAGTAAAGGGCATGG + Intronic
1039464691 8:37776172-37776194 TTTTCAAAAAAGAAAGGGCATGG - Intronic
1039681856 8:39747912-39747934 CTTTGAAATTGGATAGTGCATGG - Intronic
1042086668 8:65116808-65116830 ATTTGAAAGAGGAAATGGATTGG + Intergenic
1042688307 8:71465813-71465835 TTTTGAAATCAGAAAAGGCAAGG + Intronic
1042688335 8:71466358-71466380 TTTTGAAATCAGAAAAGGCAAGG + Intronic
1043214220 8:77565305-77565327 ATATGAAGTAAGAAAGGGTAGGG - Intergenic
1043760892 8:84066647-84066669 ATTTCAAAATGGAAAGGTCAGGG - Intergenic
1043955105 8:86350566-86350588 TATAGAAATAGGAAAGGCCAGGG + Intronic
1045233561 8:100329091-100329113 ATTTGATATAGGAGAGGGAGAGG + Intronic
1045653235 8:104362273-104362295 ATTTGAGATCAGGAAGGGCAAGG - Intronic
1046380969 8:113450145-113450167 AGTTAGAACAGGAAAGGGCAGGG + Intergenic
1047095438 8:121620005-121620027 ATTGGAAATTGGGAGGGGCAGGG - Intronic
1047648636 8:126896027-126896049 ATTTGCATTCGGAAAGGGGAGGG - Intergenic
1048295405 8:133210180-133210202 ATGTGAACTTGGAAAGGGCAGGG - Intronic
1048861227 8:138725506-138725528 ATTTGAAAGAGGCAAAGGGAAGG + Intronic
1049656662 8:143802084-143802106 ATTTAAAATAATAAAAGGCAAGG + Intronic
1049982034 9:912976-912998 ATTTGTAAAATGAATGGGCATGG - Intronic
1050259448 9:3826089-3826111 ATTTAAAATAGAAAGGGGGAAGG - Intronic
1050544927 9:6701653-6701675 ATTTATAATGGGAAAGGCCATGG + Intergenic
1050940932 9:11456081-11456103 ATATGACACAGCAAAGGGCATGG - Intergenic
1051106048 9:13581459-13581481 AAATGAAATAGGAAAATGCAGGG + Intergenic
1052055347 9:23899878-23899900 ATTTTAAATAATAAAGGACAAGG - Intergenic
1055008212 9:71533889-71533911 TTTAGAAACAGGAAAGAGCAAGG - Intergenic
1055008386 9:71535750-71535772 TTGTAAAATAGGAAAGGGTAAGG + Intergenic
1055499090 9:76885501-76885523 AAAGGAAATAGGAAAGGGGAAGG + Intronic
1055716461 9:79123293-79123315 ATTTGAAATAGAAGAGGGCAGGG + Intergenic
1058035512 9:100248267-100248289 ATTTGAATAAGGCATGGGCAAGG + Intronic
1058069816 9:100590532-100590554 ATATGAGATAGGAAAGGGTGGGG - Intergenic
1058855552 9:109058434-109058456 ATTTGAAAGAGATAAGGGCCAGG + Intronic
1059696132 9:116732107-116732129 CTTTGAAATAGCACAGGTCAGGG + Intronic
1059992757 9:119880781-119880803 GTTTGAGAGAGGAAAGGACAGGG - Intergenic
1060120598 9:120986026-120986048 ATTTTAAAGAGGAAGGGGCTTGG - Intronic
1062071161 9:134555703-134555725 ATTCCAAAAAGTAAAGGGCAGGG + Intergenic
1186211701 X:7256671-7256693 CTTTGAAATAGGATACTGCAGGG - Intronic
1186410801 X:9342893-9342915 CTCTGAAACAGGAAAGGGGACGG + Intergenic
1186942783 X:14529223-14529245 ATTTGAAGCAGAAAAGGGAAGGG - Intergenic
1187203224 X:17156099-17156121 ATTTGAAAAACGATACGGCAGGG - Intergenic
1187304938 X:18086515-18086537 AGATGAAATAGGAAATAGCATGG - Intergenic
1187402298 X:18972340-18972362 ATTTTAAATAGAAGAGGGGAAGG - Intronic
1189378588 X:40485047-40485069 CTTTTAAATAGGAAAGGGAGGGG + Intergenic
1192597182 X:72423320-72423342 ATTGGAAACAGGAAAGGGTGAGG - Intronic
1194238863 X:91419689-91419711 ATTTGATTCAGGCAAGGGCAAGG - Intergenic
1194669444 X:96712446-96712468 ATTAGGAATAGGAAAGGGTGGGG - Intronic
1195463994 X:105159470-105159492 ATATGAAATAGGATAGGGAATGG + Intronic
1195687063 X:107597065-107597087 CTCTGAAATGGGAAAAGGCATGG - Intronic
1195708220 X:107753422-107753444 ATCTGAAACAGGAAGGGGCACGG - Intronic
1195753866 X:108181718-108181740 ATTTGCATTATGAATGGGCAAGG - Intronic
1196088953 X:111718332-111718354 ATTTGAAAGTGGAAGGGGCCTGG + Intronic
1196500852 X:116380161-116380183 AGATGAAATTGGAAAAGGCAAGG - Intergenic
1197147776 X:123188085-123188107 ATTTGACATAACTAAGGGCAAGG - Intronic
1197831905 X:130651876-130651898 CTTTGAAAGAAGAAAGGGAAGGG - Intronic
1198947225 X:142028470-142028492 ATTTGATATAAGATTGGGCAGGG - Intergenic
1199458309 X:148054227-148054249 CTGTGAAATAGGAAGGTGCATGG + Intergenic
1201506556 Y:14707987-14708009 AATGGAAATAGGAAAGGGTTAGG - Intronic
1201577137 Y:15473005-15473027 ATTAGAAATAGGAAATGTCCAGG - Intergenic