ID: 1100882221

View in Genome Browser
Species Human (GRCh38)
Location 12:99031617-99031639
Sequence CTGCATTCCCAGATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 605
Summary {0: 1, 1: 0, 2: 3, 3: 58, 4: 543}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100882221_1100882225 20 Left 1100882221 12:99031617-99031639 CCTTCCTCCATCTGGGAATGCAG 0: 1
1: 0
2: 3
3: 58
4: 543
Right 1100882225 12:99031660-99031682 ATAGCCACTCTGCAGTCATGAGG 0: 1
1: 0
2: 0
3: 16
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100882221 Original CRISPR CTGCATTCCCAGATGGAGGA AGG (reversed) Intronic
900370229 1:2328973-2328995 CTGCTTTCCCAGGTCGAAGAAGG + Intronic
900682856 1:3926407-3926429 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
902526772 1:17063979-17064001 CTGCATGTCCAGCTGGAGAAGGG + Intergenic
903063274 1:20684734-20684756 CTGCCTTCCAGGATGGAGGCGGG - Intronic
903519215 1:23934758-23934780 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
905485734 1:38294892-38294914 CTGTATCCTCATATGGAGGAAGG + Intergenic
905694904 1:39967074-39967096 CTCCATGCCCAGCTGGTGGAGGG + Exonic
905863579 1:41365332-41365354 CTGCATTCCCAAAGGCAGGGAGG + Intronic
906580871 1:46934356-46934378 CGGTCTTCCCAGATGGAGAATGG - Exonic
906602852 1:47144538-47144560 CGGTCTTCCCAGATGGAGAATGG + Exonic
907485313 1:54774040-54774062 CTGCATGCTCACATGGTGGAAGG + Intergenic
908261191 1:62340393-62340415 CTGCCTTCTCACATGGCGGAAGG + Intergenic
908709739 1:67001776-67001798 CAGCATTGCAAGATGGAGCAGGG - Exonic
909052419 1:70782637-70782659 CTGCATCCTCACATGGTGGAAGG - Intergenic
910011455 1:82468752-82468774 CTGTATCCCCACATGGTGGAAGG + Intergenic
910195981 1:84640112-84640134 CTGAATTCCAAGAGGAAGGAGGG + Intergenic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
911545015 1:99206135-99206157 CTGCATCCACATATGGAGGAAGG + Intergenic
912473081 1:109919004-109919026 CTGCATTCCAAGATGGATAAGGG + Intronic
912695642 1:111840081-111840103 CTGCATCCTCACATGGTGGAAGG + Intronic
913387639 1:118277238-118277260 CTGGATTTGAAGATGGAGGATGG - Intergenic
914947336 1:152079106-152079128 CTCAATTCCCAGATGGTGGGTGG + Intergenic
915021620 1:152785168-152785190 CTGCTTTCCAAGATGGGGGGTGG - Intronic
915647580 1:157284698-157284720 CTGTATTCTCACATGGTGGAAGG + Intergenic
916084917 1:161261464-161261486 CTGCATTCACAGCTGCAGGCGGG + Intronic
916519839 1:165553717-165553739 CTGCAGTCCCAGAGGGCAGAGGG - Intronic
916539223 1:165736097-165736119 CTGCATCCTCACATGGTGGAAGG - Intronic
917347811 1:174046826-174046848 CTGCATCCTCACATGGCGGAAGG + Intergenic
917530767 1:175833060-175833082 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
918215172 1:182387082-182387104 CAGCATTCACAGATTGAGGAGGG + Intronic
918249478 1:182688897-182688919 CTGCATTCCCTTCTGGAGGCTGG - Intergenic
919766027 1:201127805-201127827 CTGCAGTCCCTGGTGGAGGCTGG - Intergenic
920281435 1:204846584-204846606 CTGGATTCCTAGGTGGGGGATGG + Intronic
921031862 1:211341101-211341123 CTACATTCCCAAATGGGGGTGGG - Intronic
921168515 1:212525232-212525254 CTGCATTCCAGGTGGGAGGAAGG + Intergenic
921249749 1:213285850-213285872 CTGCATCCTCACATGGTGGAAGG - Intergenic
922337385 1:224628784-224628806 CTGAATTCCAAAAGGGAGGAGGG - Intronic
922438134 1:225626506-225626528 CTGCATTCTCACATGGTAGAAGG - Intronic
922570619 1:226632782-226632804 CTTCTTTCACAGATGGAGTAAGG + Exonic
922728241 1:227936046-227936068 CTGCATAACAAGATGCAGGAAGG - Intronic
924819443 1:247474410-247474432 CTGAATTCCCAGAATGATGAAGG - Intergenic
1063579161 10:7290165-7290187 CTGCAATTTCAGGTGGAGGAAGG + Intronic
1065012510 10:21432371-21432393 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1065433563 10:25684135-25684157 CTGCATCCTCACATGGTGGAAGG + Intergenic
1065800378 10:29346342-29346364 CCACGTTCCCAGAAGGAGGATGG + Intergenic
1065838848 10:29683448-29683470 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1066339052 10:34511491-34511513 CTGCATCCTCACATGTAGGAAGG + Intronic
1066704584 10:38164344-38164366 CTACATTCTCACATGGAGGTAGG - Intergenic
1066957905 10:42190266-42190288 GTGCATTTCCAGTTGTAGGAAGG + Intergenic
1066997833 10:42580006-42580028 GTGTATTCACTGATGGAGGAAGG + Intronic
1067173670 10:43927349-43927371 CCCCATTCCCAGATGTAGGTGGG + Intergenic
1067577747 10:47418868-47418890 CTGCTGGCCCAAATGGAGGATGG + Intergenic
1068332722 10:55592378-55592400 CAGCATTCCTAGAAGCAGGAGGG - Intronic
1068665493 10:59671065-59671087 CTGCCTTCACAGATGAGGGAGGG + Intronic
1069086573 10:64146843-64146865 CTGACTTTGCAGATGGAGGAAGG + Intergenic
1069853377 10:71424909-71424931 CCGCATGCCCAGTGGGAGGAAGG + Intronic
1070430813 10:76335891-76335913 CTGAATTCCAACAGGGAGGAGGG + Intronic
1071959463 10:90796080-90796102 CTGAATTCCAAAAGGGAGGAAGG + Intronic
1072000863 10:91194387-91194409 CTGGATTTGAAGATGGAGGAAGG + Intronic
1072033331 10:91541772-91541794 CTGCCTTCCAAGAGGAAGGAAGG - Intergenic
1072171093 10:92862491-92862513 CTGCATCCTCACATGGTGGAAGG - Intronic
1072588145 10:96800537-96800559 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1073360491 10:102894584-102894606 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1073607977 10:104915081-104915103 CTGCCTTCCATGGTGGAGGAGGG - Intronic
1074351064 10:112737553-112737575 CTGCATTCCCAGGGGGCGGCAGG + Intronic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1074422679 10:113323224-113323246 TTTCATCCCTAGATGGAGGAAGG - Intergenic
1075037262 10:119080235-119080257 CGGCACTCCCAGATGGCGGCCGG + Intronic
1075212775 10:120505152-120505174 CTGCATTCCAAGAGAGATGAGGG + Intronic
1075271872 10:121059462-121059484 CTGAATTACAAGATGGAGGAGGG + Intergenic
1075406947 10:122201368-122201390 CTGCATTCACATGGGGAGGACGG + Intronic
1075949510 10:126464561-126464583 CTGCTCTCCCAGTTGGAGAAGGG + Intronic
1076474560 10:130743186-130743208 CTGCAGTGCCTGATGGGGGAAGG - Intergenic
1076743989 10:132503717-132503739 CAGGACTCCCAGGTGGAGGAAGG + Intergenic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1076853314 10:133103521-133103543 GTGCATTCCCAGCCTGAGGATGG - Intronic
1076908484 10:133375281-133375303 CTACATTACTTGATGGAGGACGG - Intergenic
1076977336 11:184251-184273 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1077499429 11:2902495-2902517 CTGCATCCCGGGATGGGGGAGGG + Exonic
1080335333 11:31188976-31188998 CTGCATCCTCACATGGTGGAGGG - Intronic
1081233887 11:40621638-40621660 CTGAATTTCAAGATGCAGGAGGG + Intronic
1081439137 11:43061251-43061273 CTGCATCCTCACATGGTGGAAGG + Intergenic
1082772261 11:57217205-57217227 CTGCTTCCCCAGGAGGAGGAAGG - Intergenic
1083198723 11:61106505-61106527 CTTCATTCCCTGCTGGAGGTGGG - Intronic
1083389772 11:62339351-62339373 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1083800141 11:65041752-65041774 CTGCAGGCCCAGGTGCAGGAGGG + Exonic
1083809520 11:65095982-65096004 CTGCTGTCCCAGAAGGGGGACGG - Intronic
1084248099 11:67873987-67874009 CTGCATTCCAACCTGGACGATGG + Intergenic
1086448137 11:86889498-86889520 CTGTATTCCCACAAGGTGGAAGG + Intronic
1087097158 11:94330209-94330231 CTGCATTCTCACATGGTGAAAGG + Intergenic
1087204026 11:95375133-95375155 CAGAACTCCAAGATGGAGGAGGG + Intergenic
1087429643 11:98036412-98036434 CTGCATTCTCACATGGAGGAAGG - Intergenic
1088313764 11:108486918-108486940 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1088458359 11:110056658-110056680 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1088489775 11:110375612-110375634 CTGCATTCTCACATGGTAGAAGG - Intergenic
1088743376 11:112784956-112784978 CTGGAAGCCCAGATGGAGGGTGG + Intergenic
1089286730 11:117412239-117412261 GTGCTTTCTCAGATGGAAGAAGG - Exonic
1089302466 11:117506970-117506992 CTGCATTTCTAGCGGGAGGAAGG - Intronic
1090051126 11:123380832-123380854 CTCCAGTCCCAGAATGAGGAGGG - Intergenic
1090096961 11:123751911-123751933 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1090185281 11:124735004-124735026 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1090788076 11:130068134-130068156 CTGTGTTCGCACATGGAGGAGGG + Intergenic
1090945059 11:131422101-131422123 CTACTTTGCCTGATGGAGGAAGG + Intronic
1091104254 11:132903554-132903576 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1092092809 12:5817762-5817784 CTGCATTTCCAGTTGCTGGATGG - Intronic
1092119457 12:6033869-6033891 CTCCATTCCCAGGAGGAGGAGGG - Intronic
1092139423 12:6172506-6172528 CTGAAGTTCCAGAGGGAGGAAGG + Intergenic
1092418385 12:8309374-8309396 CTGCATTCCAACCTGGACGATGG + Intergenic
1092566417 12:9671042-9671064 CCGCATTTCTAGCTGGAGGATGG - Intronic
1094732087 12:33188611-33188633 CTGGATTTTAAGATGGAGGAGGG + Intergenic
1095547509 12:43388908-43388930 CTGTGTTCTCATATGGAGGAAGG + Intronic
1096754727 12:53789684-53789706 CAGCATTGAAAGATGGAGGAAGG - Intergenic
1096803019 12:54123947-54123969 CTGGATTCCCAGATGAGTGATGG - Intergenic
1097596438 12:61638202-61638224 CTGGATTTGAAGATGGAGGAAGG + Intergenic
1097754623 12:63395982-63396004 CTGCATCCTCACATGGCGGAAGG + Intergenic
1097937115 12:65265192-65265214 CAACATTTCAAGATGGAGGAAGG + Intergenic
1098251345 12:68572840-68572862 CTGCATTCCAAGCAGCAGGAAGG - Intergenic
1098819956 12:75214601-75214623 TTGCATCCTCAGATGGTGGAAGG + Intergenic
1100119570 12:91353193-91353215 CTGTGTTCTCAGATGGTGGAAGG + Intergenic
1100201062 12:92298293-92298315 CTGCATTCTCAGAGGGAAGAGGG + Intergenic
1100506387 12:95224827-95224849 CAGTTTTTCCAGATGGAGGATGG + Intronic
1100882221 12:99031617-99031639 CTGCATTCCCAGATGGAGGAAGG - Intronic
1101469267 12:104981382-104981404 CTGCATTCTCACATGGTAGAAGG - Intergenic
1101654226 12:106705780-106705802 CTCCATCCCCAGATGGACAACGG - Intronic
1102185821 12:110947868-110947890 CTGCCTTTGAAGATGGAGGAAGG - Intergenic
1102416033 12:112763720-112763742 CTGAATTTCAAGAGGGAGGAGGG + Intronic
1102659913 12:114517108-114517130 TTCCATTCCCTGGTGGAGGAAGG - Intergenic
1103143517 12:118573394-118573416 ATGCGTTCTCACATGGAGGATGG + Intergenic
1103301150 12:119927426-119927448 CTGCATCCTCAGACGGTGGAAGG - Intergenic
1103673523 12:122637931-122637953 CTGCAGTCGCAGATGGAGTCTGG + Intergenic
1103991871 12:124804784-124804806 CGCCATTGCCAGCTGGAGGACGG + Intronic
1104277297 12:127341417-127341439 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1104646612 12:130502086-130502108 CTGTCTTGCCTGATGGAGGAGGG + Intronic
1105697928 13:22908912-22908934 CTGCATCCTCACATGGAAGAAGG + Intergenic
1105929323 13:25037436-25037458 CTTCATTCCCACATGGTAGAAGG + Intergenic
1106114695 13:26807106-26807128 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1106473301 13:30076947-30076969 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1106820276 13:33456739-33456761 CTGTATTCCCACATAGTGGAAGG - Intergenic
1107351547 13:39520062-39520084 CTGGGCTCCCAGATGGAGGGTGG - Intronic
1107464514 13:40637047-40637069 CTTCATTCACAAGTGGAGGAAGG + Intronic
1108055217 13:46478509-46478531 CCGCATTCTCACATGGTGGAAGG - Intergenic
1108248422 13:48540865-48540887 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1108415659 13:50195998-50196020 CTGCATTCTCACATGGTGGAAGG + Intronic
1109263996 13:60175625-60175647 CTGGATCCCCACATGGTGGAGGG - Intergenic
1109442880 13:62398058-62398080 CTGAATTCCCAAAGGAAGGAGGG - Intergenic
1109658737 13:65430138-65430160 CTGCATCCTCACATGGTGGAAGG - Intergenic
1109979473 13:69888131-69888153 CTGCATTCTCATATGGCTGAAGG + Intronic
1110947660 13:81443554-81443576 CTGCATTCTCATCTGGAGGCAGG + Intergenic
1112028916 13:95439287-95439309 CTGCATCCTCACATGGTGGAAGG + Intronic
1112504249 13:99966048-99966070 CTGCAGTCCCAGAGGGATCAGGG + Intronic
1113144038 13:107187021-107187043 CTGGATTTTAAGATGGAGGAAGG - Intronic
1113395662 13:109945256-109945278 CTGCATCCTCACATGGTGGAAGG + Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114237904 14:20838174-20838196 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1115300196 14:31876881-31876903 CTGCATTCCCACATGGCAGAAGG + Intergenic
1115565632 14:34622723-34622745 CTGCTTTCCAACAGGGAGGATGG - Intronic
1115679747 14:35723620-35723642 CTACATTCCCAAATTAAGGATGG + Intronic
1115957268 14:38795229-38795251 GTGCACTCACACATGGAGGAAGG - Intergenic
1116596543 14:46855531-46855553 CTGGTTTCCAAGATGGAGGAAGG + Intronic
1116962693 14:50982492-50982514 CTAGAGTCCTAGATGGAGGAGGG + Intronic
1118489213 14:66243058-66243080 CTTCCATCCCACATGGAGGATGG - Intergenic
1118857134 14:69632367-69632389 CTGCATTTACTGAGGGAGGAGGG - Intronic
1119502276 14:75140033-75140055 CTGTGTTCTCACATGGAGGAAGG - Intronic
1119952292 14:78757599-78757621 CTGCATTTCCCAAAGGAGGATGG + Intronic
1120252087 14:82070175-82070197 CTGGCTTCGAAGATGGAGGAAGG + Intergenic
1120622988 14:86789047-86789069 CTGTATTCCAAAAGGGAGGAGGG - Intergenic
1121660882 14:95634126-95634148 CTGAATTCCCAGATGGAACCTGG + Intergenic
1122260636 14:100518766-100518788 CTGTAGTCCCAGCTAGAGGACGG + Intronic
1122547516 14:102532262-102532284 CTGCATTCCCAGAAGTGAGAAGG + Intergenic
1202935208 14_KI270725v1_random:81510-81532 GTGCATTTCCAGTTGTAGGAAGG - Intergenic
1123690232 15:22832648-22832670 CTGGCTTCAAAGATGGAGGAAGG - Intergenic
1124075945 15:26444309-26444331 CTGAATTCCAAAAGGGAGGATGG + Intergenic
1124507879 15:30294553-30294575 CTGCTTTCCCTGATGGAAGAGGG + Intergenic
1124664201 15:31578176-31578198 CTGCATTCCAAAAAAGAGGAGGG - Intronic
1124735676 15:32244104-32244126 CTGCTTTCCCTGATGGAAGAGGG - Intergenic
1125975747 15:43950039-43950061 CTGCATACCAAGAAGGAAGAAGG - Intronic
1125987397 15:44067580-44067602 CTGCATCCTCAGAGGGTGGAGGG + Intronic
1126351664 15:47750749-47750771 CCACATTCCTAGAAGGAGGAAGG + Intronic
1126466985 15:48969785-48969807 CTGCCTTTGGAGATGGAGGAAGG + Intergenic
1128083459 15:64870426-64870448 GTGCTTTCCCACATGGGGGATGG - Intronic
1128430808 15:67591490-67591512 CTGTAGTCCCAGCTGGAGGCTGG - Intronic
1128499147 15:68214984-68215006 CTTCCTTCCCAGAGAGAGGAAGG + Intronic
1128853263 15:70984236-70984258 CTGCATTCCCAGAGGAAACAGGG + Exonic
1129063220 15:72878262-72878284 CTGTATCCTCACATGGAGGAAGG + Intergenic
1129451485 15:75653575-75653597 GTGCCCTCCCAGATGGGGGAGGG + Intronic
1129457361 15:75683031-75683053 CTGTGTTCCCAGATGTGGGAGGG - Exonic
1130177764 15:81592882-81592904 CTGCATCCCCACATGGTGGAAGG - Intergenic
1130685544 15:86033893-86033915 CTGCATTCTCACATGGTGGAAGG + Intergenic
1130815871 15:87432103-87432125 CTGCATTTACAGATGAAGTAAGG + Intergenic
1131335670 15:91546411-91546433 TTGCATACCCCGATGGAGTAAGG + Intergenic
1132129363 15:99261506-99261528 CTGTATTCTCACATGGTGGAAGG + Intronic
1132396629 15:101479620-101479642 CTGGTTTCCCATCTGGAGGACGG + Intronic
1132997682 16:2831703-2831725 CTGCATCCCGGGAAGGAGGATGG + Intronic
1133439178 16:5806339-5806361 CTGCATCCCCACATGGTGGATGG + Intergenic
1133625168 16:7564221-7564243 CTGTGTTCTCAGATGGAAGAGGG - Intronic
1134600514 16:15530072-15530094 CTGGCTTCGGAGATGGAGGAGGG - Intronic
1134842458 16:17412705-17412727 CTGCCTTCCAAGATGGTGGATGG - Intronic
1135591906 16:23711106-23711128 CTGCATCCCCATCTGGGGGAAGG - Intronic
1135661594 16:24301743-24301765 CTGCATGCGAAGATGAAGGAAGG - Intronic
1135875760 16:26198596-26198618 CTGCATTCCCAGAATGAAGTCGG + Intergenic
1136118079 16:28108427-28108449 CGGCTCTCCCAGATGGATGAGGG - Intronic
1138150240 16:54650169-54650191 GTGCTCTCCCAGATGGAGGCAGG + Intergenic
1138748240 16:59388677-59388699 CTGAATTTCAAAATGGAGGAGGG + Intergenic
1138750990 16:59420719-59420741 GTGCCTTCCCAGATTGAGGGTGG + Intergenic
1138802738 16:60054340-60054362 CTGCATTCTCACATGGTGAAAGG - Intergenic
1138918564 16:61498701-61498723 CAGCATTCTCACATGGTGGAAGG + Intergenic
1139238943 16:65370656-65370678 CTGCATTCTCACATGGTAGAAGG + Intergenic
1140418597 16:74797020-74797042 TTGAATTCCCAGAGGGAGGGAGG + Intergenic
1141235656 16:82213565-82213587 CTGGCTTCAAAGATGGAGGAGGG + Intergenic
1141241168 16:82266599-82266621 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1141263348 16:82473717-82473739 CTGGCTTTCAAGATGGAGGAAGG - Intergenic
1141311785 16:82920502-82920524 CTCCATTCCTAGTTGTAGGAGGG - Intronic
1141659130 16:85432234-85432256 GGGCACGCCCAGATGGAGGAGGG + Intergenic
1142367123 16:89656635-89656657 CTGCTTCCCCACATGGAGAATGG + Intronic
1142397886 16:89843089-89843111 CTGCATGCCCAGTTCAAGGAAGG + Intronic
1142442916 16:90112431-90112453 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1203143106 16_KI270728v1_random:1781825-1781847 GTGGATCCCCAGATGGAGGATGG + Intergenic
1203143147 16_KI270728v1_random:1782105-1782127 GTGGATCCCCAGATGGAAGATGG + Intergenic
1203143170 16_KI270728v1_random:1782250-1782272 GTGGATCCCCAGATGGAGTATGG + Intergenic
1142464787 17:128961-128983 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1143208160 17:5161319-5161341 CTGTAAGCCCAGATAGAGGATGG + Intronic
1143348193 17:6265908-6265930 CTGCCTTTGAAGATGGAGGAAGG - Intergenic
1145189507 17:20826713-20826735 CTGCAGTCCCAGATATTGGAGGG + Intergenic
1145223363 17:21107304-21107326 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1148862576 17:50612378-50612400 CCGGCTTCCCAGATGGAGGGAGG + Intronic
1149518966 17:57303958-57303980 CTGAATTACTAGAGGGAGGAGGG + Intronic
1149601787 17:57898197-57898219 CTGCATCCCCAGCAGGAGGCAGG - Intronic
1149729025 17:58925992-58926014 CACAATTCCCAGTTGGAGGAGGG - Intronic
1149872241 17:60193117-60193139 CTGTAAGCCCAGATAGAGGATGG - Intronic
1149933693 17:60781980-60782002 CTGAATTTCTAGGTGGAGGATGG - Intronic
1150077394 17:62204219-62204241 CTGCAGTCCCAGATACTGGAGGG - Intergenic
1150800505 17:68278252-68278274 CTGAAGTGCCTGATGGAGGATGG - Exonic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1152823902 17:82451691-82451713 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1152904924 17:82964984-82965006 GTGCACTCCCACAGGGAGGACGG + Intronic
1153169633 18:2301166-2301188 CTGCCTTTCAAGATGGAGGAAGG + Intergenic
1153304591 18:3620281-3620303 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1153343964 18:4006529-4006551 TTGCAGTCACAGTTGGAGGAGGG + Intronic
1153867993 18:9290883-9290905 CTGACTTCCCAAAGGGAGGAGGG - Intergenic
1155025299 18:21935340-21935362 CTGCAGTCCCACATGGAAGGGGG - Intergenic
1155036220 18:22026968-22026990 CTGCCTGCCCAGGTGGGGGACGG - Intergenic
1155075752 18:22352830-22352852 GTTCATTACCAGATGGATGAAGG - Intergenic
1155699811 18:28730177-28730199 CTGCATTCTCACATGGGAGAAGG - Intergenic
1156069857 18:33193937-33193959 CTGCATCATCACATGGAGGAAGG + Intronic
1156963964 18:43067767-43067789 CTGAATTCCAAAAGGGAGGAAGG + Intronic
1157179817 18:45487227-45487249 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1157401864 18:47395453-47395475 CTGTGTTCCCAGCAGGAGGAAGG + Intergenic
1158212574 18:55067693-55067715 TAGCATTCAGAGATGGAGGATGG - Intergenic
1158645840 18:59246311-59246333 CTGCATCCTCACATGGTGGAAGG + Intergenic
1159463897 18:68754865-68754887 CTGCATGCTCACATGGTGGAAGG - Intronic
1160067854 18:75594175-75594197 CTGGTTTACAAGATGGAGGAAGG + Intergenic
1160245939 18:77159468-77159490 CTGCATCCCCACATGGTGGAAGG - Intergenic
1160947623 19:1651112-1651134 CTCCATTCTAAGATGGGGGATGG + Intronic
1161759277 19:6159366-6159388 CAGCATTCCCAGCTGGAAGAAGG - Intronic
1161846218 19:6713305-6713327 CTCCCTTCTCAGATTGAGGATGG - Exonic
1163011445 19:14429084-14429106 CTGCCTCCCCAGATGGAGCTGGG - Intergenic
1164613616 19:29650907-29650929 CTGAATTCCAAGAGGGAGGAGGG + Intergenic
1165386558 19:35513591-35513613 CTGCAGACCCAGAGGGAGGGAGG - Exonic
1165854527 19:38871482-38871504 TTGTAGTCCCAGAGGGAGGAGGG - Intronic
1165929917 19:39350787-39350809 CTGCACTCCCACCTGGAGAAAGG - Intronic
1165943498 19:39427444-39427466 CTGCAATCCCAGCTAGAGGCAGG - Exonic
1166156041 19:40911808-40911830 CTGCGTTCTCACATGGTGGAAGG + Intergenic
1166593986 19:44028104-44028126 CTGCTTTTGAAGATGGAGGAAGG - Intronic
1166599654 19:44082721-44082743 CTGCTTTTGAAGATGGAGGAAGG - Intronic
1166601753 19:44101859-44101881 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1166603571 19:44119498-44119520 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1167201101 19:48066137-48066159 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1167237665 19:48325066-48325088 CTGCTTTCCCTGATGGAGCTTGG - Intronic
925333723 2:3077901-3077923 CGGGATTCCCAGATACAGGAGGG - Intergenic
925567951 2:5276991-5277013 CTGCATTCGCAGATGGTGTTAGG - Intergenic
925679087 2:6398223-6398245 CTGCATTTCCACAAGGAGAAGGG - Intergenic
926288503 2:11509734-11509756 CTGCATCCTCACATGGTGGAAGG - Intergenic
926961867 2:18365819-18365841 CTGCATCCTCACATGGTGGAGGG - Intergenic
927440311 2:23111414-23111436 TTGCATGCCCAGAGGGTGGAAGG - Intergenic
927458041 2:23274478-23274500 CTGCATCCTCACATGGTGGAAGG - Intergenic
927517280 2:23679862-23679884 CTGCTTGGCCAGATGGAGGAAGG + Intronic
928682063 2:33712765-33712787 CTGAATTCCAAGAGGTAGGAGGG - Intergenic
928807563 2:35178879-35178901 CTGGATTCTGAGATGGAGGAAGG - Intergenic
928844130 2:35648713-35648735 CTGTATTCTCACAGGGAGGAAGG + Intergenic
930505714 2:52280990-52281012 CTGTGTTCTCAGATGGAGGAAGG + Intergenic
930618889 2:53624145-53624167 CTGCATTCTCAAATGGTAGAAGG - Intronic
930689155 2:54341343-54341365 CTGCATCCTCACATGGTGGAAGG - Intronic
931654559 2:64499205-64499227 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
931998207 2:67859099-67859121 CTGAATCACCATATGGAGGATGG + Intergenic
932359290 2:71091324-71091346 CTGCATCCTCATATGGTGGAAGG - Intergenic
933850530 2:86362940-86362962 CTGCATTCTCACATGGTGGAAGG - Intergenic
934306024 2:91822783-91822805 GTGCATTTCCAGTTGTAGGAAGG + Intergenic
934327232 2:92029959-92029981 GTGCATTTCCAGTTGTAGGAAGG - Intergenic
934465614 2:94260539-94260561 GTGCATTTCCAGTTGTAGGAAGG - Intergenic
934853072 2:97713418-97713440 CTGCCTGCCCAGCTGCAGGATGG - Intergenic
935476981 2:103534745-103534767 GTGCCTACCCAGATTGAGGATGG - Intergenic
935586975 2:104809462-104809484 CTGCATTCTTACATGGTGGAAGG - Intergenic
936726196 2:115319846-115319868 CTGCATTCTCACATGGCAGAAGG + Intronic
937098005 2:119248222-119248244 CTGAGTTGCCAGAGGGAGGAAGG - Intronic
937153973 2:119705324-119705346 CTGCATTCTCATCTGGAGGCTGG + Intergenic
937342025 2:121097185-121097207 CTGGATTTGAAGATGGAGGAAGG + Intergenic
937473450 2:122193061-122193083 CTGCATTCCCAGATTCAGGGTGG + Intergenic
937613916 2:123897161-123897183 CTGCACTCCCACCTGGGGGATGG - Intergenic
937677537 2:124608429-124608451 CTGCATGCTCAGATAGAGGCAGG - Intronic
938259745 2:129887073-129887095 CTGAATTCCAAAATGGATGAGGG + Intergenic
938928635 2:136066747-136066769 CAAGATTCACAGATGGAGGATGG + Intergenic
938966457 2:136392995-136393017 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
939452625 2:142393739-142393761 CTGCATTTCCAGCTGGTGGTTGG - Intergenic
941287353 2:163630637-163630659 CTGCATTCCCAGATTTAGCAAGG + Intronic
942605040 2:177681747-177681769 CTGAATTCCAAAAGGGAGGAAGG - Intronic
943509320 2:188804248-188804270 GTGCATTTCCAGTTGTAGGAAGG + Intergenic
943538706 2:189184569-189184591 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
943657250 2:190522611-190522633 CTGAATTCCAAAAGGGAGGAGGG - Intronic
947154807 2:227151790-227151812 CTGCATCCTCACATGGTGGAAGG - Intronic
948771605 2:240253985-240254007 CTGGCTTCCCAGAGGGAGGCAGG + Intergenic
1169301440 20:4445171-4445193 CTGCATCATCAGATGGTGGAAGG - Intergenic
1169332765 20:4729744-4729766 ATGCATTCCCAGAGGCATGAGGG - Intergenic
1169363874 20:4975234-4975256 CTGCATTCCCAGAAGGAATTGGG - Intronic
1170823772 20:19776206-19776228 CTGAATTCCCAAAGGGAGGAGGG - Intergenic
1171058659 20:21934024-21934046 CTGCATTCCAACATGGAGGACGG - Intergenic
1171793741 20:29550641-29550663 CTGGATTCCCAGATGAGTGATGG + Intergenic
1171854729 20:30333749-30333771 CTGGATTCCCAGATGAGTGATGG - Intergenic
1172004786 20:31811627-31811649 CTCCATTCCCAGAATGAAGACGG + Intergenic
1172362237 20:34321278-34321300 CTGCATTCCCAGATGGTTTAAGG + Intergenic
1173010684 20:39179027-39179049 CTGCATTCCCACATGGCGAAAGG + Intergenic
1173054587 20:39598790-39598812 CTGCACTCCTGGCTGGAGGATGG - Intergenic
1173275991 20:41583024-41583046 CTGGAGTCCCAGATGGCAGAAGG + Intronic
1173313772 20:41925100-41925122 CTGCACTCCCACTTGGAGGCAGG + Intergenic
1173495079 20:43513047-43513069 CTGAATCCCCAGAGGGAGGAGGG + Intronic
1173570326 20:44071641-44071663 CTGCCTCCCAAGAAGGAGGAAGG - Intergenic
1175212977 20:57373075-57373097 CTGCCTCCCCAGCTGGAGGAGGG - Intronic
1175282115 20:57810958-57810980 CTGCATTCCACGCAGGAGGAGGG + Intergenic
1175390974 20:58627206-58627228 CTGTAGTGCAAGATGGAGGAGGG + Intergenic
1175972798 20:62695469-62695491 CTGCCTTGCCAGGTGGACGAGGG - Intergenic
1176596624 21:8703746-8703768 GTGCATTTCCAGTTGTAGGAAGG - Intergenic
1177535302 21:22419542-22419564 CTGTATTCTCACATGGTGGAAGG - Intergenic
1178242629 21:30920345-30920367 CTGCATTCCCAGTTGGTGATTGG + Intergenic
1178570597 21:33732298-33732320 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1178804101 21:35824162-35824184 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1178814461 21:35915296-35915318 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1178897385 21:36570351-36570373 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1179553308 21:42156901-42156923 CTGCATTCTCACCTGGAAGAAGG - Intergenic
1180113660 21:45681000-45681022 CTGCATTCTCACATGGCAGAAGG + Intronic
1180279543 22:10681188-10681210 GTGCATTTCCAGTTGAAGGAAGG - Intergenic
1180586756 22:16899718-16899740 GTGCATTTCCAGTTGTAGGAAGG - Intergenic
1180883254 22:19221567-19221589 CTGGAGTCCCAGATTCAGGAAGG - Exonic
1181386668 22:22550853-22550875 CAGCACTCCCAGAGGGAGGCAGG + Exonic
1181555500 22:23669326-23669348 CTGTAATCCCAGCTGGTGGAAGG + Intergenic
1182109814 22:27715195-27715217 CTGCCTTCCCAGCTGGACGAGGG - Intergenic
1182455440 22:30447532-30447554 CTGAATTCCGAAAGGGAGGAGGG + Intergenic
1184167346 22:42737766-42737788 CTGCCTTCCCAGATGGTTAAGGG + Intergenic
1185270593 22:49927893-49927915 CTTCATTCCCAGATGAGGAACGG - Intergenic
949403329 3:3688436-3688458 CTGTATTCCAAAAGGGAGGAGGG + Intergenic
950787729 3:15450065-15450087 CAGCATTGCCAGATGGAGGGAGG - Intronic
950948769 3:16977903-16977925 CTGCATCCTCACATGGTGGAAGG + Intronic
951159038 3:19393515-19393537 CGGAAGTCCCAAATGGAGGAGGG - Intronic
951350214 3:21597846-21597868 CTGCCTTTCCAGATGAAGGTTGG - Intronic
951599120 3:24353603-24353625 TTGCATTGCCAGGTGCAGGAAGG + Intronic
952124794 3:30287798-30287820 CTGCATCCACACATGGTGGAAGG - Intergenic
952394340 3:32908013-32908035 CTGCATTCCAGGCTGGATGATGG - Intergenic
952686241 3:36151816-36151838 CTGCATCCTCATATGGTGGAAGG + Intergenic
953007979 3:38995499-38995521 CTGCCTCCCAACATGGAGGAAGG - Intergenic
953129864 3:40127638-40127660 CTGCATTCCCGGTTGGGGGTGGG + Intronic
953422333 3:42764229-42764251 CTGAATTCCAAAAGGGAGGAGGG + Intronic
953817964 3:46177287-46177309 CTGCCTTGCTAGATGGGGGAAGG + Intronic
954923502 3:54212601-54212623 CTGAATTCCAAAAGGGAGGAGGG + Intronic
955877872 3:63512639-63512661 CTGAATTCAAAGCTGGAGGAAGG + Intronic
956571862 3:70705569-70705591 CTGCATCCTCACATGGGGGAAGG + Intergenic
957468231 3:80623002-80623024 ATGCATTCCCACATGATGGAAGG + Intergenic
957827340 3:85465350-85465372 CTGCATTCCCAGGTGGTCGATGG - Intronic
957903168 3:86523728-86523750 CTGAATTCGAAGATGGAGGATGG - Intergenic
958579320 3:95997152-95997174 CTGGATTCCCAGATATAGAAAGG - Intergenic
959003227 3:100989147-100989169 CTGCATCCTCACATGGTGGAAGG - Intronic
959562258 3:107796095-107796117 CTTCATTCAGAGATGGAGGTTGG - Intronic
959798534 3:110462287-110462309 CTGCATTCTGACATGGTGGAAGG + Intergenic
959886674 3:111510451-111510473 CTGCATCTTCACATGGAGGAAGG + Intronic
961176923 3:124843187-124843209 TTACATTCCCAGCTGGAAGAAGG + Intronic
961198570 3:125025265-125025287 CTGCATCCCCACGGGGAGGAGGG + Intronic
961562400 3:127739832-127739854 CTGCATGCACACTTGGAGGATGG - Intronic
961896064 3:130168593-130168615 CTGCATTCCAACCTGGACGATGG + Intergenic
963024884 3:140909844-140909866 CTGTAATCCCAGATGGCTGAGGG - Intergenic
963534485 3:146511113-146511135 CTGCATTCTCACATGGCGGAAGG - Intergenic
965441376 3:168719294-168719316 CTGTATCCCCATATGGTGGAAGG - Intergenic
965579105 3:170248002-170248024 CTGCATATCCAGAGGCAGGATGG + Intronic
965742701 3:171892595-171892617 CTGAATTTCCAGATGGAGAAAGG - Intronic
966297790 3:178444166-178444188 CTGCATCCCCACAAGGTGGAAGG - Intronic
966490027 3:180517054-180517076 ATGAATTCCCACATGGAGGCAGG + Intergenic
966493544 3:180555186-180555208 CTGCATTCCCACATGATGAAAGG + Intergenic
967000231 3:185327177-185327199 CTGGCTTCGAAGATGGAGGAAGG - Intronic
967097946 3:186193153-186193175 GTGCATTCCAAGAGGGAGGGAGG - Intronic
967985939 3:195095405-195095427 CCCCAGTCCCAGATGGTGGAAGG - Intronic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
968363188 3:198163391-198163413 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
968654683 4:1773395-1773417 CCGCATGCCCAGAGGGAGGCCGG - Intergenic
969049853 4:4365038-4365060 CTGCCTTTGAAGATGGAGGAAGG - Intronic
969218547 4:5743673-5743695 CTGCATCCCAGGAAGGAGGAAGG + Intronic
969226399 4:5801317-5801339 CTGCATTCCAGGTAGGAGGAGGG + Intronic
969746697 4:9078380-9078402 CTGCATTCCAACCTGGACGATGG - Intergenic
970018083 4:11535052-11535074 TTGCATTTGGAGATGGAGGAGGG + Intergenic
970573029 4:17401241-17401263 CTGGCTTCAAAGATGGAGGAAGG - Intergenic
970664867 4:18325177-18325199 CTTCATTCCAAGCTGTAGGATGG + Intergenic
970800091 4:19963067-19963089 CTGCATCCTCACATGGTGGAGGG + Intergenic
971215777 4:24661181-24661203 CTGCATTCCCAGATGGTTAAGGG - Intergenic
971725808 4:30310319-30310341 CTGCATTTCCAGGTGGAGTATGG - Intergenic
973264838 4:48200774-48200796 CTGAATTGCAAGCTGGAGGAAGG - Intronic
974637381 4:64582644-64582666 CTGTTTTCCCACATGGGGGAAGG + Intergenic
974770475 4:66405072-66405094 CTGCATTCTCTCATGGTGGAAGG - Intergenic
976186875 4:82451081-82451103 CTCCATTCCCAGATGCTGCAGGG - Exonic
977125717 4:93165032-93165054 CTGCATTCTCATCTGGAAGATGG + Intronic
977206950 4:94173822-94173844 CTCCATTCTCACATGGAGAAGGG - Intergenic
977377734 4:96228566-96228588 CTGCATTCTCACATGACGGAAGG + Intergenic
977553105 4:98463195-98463217 CTGCCTACCCAGATTGAGGGTGG - Intergenic
977663177 4:99614700-99614722 CCTCATTCCAAGATGGAAGAAGG + Intronic
977959823 4:103072987-103073009 CTGTGTTCTCAGATGGTGGAAGG - Intronic
978104955 4:104890809-104890831 GGGCATTCCCAGCAGGAGGAAGG + Intergenic
978423044 4:108554253-108554275 CTGAATTCCAAAAGGGAGGACGG - Intergenic
979701997 4:123679753-123679775 CTGCATTCTCAGAATTAGGATGG - Intergenic
980078068 4:128314866-128314888 CTGCATTCTGAGCTGGAGGAGGG - Intergenic
980513750 4:133826130-133826152 GTGCATTTCCAGTTGAAGGAAGG + Intergenic
980976571 4:139616785-139616807 CTGCATCCTCACATGGTGGAAGG + Intergenic
982449322 4:155533246-155533268 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
982676019 4:158376696-158376718 CTGCATCATCACATGGAGGAAGG + Intronic
983557842 4:169074242-169074264 CTGCATTCTCACATGGTGGAAGG + Intergenic
984316434 4:178137565-178137587 CTGCAATCGCCGATGGAGGGAGG - Intergenic
985504207 5:269678-269700 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
986800792 5:11257955-11257977 CTCTATTCCCCGATGGAAGAGGG - Intronic
987542289 5:19271160-19271182 CTGAATTCCAAAAGGGAGGAAGG + Intergenic
988600147 5:32632172-32632194 CTGCCTCCACAGATGGAGCAAGG - Intergenic
988882534 5:35518802-35518824 CTGAAGTTCCAGATGGAGGGAGG - Intergenic
988999119 5:36742842-36742864 CTGACTTCAAAGATGGAGGAAGG + Intergenic
990215841 5:53530908-53530930 CTTCATCCCCAAATGGAGGCAGG - Intergenic
990232521 5:53729129-53729151 CTGTAGTCCCAGAAGGTGGAGGG + Intergenic
990907759 5:60822025-60822047 CAACATTCCCAAAAGGAGGAAGG - Intronic
991532093 5:67626849-67626871 CTGCATTCTCACATGGCAGAAGG - Intergenic
991953708 5:71971725-71971747 CTGTATTCTCACATGGGGGAAGG + Intergenic
992041217 5:72835473-72835495 CTGCATCCCCACATGGACGAAGG + Intronic
992041454 5:72837323-72837345 CAGCATCCTCACATGGAGGAAGG + Intronic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992583667 5:78209243-78209265 CTGAATTCCAAAAGGGAGGAGGG - Intronic
992596255 5:78350396-78350418 CTGCATTCTTATATGGTGGAAGG - Intergenic
992832184 5:80604449-80604471 CTGCATTCCGACATGGCAGAAGG - Intergenic
993164584 5:84335927-84335949 CTGTTTCCTCAGATGGAGGAAGG + Intronic
993526927 5:88976489-88976511 CTGCATTCTCACATGGTAGAAGG + Intergenic
994835419 5:104845904-104845926 CTGGATTCCCTGATGCAGAAAGG + Intergenic
995058585 5:107789321-107789343 CTGCATCCTCACATGGTGGAAGG - Intergenic
996058069 5:119001982-119002004 CTGGCTTCACAGATGGAGGATGG - Intergenic
996688716 5:126313938-126313960 CTGGATTCCAAGAGGGAGGAGGG + Intergenic
997260741 5:132463996-132464018 CTCCAACACCAGATGGAGGAGGG + Exonic
998511692 5:142719058-142719080 ATGGGCTCCCAGATGGAGGAGGG + Intergenic
999297229 5:150467305-150467327 CTGCATCCTCACATGGTGGAAGG - Intergenic
1000600278 5:163265613-163265635 ATGCATTTCCAGAAGGAGCAGGG + Intergenic
1000827284 5:166060617-166060639 CTGCATCATCACATGGAGGAAGG - Intergenic
1001335618 5:170794410-170794432 CTGCCATTCCAAATGGAGGAGGG - Intronic
1001676522 5:173522262-173522284 CTGCGTTCTCACATGGAAGAGGG - Intergenic
1002824079 6:756926-756948 CTGCATTTGGAGATGAAGGAAGG + Intergenic
1003108199 6:3231354-3231376 CTGGCTTCCCAGGCGGAGGAGGG - Intronic
1003601142 6:7518675-7518697 CTGGGTTCCCTGATGGAAGAGGG - Intergenic
1003777134 6:9380111-9380133 CTGCATTCCAGGCAGGAGGAAGG - Intergenic
1004977673 6:20985764-20985786 CTGCATTCCAACCTGGATGATGG + Intronic
1005488115 6:26320364-26320386 CAGCCTTCTAAGATGGAGGAAGG + Intergenic
1006051673 6:31350145-31350167 CTGAATTCCAAGAGGGAAGAGGG + Intronic
1007367471 6:41405203-41405225 CTGCATTCTCACATGGCTGAAGG + Intergenic
1007828114 6:44616975-44616997 CTGCATCCTCACATGGTGGAGGG - Intergenic
1008671282 6:53771866-53771888 CTGCTTTCACTCATGGAGGAAGG + Intergenic
1009500794 6:64410231-64410253 CAGCATTCCCTGATGGCTGATGG + Intronic
1010106388 6:72174117-72174139 CTCAAATCACAGATGGAGGAGGG - Intronic
1013115841 6:107103192-107103214 CTGCATCCCCAGCTGGCGCAGGG + Intronic
1013297735 6:108774618-108774640 CTGCATTCTGATCTGGAGGAGGG + Intergenic
1013317040 6:108953168-108953190 CTGCATTCCCAGAAGCCGGTGGG + Exonic
1014503618 6:122225793-122225815 CTGCATCCTCACATGGTGGAAGG + Intergenic
1014512571 6:122342212-122342234 CTGGCTTCACAGATGGAGAATGG + Intergenic
1015213718 6:130725758-130725780 CTATATTCCCAGTAGGAGGAAGG + Intergenic
1016964825 6:149709204-149709226 CTGAATTCCAACAGGGAGGAGGG - Intronic
1016983395 6:149874927-149874949 CTGCATCCCCACATGGTGGAAGG + Intergenic
1017607680 6:156150875-156150897 CTGTATTCTCACATGGTGGAAGG + Intergenic
1017631225 6:156397757-156397779 CTGCTAGCCCAGAGGGAGGAAGG + Intergenic
1017807644 6:157959938-157959960 CTGCATCCTCACATGGAGGAAGG - Intergenic
1018648250 6:165968129-165968151 TGTCATTCCCTGATGGAGGAGGG - Intronic
1019252492 7:25320-25342 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1020222052 7:6246469-6246491 ATGCATTCCTCGCTGGAGGAGGG - Intronic
1021811594 7:24407055-24407077 CTGCATTCCTAGAGGAATGAAGG + Intergenic
1022010016 7:26300632-26300654 CTGCCTTCAGAGATGGAGGCTGG - Intronic
1022349323 7:29552561-29552583 CTGCATTCCTTTATGGAGGCTGG + Intergenic
1024395520 7:48862309-48862331 CTGCATTCCAAGCAGGAAGAAGG + Intergenic
1024399712 7:48909968-48909990 CTGCATTCCAAGCAGGAAGAAGG - Intergenic
1024797528 7:53036452-53036474 CAGAAGTCCCAGATGGCGGATGG - Exonic
1024974318 7:55099503-55099525 ATGCAGTCCCAGATGGAGGGGGG + Intronic
1025946715 7:66110327-66110349 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1026606435 7:71819996-71820018 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1026658995 7:72282561-72282583 CTGCATTTTCACATGGTGGAAGG - Intronic
1027609979 7:80348405-80348427 GTCCATTCCCAGATGGAGGGAGG + Intergenic
1028325413 7:89518258-89518280 GTGCCCTCCCAGAAGGAGGAAGG - Intergenic
1028357368 7:89925635-89925657 CTGCATTTCCTGATAGAAGATGG + Intergenic
1030262603 7:107580634-107580656 TTGCCTTCCCAGGTGGGGGAAGG + Intronic
1030507553 7:110443918-110443940 CTGGATTCAAAGATGCAGGAGGG - Intergenic
1030985239 7:116233839-116233861 CTGCATCTTCACATGGAGGAAGG + Intronic
1031489181 7:122366759-122366781 CTGGATTCACAGAAAGAGGATGG - Intronic
1032306816 7:130741796-130741818 CTGCCTTTACAGAGGGAGGAAGG - Intergenic
1033345940 7:140525859-140525881 CTGCATGCCAAGAAGGAAGAAGG - Intronic
1033712599 7:143963860-143963882 GTGCCTACCCAGATTGAGGATGG + Intergenic
1034051475 7:147988708-147988730 CAGCATCCCCAGATGCAGGCGGG + Intronic
1034826370 7:154268423-154268445 CTGTATTCTCATATGGTGGATGG + Intronic
1034961133 7:155365299-155365321 CTGCCTTCCCAGATAGTGGACGG + Intronic
1035112447 7:156494629-156494651 TTGCATTCCCAGATTAAGGCTGG + Intergenic
1035601346 8:898686-898708 CTGCATTCCCAGCTCTAAGAAGG + Intergenic
1036067307 8:5396200-5396222 CGGCATTCTCACATGGAGGAAGG + Intergenic
1036911754 8:12763376-12763398 CTGTATCCCCACATGGAAGAAGG + Intergenic
1038739506 8:30204578-30204600 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1039099742 8:33928481-33928503 CTGCATTCTCACATGGTGGAAGG + Intergenic
1039214803 8:35258146-35258168 CTGCATCGTCACATGGAGGAAGG + Intronic
1039722202 8:40176245-40176267 CTGAATTCCAAAAGGGAGGAAGG - Intergenic
1039997925 8:42550530-42550552 CTGGCTTTGCAGATGGAGGAAGG - Intronic
1040020884 8:42739904-42739926 CTGAATTCCAAAAAGGAGGAGGG + Intergenic
1040889736 8:52304819-52304841 CTGTGTTCTCACATGGAGGAAGG + Intronic
1041116164 8:54539627-54539649 CTCTATTAACAGATGGAGGAAGG - Intergenic
1042295811 8:67216336-67216358 CTGCATTCTCACGTGGTGGAAGG - Intronic
1042613137 8:70619576-70619598 CAGCAATCACAGATAGAGGAAGG + Intronic
1042849891 8:73206161-73206183 CTGCAATCCCAGCAAGAGGAGGG - Intergenic
1042997950 8:74721643-74721665 CTGCATTCCAAGAGGGTGAAAGG + Intronic
1043098411 8:76006184-76006206 CTGCCTTCTCACATGGGGGAAGG - Intergenic
1044802863 8:95975061-95975083 CTGCCTTTGGAGATGGAGGAGGG + Intergenic
1045328716 8:101137035-101137057 TTGCATTCACAAATGGTGGAGGG + Intergenic
1045391425 8:101718782-101718804 CTGAATTCCAAGAGGAAGGAGGG - Intronic
1045404475 8:101852008-101852030 CTGCATCCTCACATGGTGGAAGG - Intronic
1045533523 8:103006085-103006107 CTGAATTCCAAAAGGGAGGATGG + Intergenic
1046079430 8:109353341-109353363 CTGCATCCTCACATGGTGGAAGG + Intergenic
1046152752 8:110249749-110249771 CTGCATTCCCAGATGAATTTAGG + Intergenic
1046704258 8:117433392-117433414 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1046903498 8:119547109-119547131 CTGTCTTCCAAGAAGGAGGAAGG - Intergenic
1047721162 8:127641006-127641028 CTGTCTCCCCAGATGGAGCATGG - Intergenic
1048316619 8:133367833-133367855 CTGGATTTCAAGAGGGAGGAAGG + Intergenic
1048736595 8:137508906-137508928 CTGAATTCCCTGCTGAAGGATGG - Intergenic
1048841795 8:138573041-138573063 CTGCATCCTAATATGGAGGAAGG + Intergenic
1048937927 8:139372373-139372395 CTGGATTTGCAGATGGGGGAAGG - Intergenic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1049467588 8:142759121-142759143 CTGAATTCCAGGAGGGAGGAGGG - Intergenic
1050682140 9:8124133-8124155 CAGCACTCCCAGAGGAAGGAGGG - Intergenic
1051370163 9:16352447-16352469 CTGCATTCCCAGCTGGGTGAAGG + Intergenic
1051508238 9:17848384-17848406 CTGAATTCTCAGATTGTGGAAGG - Intergenic
1051741747 9:20259084-20259106 CTGGCTTCCAAGATGGAGGAAGG + Intergenic
1052338911 9:27346135-27346157 CTGCATTCTCACATGGCAGAAGG - Intronic
1053468815 9:38330542-38330564 CTGCATTCCAAGAGTGATGAAGG + Intergenic
1053695678 9:40637322-40637344 GTGCATTTCCAGTTGTAGGAAGG - Intergenic
1053792553 9:41697030-41697052 CTGGATTCCCAGATGAGTGATGG - Intergenic
1053942668 9:43268362-43268384 GTGCATTTCCAGTTGTAGGAAGG - Intergenic
1054152621 9:61617790-61617812 CTGGATTCCCAGATGAGTGATGG + Intergenic
1054180966 9:61909051-61909073 CTGGATTCCCAGATGAGTGATGG - Intergenic
1054306925 9:63436540-63436562 GTGCATTTCCAGTTGTAGGAAGG - Intergenic
1054405656 9:64760528-64760550 GTGCATTTCCAGTTGTAGGAAGG - Intergenic
1054439283 9:65246015-65246037 GTGCATTTCCAGTTGTAGGAAGG - Intergenic
1054491123 9:65775924-65775946 GTGCATTTCCAGTTGTAGGAAGG + Intergenic
1054656625 9:67672091-67672113 CTGGATTCCCAGATGAGTGATGG + Intergenic
1054698946 9:68392558-68392580 ACGCATTCCCAAATGGAGCAGGG - Intronic
1054798834 9:69326479-69326501 CAGCGTTCCCGGTTGGAGGAGGG - Intronic
1055336036 9:75234548-75234570 CTGCATTCTGACATGGTGGAAGG - Intergenic
1055449526 9:76418378-76418400 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1055709752 9:79047855-79047877 TTGCATTCCCAGGAGGTGGAAGG + Intergenic
1056200758 9:84274080-84274102 CTGCATGACCAGAAGGTGGAAGG + Intergenic
1056463234 9:86828322-86828344 CTGCATGCCCCACTGGAGGAGGG - Intergenic
1056673685 9:88654650-88654672 CTGCATTCCAAGCAGGAAGACGG - Intergenic
1056681982 9:88727369-88727391 CTGAATTCCAAGAGGAAGGAGGG + Intergenic
1056995344 9:91452116-91452138 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1057974391 9:99588881-99588903 CTGCATCCTCACATGGTGGAAGG - Intergenic
1058125494 9:101189464-101189486 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1058791377 9:108449276-108449298 TTGGATTCCCAGATGCTGGATGG + Intergenic
1059336528 9:113572559-113572581 CTGCAGGCCCTGAAGGAGGAGGG + Intronic
1060731727 9:126041503-126041525 CTGCATCCTCATATGGTGGAAGG - Intergenic
1060757426 9:126223584-126223606 CTGCTTTCACAGATGAGGGACGG - Intergenic
1060785884 9:126451386-126451408 CTGCACCTCCAGGTGGAGGAGGG + Intronic
1061020261 9:128009763-128009785 CGGCATTCCCGGATGCAGGAGGG - Intergenic
1061705142 9:132447294-132447316 CTGCATCCCCAGAAAGAGGCAGG - Intronic
1062333975 9:136056862-136056884 CTTTCTTCCCAGATGGAGAAGGG + Intronic
1062747875 9:138227051-138227073 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1202778123 9_KI270717v1_random:10934-10956 GTGCATTTCCAGTTGTAGGAAGG - Intergenic
1185540167 X:897020-897042 CTGGCTTCGAAGATGGAGGAAGG - Intergenic
1185817358 X:3168727-3168749 CTGAATTCCAAAAAGGAGGAGGG + Intergenic
1185886644 X:3789270-3789292 CTGCATTTCCAGATGATTGAGGG - Intergenic
1186690110 X:11966338-11966360 CTGCATTCTCACATGGAAGAAGG - Intergenic
1186936034 X:14450740-14450762 CTGCATTCCAGCATGGATGATGG - Intergenic
1186963463 X:14762130-14762152 CTGCATCCTCACATGGTGGAAGG + Intergenic
1188848573 X:35104094-35104116 GTGCATTCCCAGATTGAGGATGG - Intergenic
1188876209 X:35433555-35433577 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1189633775 X:42983056-42983078 CTGCATACTCACATGGTGGAAGG + Intergenic
1189740147 X:44109446-44109468 CTGCATCCTCACATGGTGGAAGG + Intergenic
1189758752 X:44299286-44299308 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1189940650 X:46117468-46117490 CTGCATTCCCACATGCTGGCAGG + Intergenic
1190101288 X:47524468-47524490 CTGCAGTCCCAGACTAAGGAAGG + Intergenic
1190211782 X:48454565-48454587 CTGCATTCTCATATGGCAGAAGG - Intergenic
1190952760 X:55162286-55162308 CTGCATTCCCTGAGGATGGAAGG + Intronic
1191654899 X:63585960-63585982 CTGCATTCCCATGTGCTGGAGGG + Intergenic
1191724885 X:64268895-64268917 CTGAATACCCTGATGGAGAATGG - Exonic
1191820447 X:65300434-65300456 TTGCATTCCCAGAAGGATTATGG - Intergenic
1191885635 X:65885031-65885053 CTGCATCCTCAGATGGTGGAAGG - Intergenic
1192018153 X:67354461-67354483 CTGCATCCTCATATGGTGGAAGG + Intergenic
1193508671 X:82372862-82372884 CTGCAATCACAGGTGGAGGGAGG + Intergenic
1193959208 X:87902625-87902647 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1194020449 X:88684043-88684065 CTGCAATCTCACATGGAAGAAGG + Intergenic
1195078545 X:101349739-101349761 GTGCATTCCCAGATGTAGAGAGG + Exonic
1196737160 X:118989994-118990016 CTGCATTCCTAGAATGGGGATGG - Intronic
1197351370 X:125387551-125387573 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1198180118 X:134199262-134199284 CTGTAGTCCCAGATGGTGGCGGG - Intergenic
1198528887 X:137529653-137529675 CTGCATACTCATATGAAGGAAGG - Intergenic
1199763815 X:150926035-150926057 CTGGCTTTGCAGATGGAGGAAGG + Intergenic
1199778215 X:151034214-151034236 CTGCATTCTCACATGGCAGAAGG - Intergenic
1199941554 X:152632699-152632721 CAGCCTTTCCAGATGGAGAAAGG + Intergenic
1200284826 X:154810615-154810637 CTGAATTCTCACATGGTGGAAGG + Intronic
1200291330 X:154877406-154877428 CTGGCTTCGAAGATGGAGGAAGG + Intronic
1200444904 Y:3248642-3248664 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1201290130 Y:12414667-12414689 CTGAATTCCAAAATGGAGGAGGG - Intergenic
1201597146 Y:15682957-15682979 CTGCATCCTCACATGGTGGAAGG - Intergenic