ID: 1100885661

View in Genome Browser
Species Human (GRCh38)
Location 12:99067068-99067090
Sequence GTGCCCTGGCCAGTCTCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 246}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100885661 Original CRISPR GTGCCCTGGCCAGTCTCCCA TGG Intronic
900592967 1:3468015-3468037 CTGCCCTGGCCGGGGTCCCAGGG - Intronic
901446236 1:9309887-9309909 GGGCCCTGACCAGTCTCCCTTGG + Intronic
901644059 1:10707152-10707174 GTGCCCTGGCCAGCCTCCTGTGG + Intronic
902736607 1:18405457-18405479 GAGGCCTGGCCAGTCTCAGAGGG - Intergenic
903348173 1:22701154-22701176 GAGCCCTGGCCAGGGTCTCATGG - Intergenic
904959773 1:34323235-34323257 GTCCCATGCCCAGACTCCCAAGG - Intergenic
905036013 1:34918746-34918768 GGGCCCTGGCCAGGGTCCTAGGG - Intronic
905930011 1:41780277-41780299 GGGCCTTGGCCACTCTGCCAAGG + Intronic
907813970 1:57900246-57900268 GTGGAATGGACAGTCTCCCATGG + Intronic
909049418 1:70750670-70750692 GTGACCTGACCATTCTCCCTAGG + Intergenic
911090695 1:94014793-94014815 GTGAACTGGCCAGAGTCCCAGGG + Intronic
912251274 1:108014931-108014953 GTGCCCTTTCCCTTCTCCCAGGG + Intergenic
913384744 1:118247339-118247361 CTACCCTGACCAGTCTACCAGGG + Intergenic
915334311 1:155131936-155131958 GTGCCCAGGTCATTTTCCCAAGG - Intronic
915740485 1:158115129-158115151 GATACCTGGCCTGTCTCCCAGGG + Intergenic
915784384 1:158593235-158593257 TTGCCCAGGCCAGTATCACAAGG - Intergenic
916931463 1:169582157-169582179 GTGACCTGGGCAGTTTCACAGGG + Intronic
917074764 1:171192920-171192942 GTTCTCTGCCCAGTGTCCCAGGG + Intronic
917188552 1:172388788-172388810 GGGCCCCGCCCAGTGTCCCAAGG + Exonic
919307176 1:195856480-195856502 GTGCCCAGGCCTGCCACCCAGGG + Intergenic
919658653 1:200221897-200221919 GTGCCATGGGCAGCCTCTCAGGG + Intergenic
920386953 1:205576142-205576164 GTTCCTGGGCCAGCCTCCCAGGG + Intronic
923155709 1:231277410-231277432 CTCCCCTGGACAGTCGCCCAAGG + Intronic
924452599 1:244191672-244191694 GTGACCTGGGCAGTCACACAGGG - Intergenic
924638520 1:245811143-245811165 GTGGCCTTTCCAGTTTCCCAGGG + Intronic
1063455962 10:6182869-6182891 GTGCCCTTCCCAGCCCCCCAGGG + Intronic
1064222191 10:13450898-13450920 GTTCCCTGGCCAGTCTGCTTGGG + Intronic
1064672467 10:17730919-17730941 GTGCCCCTGGCAGTCTCCCTTGG - Intergenic
1067779041 10:49185432-49185454 GTGACCAGGCCAGTCACCCAGGG - Intronic
1068836459 10:61559789-61559811 GTAAGCTGACCAGTCTCCCATGG + Intergenic
1069594394 10:69661210-69661232 GGGCCGTGTCCAGTCTGCCAGGG + Intergenic
1071496128 10:86168797-86168819 TTGCCCTGCCCTGTCCCCCAGGG - Intronic
1071561910 10:86651775-86651797 ATGCCCAGGACAGTCTCCAAGGG + Intergenic
1073425933 10:103455492-103455514 GGGCCGTGGCCAGTGTCCCGTGG + Exonic
1074668529 10:115759482-115759504 GTCCCCTGGTCACTCCCCCAGGG - Intronic
1075012498 10:118886773-118886795 GTGCCCTTGGCAGATTCCCAAGG - Intergenic
1075810079 10:125218840-125218862 AGGCCCTGGCCTGTCTCCCATGG + Intergenic
1076016098 10:127028589-127028611 GTGGCCTCGCCACTCCCCCAAGG - Intronic
1076407950 10:130225887-130225909 GAGCCCTGGGCAGTATTCCATGG + Intergenic
1076443380 10:130495658-130495680 GGTCCCTGCCCAGTCCCCCATGG + Intergenic
1076450209 10:130551901-130551923 GTGCCCTGGCCTGTCCCAGAAGG - Intergenic
1076639309 10:131902993-131903015 CTGCCCACGTCAGTCTCCCAAGG + Intronic
1077093295 11:789127-789149 GTGACCTGGCCAGGGTCCCAGGG + Intronic
1077242604 11:1518463-1518485 GTGCGCAGGCCAGTCTCGCGGGG - Intergenic
1077418228 11:2435946-2435968 GTGCTCTGGCCAATCCCCCATGG - Intergenic
1077581133 11:3418029-3418051 CTGCCCTGCACTGTCTCCCATGG + Intergenic
1078775426 11:14389387-14389409 GTCCCCAGGCCAGGCTCTCAGGG + Intergenic
1080417926 11:32086927-32086949 GTGACCTGGCAACTCTGCCAAGG + Intronic
1081807277 11:45897366-45897388 GTGCTCTGAGCTGTCTCCCAAGG + Intronic
1083946375 11:65925281-65925303 GTGCTCTGGACAATCTACCAGGG + Intergenic
1084681145 11:70667184-70667206 CTGCCCTGGCCATGCTGCCATGG + Intronic
1084730099 11:71067220-71067242 GTGCCCTTGCTGGTGTCCCACGG - Intronic
1085389426 11:76175012-76175034 GGGCTCTGGGGAGTCTCCCAGGG + Intergenic
1087711181 11:101554579-101554601 GTGCCCTGGCCAGTTTCAGGTGG + Intronic
1088024042 11:105156191-105156213 TTGCCCAGGCCAGTCTCCTCAGG + Intergenic
1089351784 11:117825416-117825438 GTGTCCTTGCCAGTTTACCATGG + Intronic
1089364889 11:117915525-117915547 GAACCCTGGGCAGTCTCCCCTGG + Intronic
1089647794 11:119891701-119891723 GTGCCCTGGCTGTACTCCCATGG + Intergenic
1090395213 11:126414257-126414279 CTGCCCTGGCCGGGCTCCCACGG - Exonic
1090407942 11:126488636-126488658 GTGACCTGGCCTGTGGCCCAGGG + Intronic
1090412757 11:126520363-126520385 GAGCCCTGGCCAGGAGCCCATGG + Intronic
1090439714 11:126715366-126715388 CTGCCCTGGCCAGCCTCTGAGGG + Intronic
1092011057 12:5112930-5112952 GTGCCCAGGCCAGTTCCCAATGG - Intergenic
1094034657 12:26055320-26055342 GTGCACCGGCCAGTCACTCAAGG - Exonic
1094826714 12:34275262-34275284 GTGCCTTGGGCAGGCTCACAAGG - Intergenic
1097056556 12:56253544-56253566 CTGCCCTGCCCAGTCTCCTAAGG - Intronic
1099329744 12:81268475-81268497 GTGACCTGGCCAGATACCCATGG - Intronic
1099970057 12:89491087-89491109 TTGACCTGGCCAGCCTCCCTGGG + Intronic
1100885661 12:99067068-99067090 GTGCCCTGGCCAGTCTCCCATGG + Intronic
1102416370 12:112766480-112766502 TTCCCCCTGCCAGTCTCCCATGG - Intronic
1102877017 12:116456828-116456850 GGTCACTGGCCAGTCTGCCAGGG + Intergenic
1102882708 12:116497932-116497954 TTGCCCGCCCCAGTCTCCCAAGG - Intergenic
1107950091 13:45453785-45453807 GTGCCCTGGCATGGCACCCAAGG + Intergenic
1117140996 14:52791310-52791332 GTGCCCCGGCCAGGCCCCCGGGG - Intronic
1119404905 14:74392234-74392256 GTGCCCAGGCCAGTGCACCACGG + Intergenic
1124604410 15:31160174-31160196 GTGGCCTGCCCAGTCTCCTTGGG + Intronic
1125182681 15:36895461-36895483 CTTCACTGGCCAGTTTCCCAGGG + Intronic
1125525282 15:40370325-40370347 GCGCCCTGTCCAGCCTCCCCGGG - Exonic
1126258407 15:46655717-46655739 ATGCCCTTGCCTGTCTCTCACGG + Intergenic
1127362078 15:58252897-58252919 TTGCCCAGGCCAGTCTCCAGAGG - Intronic
1129737779 15:77975542-77975564 CTGCCCTGGGCTCTCTCCCAGGG + Intergenic
1129848307 15:78778074-78778096 TTGCCCTGGGCTCTCTCCCAGGG - Intronic
1131154332 15:90065463-90065485 GTGCCCTCTCCAGGCTTCCAAGG - Intronic
1132554923 16:568163-568185 GTGCCCCGTCCAGCCCCCCAGGG - Exonic
1132585088 16:702682-702704 GTGCCATGGCCAGTGTCCGCGGG + Intronic
1132636884 16:954194-954216 GTGCACTGGCCGCTCTGCCATGG + Intronic
1132656885 16:1045133-1045155 GGGCTCTGGTCAGCCTCCCAAGG + Intergenic
1132827038 16:1910270-1910292 CAGCCCTGCCCAGCCTCCCAGGG + Intergenic
1132874572 16:2130623-2130645 GTGGCCTGGCCAGCCCCCCAAGG + Intronic
1134553516 16:15149456-15149478 GTGGCCTGGCCAGCCCCCCAAGG + Intergenic
1136146178 16:28317824-28317846 GTACCCTGGCCACTCTGCCCCGG - Intronic
1136637785 16:31536979-31537001 GTGGCCTTTCCAGGCTCCCAAGG + Intergenic
1138264836 16:55652862-55652884 GTGCTCTGTGCAGTCTCCCGAGG + Intergenic
1139950241 16:70664902-70664924 GGGCCCTGGCCAGCCTACCTTGG + Exonic
1141099448 16:81186307-81186329 CTGCCCTGGACCTTCTCCCAGGG - Intergenic
1141171159 16:81692608-81692630 CTGGCCTGGCCAGTCCCCGAGGG + Intronic
1141901479 16:86993944-86993966 GCGCCCTGGACAACCTCCCAAGG + Intergenic
1142222131 16:88860697-88860719 GTTCCCTGTGCAGCCTCCCAAGG - Intronic
1142283303 16:89160558-89160580 GTGCCCTCGCGGGTCACCCAGGG - Intergenic
1143978588 17:10848280-10848302 GTGTCTGGGCCAGTCTGCCATGG + Intergenic
1145037424 17:19551151-19551173 GAGTCCTGGCCATTCACCCAGGG + Intronic
1145246431 17:21272840-21272862 CCGCCTTGGCCAGTCTCCCTTGG - Intergenic
1148383066 17:47214098-47214120 GTGACTTGCCCAGTCTCACATGG + Intronic
1149318227 17:55458731-55458753 CTGCCCTGGCCAGACTGCCCTGG - Intergenic
1152553015 17:81039204-81039226 GTGCCCTGGCCACCCCACCAAGG - Intronic
1152854960 17:82659462-82659484 GTGCCCTGGCCTGTGATCCATGG + Intronic
1155166069 18:23233416-23233438 GTGACCTTGGCAATCTCCCAAGG + Intronic
1156522260 18:37731797-37731819 GTGCCCAGGCCCGACTCCCAGGG + Intergenic
1156522703 18:37735333-37735355 GTCCCCTGCCCAGTCCTCCAAGG + Intergenic
1157519749 18:48337254-48337276 TTGCCTTGGTCAGTTTCCCAAGG + Intronic
1157607556 18:48935462-48935484 GTGCCCGGGCCAGTCACCTACGG + Intronic
1158322886 18:56282661-56282683 GTGCCCTGCCCATATTCCCAGGG + Intergenic
1158512490 18:58103535-58103557 GTGCACTGACCAATCACCCATGG - Intronic
1158553396 18:58456266-58456288 GTACCGAGGGCAGTCTCCCAAGG - Intergenic
1158735638 18:60075693-60075715 GTGCCCAGGCCTGTCATCCAGGG + Intergenic
1160512564 18:79460814-79460836 GTTCCCAGCCCAGCCTCCCAGGG - Intronic
1161485166 19:4531600-4531622 GTGCCCTGGCCCGTGTCCCTGGG - Intronic
1161812730 19:6479808-6479830 GGGCGAGGGCCAGTCTCCCAGGG - Intronic
1162078529 19:8205199-8205221 GTCCCCTGCCCAGCTTCCCAGGG - Intronic
1162761020 19:12888083-12888105 GTCCCCTTCCCAGGCTCCCAGGG - Intergenic
1164742621 19:30587719-30587741 CTCCCATGGCCAGTCTTCCAGGG - Intronic
1164918958 19:32074266-32074288 GTGCCTGGGCCAGCCTCACATGG - Intergenic
1166760616 19:45222010-45222032 GGGCCCTGGTGATTCTCCCAGGG + Intronic
1167015407 19:46838132-46838154 GAGCCCTTGCCTGTCTCCCCTGG - Intronic
1167800751 19:51739784-51739806 GTGCCCTGGGGAGGCTCACAGGG + Intergenic
1168061172 19:53893102-53893124 GAGCCCAGCCCAGCCTCCCACGG + Intronic
1168138772 19:54370374-54370396 GAGCCCAGGCCAGGCTGCCAAGG - Intronic
1168159251 19:54498123-54498145 GAGCCCAGGCCAGGCTGCCAAGG + Intronic
1168482848 19:56736178-56736200 GTGACCTGCCCTGTCACCCAGGG + Intergenic
1168667656 19:58216890-58216912 GGGCCCTGGTCAGCCTCCCCAGG - Intergenic
927133485 2:20080113-20080135 ATGCCCTGGCCAGAAACCCAGGG - Intergenic
927137989 2:20111417-20111439 GTGCCGGGGCCTGGCTCCCAGGG + Intergenic
929086846 2:38176489-38176511 GAGGCCTGGTCAGTATCCCAGGG + Intergenic
929872977 2:45773883-45773905 GTGCCCTGGGCAGCTGCCCAAGG + Intronic
931461082 2:62450640-62450662 CTGTTCTGGACAGTCTCCCAGGG - Intergenic
931713225 2:65007412-65007434 GCATCCTGGCCAGTCTCCCTGGG - Intronic
932399230 2:71468238-71468260 GTGCCCTGCCCAGTGTCCTTAGG - Intronic
933029467 2:77309599-77309621 GTGCAGTGGCTAGTATCCCAGGG - Intronic
934648396 2:96072609-96072631 GTGGCCTGGCCAGGGTCCCTCGG + Intergenic
935726640 2:106029339-106029361 GGGCTCAGGCAAGTCTCCCAGGG - Intergenic
936815484 2:116455924-116455946 GTGCCCATGCCAAGCTCCCATGG + Intergenic
936906120 2:117537130-117537152 GTGCCCTGGCTACTCACCCCTGG + Intergenic
938093040 2:128445735-128445757 TTCCCCTGGCTGGTCTCCCAGGG - Intergenic
938164019 2:129010424-129010446 GTGCCCTGGCCAGGCTTCCACGG - Intergenic
939629829 2:144517484-144517506 GGGCCCTGGCCCGGCTCCCCTGG - Intronic
940856070 2:158729647-158729669 GTGTCCTGGCCGGTCTCCTGTGG + Intergenic
947834049 2:233162800-233162822 GAGCCCGGGCCAGTGCCCCAGGG + Intronic
948272786 2:236687093-236687115 GTGCCCTGGCCACACCTCCAGGG - Intergenic
948835507 2:240624291-240624313 GTTCCCTGCCCAGTCTCCATGGG - Intronic
948908027 2:240989107-240989129 GAGCCCGGGCCTGGCTCCCATGG - Intronic
1168838121 20:891316-891338 CTGGACTGGCCAGTCTCCAAGGG + Intronic
1170509445 20:17061361-17061383 GTGCCTTGGCCAAGATCCCAAGG + Intergenic
1171422427 20:25026119-25026141 GTCCCCTGGCCTGGCTTCCAGGG - Intronic
1172229835 20:33329173-33329195 GGGCCCAGGCCAGGCCCCCAAGG + Intergenic
1173314888 20:41934125-41934147 GGGCCCTGTGCAGTCTCACATGG - Intergenic
1174879362 20:54261466-54261488 AGGGCCTGGCCAGTCTCTCAAGG + Intergenic
1175231053 20:57473539-57473561 ATGCCCTGGCCAGAATCCCTGGG + Intergenic
1175682527 20:61000805-61000827 GTTCTCTGGCCAGTGTCACAGGG + Intergenic
1175797193 20:61779197-61779219 TTGCCCTGGACAGCCTCTCAAGG - Intronic
1175943329 20:62547800-62547822 GTGCTCTGCCCTGTCTCACACGG - Intergenic
1176086290 20:63296980-63297002 GGGGCCTGGCCAACCTCCCAGGG - Intronic
1176195736 20:63835763-63835785 GTGGCCTGGCCTCTGTCCCAGGG - Intergenic
1176687632 21:9865270-9865292 GTGCTCTGGAGAGTCTCCCAGGG + Intergenic
1179505684 21:41838696-41838718 GCCCCCTGGCCAGTTTCCCCAGG - Intronic
1179578287 21:42321357-42321379 CTGCCCTGGCCTGGCTCCCTGGG + Intergenic
1179831622 21:44000585-44000607 GGGCCTTGGCAAGCCTCCCACGG + Intergenic
1181092237 22:20481845-20481867 CTGCCCACCCCAGTCTCCCAAGG + Intronic
1181164534 22:20976328-20976350 GTGCCCTGCCTAGTGTCCGATGG - Intronic
1181582003 22:23833772-23833794 TTGCCTTTCCCAGTCTCCCATGG + Intronic
1181633411 22:24163294-24163316 GTGCCCTGGCTTTCCTCCCAGGG + Intronic
1181636201 22:24175997-24176019 CTCCCCTGCCCAGTGTCCCAGGG + Intronic
1181642955 22:24214406-24214428 GGGCCTGGGCAAGTCTCCCAGGG + Intergenic
1182014193 22:27025471-27025493 CTCCCCTGGCCGGTCACCCAGGG - Intergenic
1182112032 22:27730878-27730900 GTGGCCAGGCCAGTGTCACATGG - Intergenic
1182253072 22:29017317-29017339 GTACACTGTCCAGTCTGCCACGG + Intronic
1183582185 22:38732591-38732613 GTGCCCTGGGCAGGCTCCAAAGG + Exonic
1184444917 22:44541383-44541405 CTGCCCTGGGGAGTTTCCCATGG - Intergenic
1184654706 22:45935297-45935319 GTGCCTTGGCCTGGCCCCCAAGG + Intronic
1185050716 22:48552761-48552783 GGGGCCCGGCCAGGCTCCCAGGG + Intronic
1185315760 22:50178471-50178493 GCGCCCTGGCCAGGCTCCCGTGG - Intronic
949419990 3:3855537-3855559 TTGTCCTGGCCAGTTCCCCAGGG + Intronic
950499650 3:13355541-13355563 GGGGCCTGGCCAGGCTGCCATGG - Intronic
951345753 3:21545735-21545757 GGTCTCAGGCCAGTCTCCCATGG - Intronic
952234308 3:31463181-31463203 GTGCCCTGGCCAGAAGCCCTTGG - Intergenic
954805838 3:53219933-53219955 GAGCCCTGCCTAGTCTCACAGGG + Intergenic
956310713 3:67876358-67876380 TTGCCCTGGCCTGGGTCCCATGG - Intergenic
957054000 3:75430662-75430684 CTGCCCTGCACTGTCTCCCATGG + Intergenic
960935193 3:122895280-122895302 GTGCCTTGGTCTGTGTCCCAGGG + Intergenic
961253224 3:125523883-125523905 GGTGCCTGGCCAGCCTCCCAGGG + Intergenic
961473663 3:127134148-127134170 GTGGCCTGTCCAGCCTCACAGGG + Intergenic
961887670 3:130107039-130107061 CTGCCCTGCACTGTCTCCCATGG + Intronic
967838274 3:193982419-193982441 CGGCCCTGCCCAGTCTCTCAGGG + Intergenic
968150690 3:196335180-196335202 GTCCTCTGGCCACCCTCCCAGGG - Intronic
969320704 4:6410718-6410740 GTGACCTGGCCAGGCTCACTGGG - Intronic
969601632 4:8179806-8179828 GTGCCCTGGCCACTAGACCAGGG - Intergenic
969703296 4:8779377-8779399 GTGCCCTGTCCATTCTGCCCCGG - Intergenic
971209262 4:24600240-24600262 TTGTCCTGGGGAGTCTCCCAAGG + Intergenic
972668354 4:41189864-41189886 GGCCCCAGGCCTGTCTCCCAGGG - Intronic
978408591 4:108405426-108405448 GTGTCCTGGACAGGTTCCCAAGG + Intergenic
979756862 4:124351292-124351314 CTGCCTTCGTCAGTCTCCCAGGG + Intergenic
980350984 4:131683086-131683108 GTGCTCTGGAGAGTCTCCCAGGG + Intergenic
983580043 4:169300395-169300417 GTGCCCTGATCAATGTCCCAGGG - Intergenic
985188669 4:187346765-187346787 GTGACCTGGCCAGTGTAACAGGG - Intergenic
985198253 4:187456413-187456435 GTGCCCTGGCCACTCTCCTCAGG + Intergenic
985200387 4:187478638-187478660 TTGCCCTGCCCTGTTTCCCATGG - Intergenic
988048925 5:25998470-25998492 GTCCACTGGCCAGTCTCCTTTGG + Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
990624591 5:57597306-57597328 TTGCCCTTGCCAGTTTCTCAAGG + Intergenic
992564608 5:77985412-77985434 GAGCCCTGGCCAGTTCCCCTGGG + Intergenic
997714885 5:136035119-136035141 CTGCCCTGGACAGGCTCCCAGGG - Intronic
998622132 5:143806637-143806659 GTGCTCTGGCCTGCCTCCCTTGG + Intergenic
999323404 5:150628308-150628330 CTACCCTGTCCAGCCTCCCAGGG + Intronic
1000416052 5:160984853-160984875 ATGCACTGGGCAGTCTCCCTGGG + Intergenic
1001740728 5:174050909-174050931 GTGCCTTGGTCCTTCTCCCATGG + Intronic
1002936751 6:1680577-1680599 GTGTCCTGGCCGGGCGCCCAAGG - Intronic
1003174768 6:3746413-3746435 GTGCCCTGCCAGGGCTCCCATGG - Intronic
1006383505 6:33715359-33715381 GTGGCCTGCACAGTCGCCCAGGG - Intergenic
1007593089 6:43035229-43035251 GTCACCTTGCCAGTCTCCCATGG - Intergenic
1010713654 6:79204431-79204453 CAGCCCTGGCCAGCTTCCCAGGG + Intronic
1013554609 6:111243206-111243228 TGGCTCTGGCCAGTCTACCAAGG - Intergenic
1014262178 6:119231637-119231659 GTGCCTTGGCCAGGCCCTCAGGG - Intronic
1015681378 6:135812397-135812419 ATCCCCTGGGCATTCTCCCAAGG - Intergenic
1016337524 6:143023836-143023858 CTGCCCTGCCCATTCTCACAGGG - Intergenic
1016891820 6:149014830-149014852 TTTCCCTGGCCAGACTTCCAGGG - Intronic
1016911374 6:149202542-149202564 GTGCCTTTCCCAGTTTCCCAGGG + Intergenic
1017774851 6:157672829-157672851 GTGCCCAGGCCAGGCTTCCCGGG - Exonic
1018071566 6:160168490-160168512 GTCCCCTGGCTAGTCACCCAGGG + Intergenic
1019257280 7:60485-60507 GTGCCCTGTCAAGCCACCCAAGG + Intergenic
1019274410 7:168335-168357 AGGCCCTGGCCAGAGTCCCATGG + Intergenic
1022197503 7:28082992-28083014 GTGCTCTGGCCTGTCCCTCATGG + Intronic
1022452262 7:30525955-30525977 CTGCCCTTGCCAATCTCCCCAGG - Intronic
1022863955 7:34398034-34398056 CTGCCCTGGCCACTCTCTCTTGG - Intergenic
1024096062 7:45983721-45983743 GGGCCCTGGCCAGTTTTCTATGG + Intergenic
1025260438 7:57414486-57414508 GTGCCCTGTCCAGCCCACCAGGG + Intergenic
1026466357 7:70658274-70658296 GTGCCCTAGACAGTTCCCCAGGG - Intronic
1029226777 7:99034202-99034224 GGGCCCTGGCCACTCTGCCCGGG + Intronic
1031007951 7:116495982-116496004 ATGCACTGGACAGTCTCTCAAGG + Intronic
1033345696 7:140524063-140524085 CTGCCCTGGCCAGAATCCCCTGG - Intronic
1035234449 7:157487406-157487428 CTCCCCTGGCCCCTCTCCCAAGG - Intergenic
1036570244 8:9974071-9974093 GTGCCCAGGCCACTCTGCCCAGG - Intergenic
1036848673 8:12186673-12186695 GTGCCCTGCCCTGTGCCCCAAGG + Intronic
1036870034 8:12428954-12428976 GTGCCCTGCCCTGTGCCCCAAGG + Intronic
1036940543 8:13048063-13048085 GAAGCCTGGCCAGTCTCCCAGGG + Intergenic
1037632641 8:20672129-20672151 ATGCTCTGGTCAGTGTCCCATGG + Intergenic
1042189195 8:66168300-66168322 GAACCCAGGCCAGTCACCCATGG - Intronic
1042838239 8:73097183-73097205 ATGACCTGGGCAGTGTCCCACGG + Intronic
1045547775 8:103143231-103143253 GAATCCTGGCCAGTCTCCCAGGG - Intronic
1046025997 8:108724764-108724786 GTGCACTGGGCAGACTCCAATGG + Intronic
1049352167 8:142170226-142170248 GTGGCATGGCCAGTCTCACTAGG + Intergenic
1049373380 8:142278151-142278173 GTGCCCAGGCCCATCGCCCAAGG + Intronic
1049395310 8:142397477-142397499 GTGACATGGCCAGGGTCCCACGG + Intronic
1049478157 8:142806429-142806451 GTGCGCTGGGCAGTCCCCCCAGG - Intergenic
1051357754 9:16255117-16255139 ACTCCCTGACCAGTCTCCCAGGG + Intronic
1053416225 9:37948519-37948541 GTGTGCTGGCAAGTTTCCCAGGG + Intronic
1054169672 9:61826783-61826805 GTGCTCTGGAGAGTCTCCCAGGG - Intergenic
1054667866 9:67754032-67754054 GTGCTCTGGAGAGTCTCCCAGGG + Intergenic
1055176572 9:73325043-73325065 GTGGCCTGGGCAGTCACACAAGG - Intergenic
1055196509 9:73600812-73600834 TTTCCCTGCTCAGTCTCCCAAGG + Intergenic
1055715848 9:79117177-79117199 GTGACCTGGGCAGTCACACAGGG + Intergenic
1055886685 9:81071203-81071225 ATGCCCTGGCCACACTCCTAAGG + Intergenic
1056790145 9:89620008-89620030 GAGGCCAGGCCAGTCTGCCAGGG + Intergenic
1057149788 9:92786111-92786133 GTGCACAGGACAGTCTCCCCAGG - Intergenic
1061260087 9:129475423-129475445 GGGCCCTGGACCGGCTCCCAGGG + Intergenic
1061678325 9:132230607-132230629 GGGCCCTGGCCACCCTCCCCAGG - Intronic
1062431880 9:136529994-136530016 GGGCCCTGCCCTGGCTCCCAGGG + Intronic
1062468276 9:136691091-136691113 GTGCCCTGGCCAGCGCCCCTTGG - Intergenic
1062721440 9:138046357-138046379 GTGCCCTGTCCAGGCTCCCAGGG - Intronic
1188081127 X:25842010-25842032 TTGCCCAGACCAGTGTCCCAAGG + Intergenic
1190450136 X:50571217-50571239 GTGACCTGTGCAGTCTCACAGGG - Intergenic
1190912273 X:54784249-54784271 ATGCCCTGGCGATTTTCCCAAGG - Intronic
1192190798 X:68990112-68990134 GTGGCCTGGACGGTTTCCCAAGG - Intergenic
1199880958 X:151974199-151974221 CTGCCCTGGCCGGTCACCCCGGG + Intronic
1199978621 X:152908769-152908791 TGGCCCTGGCCACACTCCCAGGG - Intergenic
1200870627 Y:8094263-8094285 GTGCCTTGGCCTGCCTACCATGG - Intergenic