ID: 1100890123

View in Genome Browser
Species Human (GRCh38)
Location 12:99116119-99116141
Sequence TTTTATGTGCGTAAAGTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100890121_1100890123 20 Left 1100890121 12:99116076-99116098 CCAATAGTTTCTATTGTGTAGGA 0: 1
1: 0
2: 4
3: 9
4: 175
Right 1100890123 12:99116119-99116141 TTTTATGTGCGTAAAGTGCTAGG 0: 1
1: 0
2: 0
3: 10
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100890123 Original CRISPR TTTTATGTGCGTAAAGTGCT AGG Intronic
900930761 1:5735486-5735508 TTTCAGGTGTGCAAAGTGCTGGG - Intergenic
902704916 1:18198003-18198025 TTCAATGTGCTTAAAATGCTTGG + Intronic
904327194 1:29734490-29734512 TTTTAAGTGGGTACAATGCTGGG + Intergenic
905892347 1:41525347-41525369 TTTGATTTGGGTAAAGTGCCTGG - Intronic
906927298 1:50131924-50131946 TTTTCTGTGTGTAAAGAGCATGG - Intronic
908682165 1:66674312-66674334 TTTTATGTCAGTAAAGTACACGG - Intronic
909040129 1:70639515-70639537 TTTTATGTACTTTAAGTTCTAGG - Intergenic
909788318 1:79642646-79642668 TTTTATAAGAGTAAATTGCTGGG + Intergenic
910603096 1:89052370-89052392 TCTTATGTGTGAAAAGTCCTAGG - Exonic
916143482 1:161720257-161720279 TTTTTTGTGCTTTAAGTTCTAGG - Intergenic
917985433 1:180312794-180312816 GTTAATCTGTGTAAAGTGCTTGG - Intronic
921212102 1:212909671-212909693 GTGTATGTGGGTACAGTGCTGGG + Intergenic
922770257 1:228178052-228178074 TGTTATGTGGGTATAGTGCATGG + Exonic
1062994290 10:1851380-1851402 TTTTAATTTCCTAAAGTGCTAGG - Intergenic
1064157941 10:12919163-12919185 TATTATGTGTGTAAAGACCTAGG + Intronic
1064251323 10:13708457-13708479 TTTTGTCTGCGTTAAGTACTGGG + Intronic
1064828284 10:19430668-19430690 TTTTATGTGCCAATAGAGCTGGG - Intronic
1067554864 10:47261672-47261694 TATTATGTGAGCCAAGTGCTTGG - Intergenic
1070484434 10:76915848-76915870 TTTTATGTGCCTGTAGTGCCAGG + Intronic
1070863540 10:79692292-79692314 ATTCATATGTGTAAAGTGCTTGG - Intergenic
1071182762 10:83005993-83006015 TTTTATTTGGGTATAATGCTGGG + Intergenic
1072696641 10:97608939-97608961 TTTTGTTTGGGTAAAGTGATGGG + Intronic
1077879630 11:6338689-6338711 TTTTATCTGGTTAAAGTCCTGGG + Intergenic
1079351628 11:19696764-19696786 CTTTTTGTGCTTAAAGTCCTTGG - Intronic
1080732192 11:34968350-34968372 TTTTATGTTAGCAAAGTACTTGG - Intronic
1080832234 11:35906052-35906074 TTATTTGTTAGTAAAGTGCTAGG + Intergenic
1081871992 11:46387265-46387287 TTTTAAGTGTCAAAAGTGCTTGG - Intergenic
1084114514 11:67034075-67034097 CTTTAAGTGGGTAAATTGCTTGG - Intronic
1087705228 11:101482510-101482532 TTTGATGTATATAAAGTGCTTGG + Intronic
1090119466 11:124009744-124009766 GTTTATGTGCTTACTGTGCTGGG + Intergenic
1091534556 12:1393638-1393660 GTGTGTGTGTGTAAAGTGCTTGG + Intronic
1091872584 12:3906838-3906860 TTTGATGTGAGTGAAGTGCGGGG - Intergenic
1093731531 12:22571027-22571049 TTTTATGTCTGGAAAGGGCTGGG - Intergenic
1099147848 12:79069787-79069809 TTTAATGGGAGTAAAGTGTTTGG + Intronic
1100513698 12:95304446-95304468 TTTTCTGTCAGTAAAGTGCATGG + Intergenic
1100768183 12:97892248-97892270 ATTTATATGCTTAAAGTGTTGGG - Intergenic
1100890123 12:99116119-99116141 TTTTATGTGCGTAAAGTGCTAGG + Intronic
1101484031 12:105132820-105132842 GTGTGTGTGTGTAAAGTGCTTGG + Intronic
1101822765 12:108196577-108196599 TTCTATATATGTAAAGTGCTTGG - Intronic
1103861881 12:124021873-124021895 TTTTATGTGTGTAAAATACCAGG + Intronic
1104860689 12:131921832-131921854 CTCTATATGCATAAAGTGCTTGG - Exonic
1105620974 13:22065619-22065641 TTTCATGTGCTTTAAGTGCTGGG - Intergenic
1109378437 13:61526196-61526218 TTTTCTGTGGGTAAAGGGCTTGG - Intergenic
1109990443 13:70048027-70048049 TTTTCTGTGCGTAAGGGGGTGGG + Intronic
1112529009 13:100182421-100182443 TTTAATGTGCTTTAAGTACTAGG - Intronic
1113193753 13:107780784-107780806 TTTAATTTCTGTAAAGTGCTAGG + Intronic
1113388052 13:109869577-109869599 TTTTATGTGCAGCGAGTGCTTGG - Intergenic
1114358688 14:21944890-21944912 ATTTATGTGCGTCTAGTTCTGGG + Intergenic
1115662853 14:35513961-35513983 TTTGATGTTTGAAAAGTGCTTGG - Intergenic
1118390958 14:65294906-65294928 TCTTAAATGCCTAAAGTGCTAGG - Intergenic
1119977499 14:79041460-79041482 AATTTTGTTCGTAAAGTGCTGGG + Intronic
1120633978 14:86928492-86928514 GTTTCTGTGTCTAAAGTGCTTGG + Intergenic
1121684166 14:95819985-95820007 GTTTTTGTGTGTAAAGTGTTTGG - Intergenic
1134912166 16:18037469-18037491 TTTAGTGTTCATAAAGTGCTAGG - Intergenic
1139222050 16:65193577-65193599 TTTTATTTGCTTTAAGTTCTGGG + Intergenic
1141165095 16:81655041-81655063 TCTCATATGCATAAAGTGCTTGG + Intronic
1143426747 17:6845609-6845631 TTTTATGTACTTTAAGTTCTGGG + Intergenic
1146482899 17:33219302-33219324 AGTAATGTGTGTAAAGTGCTTGG - Intronic
1150457361 17:65317549-65317571 GTTAATCTGTGTAAAGTGCTTGG - Intergenic
1154193651 18:12250641-12250663 GTTTATGTTCATAAACTGCTTGG - Intergenic
1157025845 18:43841599-43841621 TTTTATGTACTTAAAGTTCTAGG - Intergenic
1158123158 18:54072734-54072756 TTTTATATACTTAAAGTTCTGGG + Intergenic
1159927804 18:74284284-74284306 TTTTATGTGCAAAAAGCACTTGG + Intronic
1163739845 19:19004697-19004719 TTTTATTTGCTGAAACTGCTGGG + Intronic
1167465544 19:49649282-49649304 TATTTTGTGCTTAAGGTGCTGGG + Intronic
931574030 2:63700644-63700666 TTTTATGTGAGTACCATGCTGGG - Intronic
931760103 2:65409030-65409052 ATTTATGTGCATAAAGGTCTGGG - Intronic
931917772 2:66977768-66977790 TTTTGGCTGCCTAAAGTGCTGGG + Intergenic
933084170 2:78033834-78033856 CTTTATATGTGTAAAGTCCTTGG - Intergenic
933193490 2:79363475-79363497 TTTAACGTATGTAAAGTGCTTGG + Intronic
933863499 2:86494671-86494693 TTTTATTTGTGTAAAGTGGGTGG + Intergenic
936819300 2:116499607-116499629 TGTTCTGTGTGGAAAGTGCTGGG - Intergenic
940620892 2:156112099-156112121 CTTTATGTGTGTAAATTGCATGG - Intergenic
940943165 2:159586332-159586354 TTTTTTGTAGGGAAAGTGCTAGG + Intronic
941050022 2:160722343-160722365 TTTTATTTGCTTTAAGTTCTGGG + Intergenic
941102316 2:161309824-161309846 TTTTTTCAGCCTAAAGTGCTTGG + Intronic
942204505 2:173606265-173606287 ATTAATATGTGTAAAGTGCTTGG + Intergenic
942610659 2:177739063-177739085 TCTTTTGTGCGTTAAGAGCTTGG - Intronic
944569556 2:201029910-201029932 TTTTATATGCTTTAAGTTCTAGG - Intronic
945030302 2:205656944-205656966 ATTAATGTTTGTAAAGTGCTTGG + Intergenic
945758976 2:213886954-213886976 TTTTATGTGCTTTCAGAGCTGGG + Intronic
946842603 2:223833553-223833575 TTTTCTGTGTGTAAAGTACTAGG + Intronic
948161603 2:235829318-235829340 CTTTATGTCCGTAATGTGATGGG + Intronic
1169600965 20:7260318-7260340 TTTTATATGAGTAAAGTTTTAGG + Intergenic
1169677982 20:8176455-8176477 TTTTGTGTCTGTAAAGTGTTAGG + Intronic
1169691593 20:8338806-8338828 TTTTATGTGCGTGCAGGGGTAGG - Intronic
1170453028 20:16505452-16505474 TTTTCTTTGCTTAAAGTGCAAGG - Intronic
1170540408 20:17381934-17381956 TTTTTTGTTGGTAAAGTGCCTGG - Intronic
1171014085 20:21523925-21523947 ATTCATGTGAGTAAAGTGCGAGG - Intergenic
1176695740 21:9975622-9975644 ATTTATCTTCGTAAAGTGTTTGG + Intergenic
1177255973 21:18663350-18663372 TTTTATGTTGGCAAAGAGCTGGG - Intergenic
1182253341 22:29019709-29019731 GTTCATGGGTGTAAAGTGCTTGG - Intronic
1184897583 22:47420453-47420475 TTTTACCTGCGTGAAGGGCTAGG - Intergenic
1185211687 22:49574115-49574137 TTTTATCTGCCCAAAATGCTTGG - Intronic
949725264 3:7036928-7036950 TCTTCTTTGCGTAAATTGCTGGG - Intronic
952211541 3:31233292-31233314 TTTTATGTGTGTTAAATGCATGG - Intergenic
953542930 3:43838645-43838667 TTTTCTGAGCATAAAGTTCTAGG - Intergenic
955555218 3:60129593-60129615 TATTATGTACGTAAAGTCCTAGG + Intronic
956232455 3:67031885-67031907 TGTTATATGGGTAAATTGCTTGG - Intergenic
956255175 3:67275749-67275771 TTTTATGTGCTTAAATTTTTTGG + Intergenic
958964118 3:100539280-100539302 TATTATGTGGGTAAATTTCTGGG - Intronic
959681177 3:109098346-109098368 TGTTATGTGTGTAAAGGGCATGG - Intronic
960373592 3:116871104-116871126 TTTTTTTTGCTTTAAGTGCTGGG + Intronic
961578600 3:127859067-127859089 ATGTATGTGCGTAAAGGCCTTGG + Intergenic
962730398 3:138277779-138277801 TTTTATGTGAGTAAACGGCTAGG - Intronic
964368253 3:155971824-155971846 GTTAATATGTGTAAAGTGCTTGG + Intergenic
964446820 3:156767931-156767953 TTTGATGTGTGTAAAAAGCTTGG - Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965570919 3:170172288-170172310 GTTTATGTGTATAAAGTTCTAGG - Intronic
965971885 3:174568956-174568978 TTTTATATGGGTAAAATGTTAGG - Intronic
970452725 4:16187832-16187854 TTTTATGGGCTTAAAATGCATGG - Intronic
971080399 4:23203521-23203543 GTTTATGTGCTTAAAGTATTTGG - Intergenic
978986336 4:115017384-115017406 TTTTATTTGGGTAATGTGTTTGG - Intronic
980368360 4:131835855-131835877 ATTTATCTTCGTAAAGTGTTTGG + Intergenic
982459923 4:155656331-155656353 TTTGAAATGCGTAAAGTGATAGG + Intergenic
982488173 4:155994234-155994256 TCTTATATGGGTAAAGTTCTAGG + Intergenic
986761861 5:10887430-10887452 ATGTATGTGTCTAAAGTGCTGGG - Intergenic
987741000 5:21908536-21908558 TTTTATGTCTGTAAAGGCCTTGG - Intronic
989333374 5:40286652-40286674 TTTTGTTGGCATAAAGTGCTAGG - Intergenic
989712913 5:44422620-44422642 GTTAATGTGGGTAAAGTGCTTGG - Intergenic
995677766 5:114682339-114682361 TTTTATGTACTTTAAGTTCTGGG - Intergenic
996067193 5:119092072-119092094 TTTTCTGTGCCCTAAGTGCTGGG + Intronic
997756666 5:136406115-136406137 ATATATGTGTGTAAATTGCTTGG + Intergenic
1001278588 5:170369299-170369321 ATGTATGTGTGTAAAGGGCTTGG + Intronic
1005278307 6:24243491-24243513 TTTAATGTGTTTAAAATGCTCGG + Intronic
1007065703 6:38988323-38988345 TTGTATGTGTATAAAGTGCTGGG + Intronic
1008818723 6:55604909-55604931 TTTTAAATGAGTAAAGTGCATGG + Intergenic
1009346853 6:62624041-62624063 TTTTATGTTTGTAAAGGGCTGGG + Intergenic
1009866351 6:69402361-69402383 TTTTATTTTTATAAAGTGCTGGG - Intergenic
1009928974 6:70153968-70153990 TTTTATGTACTTTAAGTTCTGGG + Intronic
1012312382 6:97741743-97741765 TTTCATGCGTGTAAAGTGGTAGG + Intergenic
1018311949 6:162518995-162519017 TTATATTTTCCTAAAGTGCTAGG - Intronic
1018990113 6:168668233-168668255 GTTAATGTATGTAAAGTGCTTGG + Intronic
1019206349 6:170365145-170365167 TTCCATGTGGGTAAAGTGCCAGG - Intronic
1019990242 7:4685042-4685064 TTAGATGTGCGTGAAGTGCTTGG + Intronic
1022895706 7:34748708-34748730 GTTTGTGTGCGTGAGGTGCTGGG + Intronic
1025631163 7:63274407-63274429 TTTTAAGTGCCTAAAGTTTTGGG + Intergenic
1026552089 7:71377410-71377432 TTTGTTGAGCCTAAAGTGCTTGG + Intronic
1027235761 7:76296904-76296926 GTGAATGTGTGTAAAGTGCTCGG - Intergenic
1028109691 7:86924983-86925005 TTTTAAGTGCCTAGAGGGCTTGG - Intronic
1028517571 7:91695575-91695597 GATTATGTACATAAAGTGCTTGG - Intronic
1031337276 7:120551209-120551231 TTTTATATGCTTAAAATGGTGGG - Intronic
1036965662 8:13294917-13294939 GTTTATGTCTATAAAGTGCTTGG + Intronic
1041305713 8:56456497-56456519 ATTTATGTGGGTAAATTTCTGGG - Intergenic
1043193448 8:77257076-77257098 TTGTATGTGTGTAACATGCTTGG + Intergenic
1043398442 8:79860403-79860425 TTTTATATGCTTTAAGTTCTAGG + Intergenic
1046568564 8:115933047-115933069 TTTCATGTGCAGAAAGTGGTAGG + Intergenic
1046953992 8:120044740-120044762 TATTAAGTGTGTAAAGTACTTGG + Intronic
1047353819 8:124101091-124101113 TTTTAGGTGGTTAAAGGGCTTGG + Exonic
1049125355 8:140782138-140782160 TTTTATGTGCACAAAGTAGTAGG - Intronic
1053604851 9:39647195-39647217 GTTAATATGCTTAAAGTGCTTGG + Intergenic
1053773035 9:41501954-41501976 ATTTATCTTCGTAAAGTGTTTGG - Intergenic
1053862726 9:42403545-42403567 GTTAATATGCTTAAAGTGCTTGG + Intergenic
1054248690 9:62695220-62695242 GTTAATATGCTTAAAGTGCTTGG - Intergenic
1054562803 9:66729746-66729768 GTTAATATGCTTAAAGTGCTTGG - Intergenic
1055375589 9:75646071-75646093 TTGTATCTGAGTAAAGTCCTGGG - Intergenic
1057646910 9:96884799-96884821 TTTTAAGTGGGTATAGTGCCAGG - Intergenic
1059034112 9:110734829-110734851 ATGTATGTAGGTAAAGTGCTTGG - Intronic
1059874853 9:118623104-118623126 TGTTATGTGTGCAAAGTGCAGGG - Intergenic
1060595872 9:124848566-124848588 ATTAATGTATGTAAAGTGCTTGG - Intergenic
1194272729 X:91838379-91838401 TATGATGTGCCTAAAGTACTGGG + Intronic
1194683565 X:96883795-96883817 TTTTAGGAGCACAAAGTGCTTGG - Intronic