ID: 1100909295

View in Genome Browser
Species Human (GRCh38)
Location 12:99339328-99339350
Sequence AGGAAGAATGCAGTGATTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 10, 3: 66, 4: 358}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1100909295_1100909301 25 Left 1100909295 12:99339328-99339350 CCAGCAATCACTGCATTCTTCCT 0: 1
1: 0
2: 10
3: 66
4: 358
Right 1100909301 12:99339376-99339398 CATGCCACACTGCATTGTCAGGG 0: 1
1: 0
2: 3
3: 13
4: 151
1100909295_1100909303 30 Left 1100909295 12:99339328-99339350 CCAGCAATCACTGCATTCTTCCT 0: 1
1: 0
2: 10
3: 66
4: 358
Right 1100909303 12:99339381-99339403 CACACTGCATTGTCAGGGAATGG 0: 1
1: 1
2: 1
3: 28
4: 195
1100909295_1100909300 24 Left 1100909295 12:99339328-99339350 CCAGCAATCACTGCATTCTTCCT 0: 1
1: 0
2: 10
3: 66
4: 358
Right 1100909300 12:99339375-99339397 CCATGCCACACTGCATTGTCAGG 0: 1
1: 1
2: 2
3: 11
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1100909295 Original CRISPR AGGAAGAATGCAGTGATTGC TGG (reversed) Intronic
903323111 1:22554236-22554258 AGGACGAAGGGAGCGATTGCAGG - Intergenic
905598517 1:39230094-39230116 AATAAGAATGGAGTGATTGAAGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
906870105 1:49469798-49469820 AGTAAGAAAGCAGTGAATGGAGG - Intronic
908523769 1:64968356-64968378 AGTAACAATTCAGTGATTCCCGG + Intergenic
908582435 1:65530138-65530160 AGGAAGACTGCAGATAGTGCAGG - Intronic
909347622 1:74610632-74610654 AGGAAGAATGTAGTGGTTCAAGG - Intronic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
910419708 1:87045663-87045685 ACTACTAATGCAGTGATTGCTGG - Intronic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
911011608 1:93287184-93287206 AAGGAGAATGCAGTGATTCTGGG + Intergenic
911923232 1:103793984-103794006 AGGAGGACTGAAGTGAATGCAGG + Intergenic
911932137 1:103918179-103918201 AGGAAAAATGCACTCATGGCAGG + Intergenic
912018548 1:105072980-105073002 AGGAAGAGTGCAGTGACTGAGGG - Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
913333272 1:117684848-117684870 AGAAGCACTGCAGTGATTGCTGG + Intergenic
914221828 1:145688510-145688532 GGGAAGAATGCAGTGATAAGGGG + Intronic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916302894 1:163295129-163295151 AGGTAAAATGCAGAGATTGGAGG - Intronic
916677490 1:167076055-167076077 AGGAAGCAGACAGTGTTTGCTGG + Intronic
917811849 1:178666613-178666635 ATGAGGAATGCAGTGATTTATGG - Intergenic
919067665 1:192713886-192713908 AGGGAGAATGCATTGAGTGTGGG + Intergenic
919955885 1:202415252-202415274 AGGAAGAATATAGTGCCTGCTGG + Intronic
920118838 1:203640268-203640290 AGGGAGGATGCAGTGAGAGCAGG - Intronic
921002146 1:211055257-211055279 AGGAAAAACACAGTGATTGTGGG + Intronic
921713386 1:218395074-218395096 AGGAAAAGTGCAGTCATTTCTGG + Intronic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
923378599 1:233391757-233391779 AGGAAGATTGCAAGGATTTCAGG + Intergenic
923971966 1:239213638-239213660 AGGAAGAAAGAAGTAATTGGTGG + Intergenic
924250901 1:242132173-242132195 AAAGAGAATGCAGTGATTGCGGG + Intronic
924490926 1:244536562-244536584 AGACAGAGTGCAGTGATTGTGGG - Intronic
1063529977 10:6821494-6821516 ACGATGAATGCAGTGTGTGCAGG - Intergenic
1065224174 10:23525895-23525917 AGGAAGATTGCAATGATTTTTGG + Intergenic
1065928513 10:30457937-30457959 AGGAACCATGCAGCAATTGCTGG - Intronic
1066616275 10:37298113-37298135 TGGAAGTTTGGAGTGATTGCAGG + Intronic
1067070030 10:43124492-43124514 AAGAAGAATGAATTGATTGAGGG - Intronic
1067327009 10:45279130-45279152 AGGAAGAAGGGAGTGGTTGTTGG - Intergenic
1069076441 10:64042319-64042341 AGGGAGAGTGGAGTGAGTGCAGG - Intergenic
1070970815 10:80565749-80565771 AGGAATGAAGCAGTGATTCCTGG - Intronic
1071586948 10:86832571-86832593 AGGTAGAAGGCAGTGATTGTGGG - Intronic
1073125725 10:101147566-101147588 AAGAAAAATGCACTGATTCCAGG + Intergenic
1073134592 10:101213433-101213455 AGTAACAATGCAGAAATTGCCGG - Intergenic
1074147995 10:110733496-110733518 AGGAGGCATGCAGTGATTTGTGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075605155 10:123799752-123799774 AGGAAGAATCCAGTGATGGCTGG + Intronic
1076467935 10:130697819-130697841 AGGAAGAAGGCAGGGACTTCTGG - Intergenic
1076777557 10:132706557-132706579 GGGAAGAATGCAGTGTGTACGGG + Intronic
1078690783 11:13578735-13578757 AGGGAGAGTGCAGGGATTGCGGG + Intergenic
1079042667 11:17073179-17073201 AGGAAGAAAACAGTTGTTGCAGG + Intergenic
1079282302 11:19098413-19098435 AGGAAGGAAGGAGTGTTTGCAGG - Intergenic
1080966640 11:37220567-37220589 AGAGAGAATGCAGTGATCGTGGG - Intergenic
1081759776 11:45569049-45569071 AGGAAGAGTGAGGTGATGGCAGG + Intergenic
1082835153 11:57646077-57646099 AAGGAGAAAGCAGTGATTGTAGG + Intronic
1083690109 11:64402706-64402728 AGGATGAACCCAGTGACTGCTGG + Intergenic
1084178836 11:67436765-67436787 AGGAAAAAGGCACTGAGTGCTGG - Intronic
1084721884 11:70911615-70911637 TGGAAAAAGGCAGTGATTCCAGG + Intronic
1084763960 11:71295401-71295423 AGGTATAATGCAGTGATTGTGGG - Intergenic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1085980404 11:81717867-81717889 AGGAAAACTGCAGTGATTGTGGG + Intergenic
1088188775 11:107204324-107204346 AGAAAGAATTCATTGAATGCTGG + Intergenic
1089843138 11:121436183-121436205 AGGAACAATGAAGTGATTAAGGG + Intergenic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1090496386 11:127216897-127216919 AGGAAGGAGGCAGCGATAGCAGG - Intergenic
1090923093 11:131224482-131224504 AGGGATAATACAGGGATTGCAGG + Intergenic
1092497512 12:9011815-9011837 AGGAAGAGTGCTGTGATTATGGG + Intergenic
1092517471 12:9230328-9230350 AGGAAAAATGCAGGGTTTGATGG + Intergenic
1095592017 12:43914286-43914308 AGGAAGAAAGCAGTAATAGAGGG - Intronic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096308824 12:50503002-50503024 TGGAAGAATGCAGTAAAGGCTGG + Intergenic
1096487927 12:51996195-51996217 AGAATGAATGCAGTGATTTGAGG - Intronic
1096944807 12:55392506-55392528 ACCAAGAATGCAGGGTTTGCTGG + Intergenic
1096954825 12:55515817-55515839 AGGAAGCATCCAGTCATGGCAGG + Intergenic
1098669193 12:73203268-73203290 AGGAATAATACAGTGGTTACGGG - Intergenic
1099237729 12:80102108-80102130 ATGCAGAATGCAGTGGTTGAGGG + Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1100598740 12:96093954-96093976 AGGACTAATGCCATGATTGCTGG + Intergenic
1100904808 12:99285756-99285778 AGGAAGAGAGCAGTAATTGTGGG + Intronic
1100909295 12:99339328-99339350 AGGAAGAATGCAGTGATTGCTGG - Intronic
1101093658 12:101313834-101313856 AGGAGGAATGCAGGAGTTGCAGG + Intronic
1103552828 12:121748670-121748692 AGCAGGCATGCAGTGAGTGCTGG - Intronic
1104268728 12:127262825-127262847 AGGCAGAATGGAGAGATTGGAGG - Intergenic
1104704338 12:130932056-130932078 AGTAAAAATGCAGTGACTGCAGG - Intergenic
1106865455 13:33959493-33959515 AGGAAGAATGCAATTTATGCTGG - Intronic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108741253 13:53340930-53340952 AGGGAGAATACAGTTATTTCAGG + Intergenic
1109225449 13:59689049-59689071 AGAAAGAAAGCAATGATTGAGGG + Intronic
1109556582 13:63983767-63983789 AGAAAGAATGTTGTGTTTGCAGG + Intergenic
1109649915 13:65311151-65311173 AGGAAGAATCCAGTGAGTGATGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1111800077 13:92970341-92970363 AGGAAGAATTAAGTGAGTGTGGG + Intergenic
1112991348 13:105517471-105517493 AGGAAGAAAGGAGTCATTGATGG - Intergenic
1113834287 13:113318744-113318766 AGGGAGAAGGCAGTGAGTGTGGG - Intronic
1116114876 14:40635389-40635411 AGAGAGAATGTAGTGATTGTGGG + Intergenic
1116163284 14:41298470-41298492 AGGAAGAATCCCATAATTGCAGG - Intergenic
1116215663 14:42014063-42014085 AGGAAGAATGCAGAGAGGGAGGG - Intergenic
1116217412 14:42035981-42036003 ATGAAGAATGCAGTGCCTACTGG + Intergenic
1117212364 14:53513716-53513738 AGGAAGGATGAAGTCATTGAGGG + Intergenic
1117795546 14:59389370-59389392 AGAAAGAGTGCAGTGGTTGTGGG - Intergenic
1118149877 14:63178361-63178383 AGGCAGAATCCAGTGTCTGCAGG + Intergenic
1118640650 14:67789238-67789260 AGGAAGAAAGCAGTTATTGGAGG - Intronic
1119162881 14:72467820-72467842 AGGAGGGGTGCTGTGATTGCTGG - Intronic
1120665924 14:87306788-87306810 AGGAAGTATTCTCTGATTGCTGG - Intergenic
1120929325 14:89832529-89832551 AGTAAGAATTCAGTGCTTGCAGG - Intronic
1122145456 14:99685963-99685985 AGGAAAATTACAGTGATTTCAGG - Intronic
1122258639 14:100499471-100499493 AGGAAGCAGGCAGTGGTTTCCGG - Intronic
1122319851 14:100847927-100847949 AGGAAGGATGCTATGAATGCAGG + Intergenic
1123042177 14:105494793-105494815 AGGAAGAAGCCAGTGATGACGGG - Intronic
1124938180 15:34192801-34192823 TGGAAGCATTCAGTGATTGCTGG - Intronic
1125478886 15:40066625-40066647 AGTAAGAATGAAGAGGTTGCAGG + Intergenic
1126979948 15:54229156-54229178 AGAGAGAATGCAGTAATTGCAGG - Intronic
1128043966 15:64600644-64600666 AGAAAGAAAGCAGGGATGGCGGG + Intronic
1131054322 15:89366720-89366742 AGGAAGAAGGGGGTGATGGCTGG + Intergenic
1131313532 15:91312185-91312207 AGGAAGAAAGCAGTGGGAGCTGG - Intergenic
1133834304 16:9352328-9352350 AGACAGAGTGCAGTGATTGTGGG - Intergenic
1135864434 16:26087910-26087932 GGGAAGAATGCATTGAGTGGAGG - Intronic
1137950276 16:52776920-52776942 AGGAAGAAGTCAGTGACTCCAGG + Intergenic
1138451573 16:57096341-57096363 TGTAAGAGTGCAGTGAATGCTGG - Intronic
1138455960 16:57120912-57120934 AGGAAGACTTCTGTGATTGCTGG - Intronic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1142919139 17:3169345-3169367 AGAGAGAATGCAGTGAGTGTGGG + Intergenic
1145765941 17:27458097-27458119 TGGAAGAATACAGTCAGTGCTGG + Intronic
1146388472 17:32399049-32399071 ATGAAGAATACAGTGACTACTGG + Intergenic
1149183098 17:53963917-53963939 AGGAGGAATTCAGTGAGTGAAGG - Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150962406 17:69928762-69928784 AGGAAGTATGTACTGTTTGCAGG - Intergenic
1151441315 17:74131047-74131069 AGGGAGAAGGCATTGATGGCAGG - Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153359949 18:4182910-4182932 AGGAAGAAAACAATGTTTGCAGG + Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1154341969 18:13511021-13511043 AGGAAAACGGCAGTGATTTCTGG + Intronic
1155193126 18:23449024-23449046 AGGAAGAATGCAGGGAGTTAGGG - Intergenic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1157407221 18:47432178-47432200 AGCAGGAATGCAGTCATTTCTGG + Intergenic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1158025016 18:52885878-52885900 AGGAAGAATCCAGTCATAGCAGG - Intronic
1158323860 18:56293385-56293407 AGGAAGATTGCATTGTTTGATGG + Intergenic
1158348919 18:56544371-56544393 AGGAAGTTTGTAGTGATAGCAGG - Intergenic
1158530263 18:58254770-58254792 ATGAAAAATGCTGTGATAGCAGG + Intronic
1159163006 18:64668584-64668606 AGCAAGACTGTAGTGATTACTGG + Intergenic
1159303815 18:66613836-66613858 AGGAAAAGTACAGTGATTGAAGG - Intergenic
1160356189 18:78229825-78229847 AGGAAGAAGGGAGTGAAGGCAGG - Intergenic
1161200303 19:3010925-3010947 AGGCAGAATGCTGGGATTCCAGG - Intronic
1161812923 19:6481127-6481149 AGGAGGAAAGCAGAGATTGCAGG - Intronic
1166661106 19:44647768-44647790 AGGAAGAAAGCAGAGATCTCAGG + Intronic
1167020076 19:46867332-46867354 AGTAAGAATGCAGAGATATCAGG - Intergenic
1167315253 19:48759026-48759048 AGGCAGAATGGCGTGAATGCGGG + Intergenic
1167742343 19:51331277-51331299 GGGAAGAAGGCAGTGATAGAGGG + Intergenic
1168448961 19:56448178-56448200 AGGAAGAATGGAGTGATGGTGGG + Intronic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
927243736 2:20940464-20940486 AGGGAAAATGCAGGGATTACGGG + Intergenic
927430417 2:23022352-23022374 AGGAATCATGCTGTGATTCCAGG - Intergenic
928255874 2:29722048-29722070 AAGAAGCAGGGAGTGATTGCAGG - Intronic
928715648 2:34056696-34056718 AGGAAGAGTGCCATGATTGTGGG - Intergenic
929641757 2:43587556-43587578 AGGGATGAGGCAGTGATTGCTGG - Intronic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
931832622 2:66068286-66068308 AAGATGAATGCAGTGATTAATGG - Intergenic
932111675 2:69007589-69007611 AGGAAGCATGCAGTCAATGCTGG - Intergenic
932998627 2:76891080-76891102 AGGAAGAATGAAGTGAAAGGAGG + Intronic
933056029 2:77666525-77666547 AGGATGAATCCAGTGATTTAGGG - Intergenic
933654661 2:84877811-84877833 TGGAAAAGTGCAGTTATTGCAGG - Intronic
934014677 2:87866911-87866933 AGGAAGGATACAGTGATTTAAGG + Intergenic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935152705 2:100451970-100451992 AGGAAGAAAGAAGTCACTGCAGG + Intergenic
935263310 2:101373729-101373751 AGGGAGAAAGAAGTGACTGCAGG + Intronic
936511403 2:113150406-113150428 AGGGATAGTGCAGTGATTGCCGG - Intergenic
936703805 2:115045580-115045602 AGGGTGAGTGCAGTGATTGCGGG - Intronic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
937053609 2:118912579-118912601 AGAAAGAAAGCATTTATTGCAGG + Intergenic
937816512 2:126256609-126256631 AGGAAGAATTTAATGAATGCAGG - Intergenic
938208354 2:129442756-129442778 AGAAAGAGTGTAGTGATCGCAGG - Intergenic
938251033 2:129815941-129815963 AGAAAGAGTGTAATGATTGCAGG + Intergenic
939708027 2:145479185-145479207 AGGAAGACTGCAGTGACTAAGGG - Intergenic
939867664 2:147492093-147492115 AGGAAGAATGCAGTGCAAGAGGG + Intergenic
940967342 2:159854411-159854433 TGCAAGAAAGCTGTGATTGCTGG + Exonic
941024562 2:160444029-160444051 AGGAAGAGTCCAAAGATTGCTGG + Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941099845 2:161283500-161283522 AGGAAAAATGCACTGATTTTAGG - Intergenic
941228937 2:162884631-162884653 AGGAAGATTGCAGTGATCTGAGG + Intergenic
942499829 2:176577904-176577926 AGGAAGATGACAGTGATTCCTGG + Intergenic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944266855 2:197737071-197737093 AGGAAAAATGAAATGGTTGCTGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
944855209 2:203760514-203760536 AGAAAGAGTGCAGTGATTGCAGG - Intergenic
945334323 2:208573491-208573513 AGGTAGAGTGAAGTGATTGTGGG + Intronic
946185388 2:217978124-217978146 AAGAAGACTGGAGGGATTGCTGG - Intronic
946509199 2:220335745-220335767 AGGAAGAATGTGGTAATTGTGGG - Intergenic
946833696 2:223750467-223750489 AGGAAGAATACATTTTTTGCTGG - Intergenic
947168918 2:227291139-227291161 CAGAAGAAGGCAGTGATTACAGG + Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948825221 2:240570691-240570713 AGGAAGAACGCTGTTCTTGCTGG - Intronic
1169275282 20:4229653-4229675 GGACAGAATGCAGTGATTGAGGG + Intronic
1169638061 20:7717256-7717278 AGGAATAATTCAGTGATTTATGG + Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170485032 20:16807275-16807297 AGAAAGAGTTCAGTGATTGCAGG - Intergenic
1175549412 20:59807351-59807373 AGGAAGATGACAGTGATTGATGG - Intronic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176940060 21:14912637-14912659 AGGGAGAATGCATTGATTGTGGG - Intergenic
1177295141 21:19163560-19163582 AGAAAGAGTGCAGTGATTGTGGG - Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1178477728 21:32952062-32952084 AGGGAGAAAGCAGTGAGAGCCGG + Intergenic
1181002026 22:19992319-19992341 TGGAAGAATGCAGGGAGAGCTGG + Intronic
1181308408 22:21930066-21930088 AGGAAAAAAACAGTGTTTGCAGG + Intronic
1183346869 22:37312900-37312922 AGGAAGGCTGAAGTGGTTGCTGG + Intronic
1183746422 22:39694436-39694458 AGGAAGAAGTCAGTGCCTGCAGG - Intergenic
1185058760 22:48594613-48594635 AGGCAGGATGCAGAGATGGCTGG - Intronic
1185076650 22:48686816-48686838 AGGAAGGATGGACTGATTGATGG + Intronic
951167906 3:19504706-19504728 AGGAAGAATGCACTGTTGGTGGG + Intronic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
952052862 3:29407161-29407183 AGCAAGTGTGCAGTGATTGTTGG - Intronic
952688486 3:36176245-36176267 AGGAAAAGTGCAGTGATTGTGGG - Intergenic
953461925 3:43088455-43088477 AGGAAGAGGGCAGTGGCTGCTGG - Intronic
953582282 3:44167797-44167819 AGAAAGCATGCAGTGAGTGCTGG + Intergenic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
955888594 3:63626519-63626541 TGGAAGAAAGAAGTGATGGCAGG - Intergenic
956068126 3:65418616-65418638 AGGAAGAAAGTAATGATTGGAGG - Intronic
956424221 3:69116542-69116564 ATGAAAAATGCAGTGCTTGGTGG + Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958147005 3:89639277-89639299 AGAAAGAATACAGTGACTGTGGG + Intergenic
958483121 3:94669685-94669707 AGGAAGACTCCAGTCATGGCAGG - Intergenic
958682691 3:97352489-97352511 AGAGAGAATGCAGTGACTGTGGG + Intronic
958693897 3:97503555-97503577 AGTCAGAATGCTGTTATTGCTGG + Intronic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
961932003 3:130544548-130544570 AAGAGGGATGCAGGGATTGCAGG + Intergenic
961975298 3:131018078-131018100 AGCAAGAATGTAGTGGTTGTAGG + Intronic
962252890 3:133848682-133848704 TGGATTAATGCAGTTATTGCAGG - Intronic
962483214 3:135815812-135815834 AGGGAGAATGCAGTGATCATGGG + Intergenic
962817572 3:139016159-139016181 AAGAAAAATGCAGTGGTCGCCGG - Intronic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
964400107 3:156289910-156289932 AGGAAGAAGGCAGTGATCCCAGG - Intronic
964686664 3:159403487-159403509 AGAGAGAGTGCAGTGATTGAGGG + Intronic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
966141830 3:176766299-176766321 AAGAAGAGTGCAGGGATTGTGGG + Intergenic
966345614 3:178976344-178976366 AGCAAAAATGCATTCATTGCTGG + Intergenic
968224596 3:196965877-196965899 AGGAAGGATGCAGTGAGAGAGGG - Intronic
968883430 4:3313736-3313758 AGGAAGGATGCGGAGACTGCAGG - Intronic
969090214 4:4688496-4688518 AGAAAGAATGCAGTGTTCGGAGG - Intergenic
969256528 4:6005911-6005933 AGGATGAATGGAGAGATTGGGGG + Intergenic
971056765 4:22922224-22922246 AGGAAGAACGGAGGGAATGCTGG - Intergenic
971297385 4:25408985-25409007 AAAAAGAATACAGTGACTGCTGG + Intronic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
974163874 4:58174949-58174971 AGGAAATATGCAGAGATTTCTGG + Intergenic
974292181 4:59947478-59947500 AGAAAGAGTGTAGTAATTGCGGG + Intergenic
975730022 4:77328727-77328749 AGGAAGATTGGAGTGCTAGCAGG - Intronic
976776179 4:88708707-88708729 AGGAAGAATGAAGTTTTTGAAGG + Intergenic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
978387864 4:108193797-108193819 AGTAAGAATGAAGTGACTGTGGG + Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981286401 4:143024183-143024205 AGGAAGAGTGTAGTGATTGTGGG + Intergenic
983295982 4:165869785-165869807 AGGAAGAATGCAATCATTTCTGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
984496283 4:180501678-180501700 AGGAAGAATGCAGTGATAGTTGG - Intergenic
985023624 4:185717294-185717316 AAGAAAAGGGCAGTGATTGCTGG + Intronic
985030282 4:185782027-185782049 AGGCAGAATGCAGTACCTGCGGG - Intronic
985420122 4:189776898-189776920 AGGAAGATGGCTGTGACTGCAGG - Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986292756 5:6413069-6413091 AGAAGGAATGCAGTCAGTGCCGG + Intergenic
986548242 5:8923625-8923647 AGGAAGAGTGCAGGGACTGTGGG + Intergenic
986631304 5:9776246-9776268 AGGGAGAGTGCAGTGACTACAGG - Intergenic
987023576 5:13900084-13900106 AGGATGAATGGAGTGACTGAGGG - Intronic
987037291 5:14031381-14031403 AGGAAGAAGGCATTGATTTCAGG - Intergenic
987537289 5:19205968-19205990 AGGAAGAACACAGCGATTGCAGG + Intergenic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
988384075 5:30539155-30539177 GAGAAGAGTACAGTGATTGCAGG + Intergenic
988907375 5:35803170-35803192 AGGAGGAAAGCAGACATTGCAGG + Intronic
988983625 5:36596130-36596152 AGGCAGAATTCATTGGTTGCTGG - Intergenic
990814015 5:59763022-59763044 AGGAAGAACACACTGATTTCAGG + Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991487202 5:67149734-67149756 AGGAAGAATTCAGAGTCTGCAGG - Intronic
991632002 5:68665607-68665629 AGGAAGAAAAGAGTGAGTGCAGG + Intergenic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993215619 5:85019464-85019486 AGGAAGATTGTGGTGATTGCTGG - Intergenic
994217974 5:97159917-97159939 ATGAAGAGTGCAGTGACTGTGGG - Intronic
994292842 5:98050517-98050539 AGAACAAGTGCAGTGATTGCAGG + Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995310695 5:110707348-110707370 AGGGAGAGTGCAGTAACTGCAGG + Intronic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
995697908 5:114900389-114900411 AGGAAGAGTGTTGTGATTGTGGG - Intergenic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
997198020 5:131992495-131992517 AGGGAGGATGCAGTCATTCCAGG + Intronic
997265074 5:132490640-132490662 GGGAAGAAGGCAGAGGTTGCCGG + Exonic
998182362 5:139954366-139954388 AGGAAGAATGAAATGACTGGAGG + Intronic
1000422076 5:161049428-161049450 AGGCAGAATGTAGTTATTGGTGG + Intergenic
1001553120 5:172618634-172618656 AGGATGAAGGGAGTGATTGGAGG - Intergenic
1002798809 6:501819-501841 AGGAAGAATCCATTAATTTCTGG - Intronic
1003244927 6:4375565-4375587 AGCAAGAGTGGACTGATTGCTGG - Intergenic
1006611431 6:35296651-35296673 AGGAACATTGCAGGGATTGGTGG + Intergenic
1008192267 6:48474838-48474860 AGGAAGAATGCAGTAACTGTGGG + Intergenic
1008238792 6:49083692-49083714 ATGAAGAGTGCAGTGATGGTGGG + Intergenic
1009039463 6:58159102-58159124 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009215355 6:60913942-60913964 AGGCAGAATGCAGTGATTATGGG - Intergenic
1009596293 6:65740826-65740848 AGGAAGAGTGAAATGATTGATGG + Intergenic
1009680449 6:66885060-66885082 ATGAAAAAGGCAGAGATTGCAGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010089628 6:71965313-71965335 GGGTAGAAGGTAGTGATTGCAGG + Intronic
1011587694 6:88944523-88944545 AGGAAGAAAGGATTGATTGGTGG - Intronic
1012003509 6:93684305-93684327 AGAAAGAGGGCAGTGATTGGGGG + Intergenic
1012073796 6:94657774-94657796 AGGGAGAAAGCAGTGACTGATGG - Intergenic
1013831469 6:114277824-114277846 AGCAAGAATGCTCTCATTGCAGG + Intronic
1013899253 6:115133250-115133272 AAGAAGAATACAATGATTACTGG + Intergenic
1013908450 6:115245936-115245958 AGGAAGAGTACAGCGATTGTGGG + Intergenic
1014072300 6:117196899-117196921 AGGGAGAAAGCTGGGATTGCAGG - Intergenic
1014275609 6:119384876-119384898 AGGAAGAGTGCAGCGACTGCGGG - Intergenic
1016012259 6:139149576-139149598 AGGGAGTTTGCAGTGAATGCCGG + Intronic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1017438129 6:154436986-154437008 AGGAAGGATGCAGAGATGGATGG + Intronic
1017957304 6:159189295-159189317 AGGAAGAATCCTGACATTGCTGG - Intronic
1019103172 6:169648557-169648579 CAGAAAAATGCAGTGAATGCGGG + Intronic
1019605401 7:1907573-1907595 AGGAGGAAGGGAGTGATTCCAGG + Intronic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021123629 7:16825635-16825657 AGGGAGAATGCAGTGATTATGGG + Intronic
1021884984 7:25129436-25129458 AGGGACAGGGCAGTGATTGCAGG - Intergenic
1021899266 7:25267104-25267126 AGAGAGGATGCAGAGATTGCAGG + Intergenic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1024194524 7:47045972-47045994 AGGAAAAATGCAGAGCTGGCTGG + Intergenic
1024560890 7:50644405-50644427 AGGAAGAAGGCAGTGGAAGCGGG - Intronic
1024705956 7:51959785-51959807 AGGAAGAATGCAGTGACTGGGGG - Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1025239235 7:57257351-57257373 AGGAAGAATTCAGGAAGTGCAGG - Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1028266700 7:88734305-88734327 AGGAAGACTGTAGTGATTATGGG - Intergenic
1028648994 7:93129437-93129459 AGGAAGAATGTAATTATTTCTGG + Intergenic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1031368217 7:120930044-120930066 AGGAACAATGCATTGAATGGTGG + Intergenic
1031412599 7:121457440-121457462 AGGGAGAATGCTGTGACTGTGGG - Intergenic
1032681530 7:134189483-134189505 AGGAAGTCTGCAGTGGCTGCAGG + Intronic
1032803719 7:135336300-135336322 AGAAAGAATGCAGTGAAGGAAGG - Intergenic
1032819019 7:135507528-135507550 ATGAAGAATTCAGTAACTGCGGG + Intronic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1034925762 7:155120149-155120171 AGAAAGAGTATAGTGATTGCAGG - Intergenic
1035495127 7:159318372-159318394 AAGAAGAATACAATGATTGGTGG - Intergenic
1035785371 8:2255562-2255584 AAGAAGCATGCTGTGATCGCTGG + Intergenic
1035807437 8:2466154-2466176 AAGAAGCATGCTGTGATCGCTGG - Intergenic
1036561161 8:9901568-9901590 AAGAAGAAAGCAGTCAGTGCTGG - Intergenic
1038796472 8:30714924-30714946 ATGAAGGATGCAGTGCTGGCAGG - Intronic
1039738887 8:40361484-40361506 AGGAAGAATGCACTGGATCCAGG - Intergenic
1040289324 8:46116318-46116340 AGGAAGACTGCATGGAATGCTGG - Intergenic
1040289670 8:46117843-46117865 AGCAAGAAAGCAGGGAGTGCTGG - Intergenic
1040292147 8:46131004-46131026 GGTGAGACTGCAGTGATTGCTGG - Intergenic
1040293512 8:46137491-46137513 AGAGAGACTGCAGGGATTGCTGG - Intergenic
1040300072 8:46183398-46183420 AGTGAGACTGCAGTGAATGCTGG - Intergenic
1040301998 8:46192891-46192913 AGCAAGACTGCAGGGAATGCTGG + Intergenic
1040315164 8:46257131-46257153 AGGGAGACTGCAGGGAATGCTGG + Intergenic
1040331713 8:46389004-46389026 AGCAAGACTGCAGGGAATGCTGG + Intergenic
1040335767 8:46415181-46415203 GGGAAGAATGCAGGGAATGCTGG + Intergenic
1040341287 8:46442451-46442473 AGCAAGACTGCAGGGAATGCTGG - Intergenic
1041669632 8:60479402-60479424 CAGAAGAAGGGAGTGATTGCTGG + Intergenic
1041857670 8:62476945-62476967 AGGAAGAATGCTGTGACTTCAGG + Intronic
1042342767 8:67697281-67697303 AGGAAGACTGGAGTGAGTCCTGG + Intronic
1042839722 8:73111490-73111512 AGGAATGATGCAGTGCATGCAGG - Intronic
1043173066 8:76989581-76989603 AGAATGAATGCTGTGATAGCAGG + Intronic
1043552854 8:81394390-81394412 AGGAAGAAAGCTGTCATTTCTGG - Intergenic
1044183567 8:89224653-89224675 AGGAAGAAAAGAGTGAATGCAGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044612853 8:94111417-94111439 AGGAAGAAAGCATTCATTGAGGG - Intergenic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1045187762 8:99856328-99856350 TGAAAGAAAGCAGTGATTGAAGG + Intronic
1045816969 8:106288072-106288094 ATGCAGAATGCAGAGGTTGCTGG + Intronic
1045820849 8:106336162-106336184 GGAAAGAATGCAGTGGTGGCAGG + Intronic
1047181031 8:122588318-122588340 AGAAAGAGTGTAGTGGTTGCTGG - Intergenic
1048425069 8:134315888-134315910 AGTAAGGATGCAGTAATTGGTGG + Intergenic
1050248062 9:3713005-3713027 TGGAAGAGTGCAGTGACTGGGGG + Intergenic
1050697786 9:8298273-8298295 AGGAAGACAGGGGTGATTGCTGG + Intergenic
1050911970 9:11082684-11082706 AGGATGAAGGCAGGGATTGAAGG + Intergenic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1051552853 9:18349716-18349738 AGGCAAAATGCAGTCATTCCTGG + Intergenic
1052103925 9:24487941-24487963 AGGAAGAATGGAATAATTGTGGG + Intergenic
1052730927 9:32284305-32284327 ATGAAGAATACAGTGAAAGCTGG - Intergenic
1053086322 9:35226001-35226023 AGGAGGCATGCAGTGATGGGTGG + Intronic
1053527296 9:38843037-38843059 ATGAAGACAGGAGTGATTGCAGG - Intergenic
1053618657 9:39794413-39794435 AGTGAGAATGAAGTGATGGCAGG - Intergenic
1053876834 9:42553775-42553797 AGTGAGAATGAAGTGATGGCCGG - Intergenic
1053895842 9:42740930-42740952 AGTGAGAATGAAGTGATGGCCGG + Intergenic
1054199519 9:62067468-62067490 ATGAAGACAGGAGTGATTGCAGG - Intergenic
1054234863 9:62547947-62547969 AGTGAGAATGAAGTGATGGCCGG + Intergenic
1054265498 9:62913016-62913038 AGTGAGAATGAAGTGATGGCAGG + Intergenic
1054638836 9:67520889-67520911 ATGAAGACAGGAGTGATTGCAGG + Intergenic
1055012651 9:71583996-71584018 TGGAAGAATGCAATCAGTGCTGG - Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056635805 9:88330346-88330368 TGGATGAATGCTGTTATTGCAGG - Intergenic
1057317046 9:93976185-93976207 AGGAACAAAGCAGTGATTCTGGG - Intergenic
1057593665 9:96395676-96395698 AGGAAGAATTCAGTTATTTGGGG - Intronic
1058445797 9:105053802-105053824 AGAAAGAGTTCAATGATTGCAGG - Intergenic
1058522918 9:105829442-105829464 AGGGAGACAGCACTGATTGCAGG - Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1060192413 9:121601293-121601315 AGGAAGAATGCGGGGATAGGAGG - Intronic
1061687787 9:132296603-132296625 ACGTAGAATGCTGTGAATGCTGG - Intronic
1185728512 X:2442633-2442655 AGAAATAATGCAGTGATTTGGGG - Intronic
1187451457 X:19400441-19400463 GGGAACCATGCAGTGATGGCTGG + Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188651420 X:32635146-32635168 AGGGAGATTGCAGTGATTATAGG - Intronic
1192046107 X:67675597-67675619 AGGAAGATTGCAGTGACTGTGGG - Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192875348 X:75223645-75223667 AGGGAAACTGCAGTGATTGTGGG - Intergenic
1192925697 X:75752827-75752849 AGGAACAATGCAGTGTTGGATGG - Intergenic
1193777308 X:85658428-85658450 AGGAAGCTTGCAGTCATGGCAGG - Intergenic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194329120 X:92559648-92559670 AGGAATATTGCAGTGACTGGGGG + Intronic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195722225 X:107878071-107878093 GGGAAGAATACAGTGATTAAAGG - Intronic
1196215746 X:113050049-113050071 AGGGAGAATGCAGCAATTGTGGG + Intergenic
1196224161 X:113146027-113146049 AGGAAGAATGGGGTGACTGGGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196984459 X:121253358-121253380 GGGAAGAATGCAGTCTTGGCTGG - Intergenic
1197378505 X:125710535-125710557 CGGAGGAATGCAGTGATGCCTGG - Intergenic
1197621246 X:128752247-128752269 AGGTAAAATGCAGTAATTGGTGG + Intergenic
1198218647 X:134579657-134579679 AGGAAGAATGGAGTGTTCTCAGG + Intronic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1199129801 X:144171600-144171622 AGGAAGGATACAGTGATTTAAGG - Intergenic
1199603045 X:149554346-149554368 AGGAACAAAGCAGTGAAAGCAGG - Intergenic
1199647343 X:149925129-149925151 AGGAACAAAGCAGTGAAAGCAGG + Intergenic